TABLE 1

Oligonucleotides used in this study

PurposeOligonucleotideSequence
Knockout cassetteUBC9 5′flankFGTCACTCGAGAGGAACCTATGCCGTATTAGATACA
UBC9 5′flankRGACTAGATCTGTTTAAATAAATAAGTAAGCAGGTAGCTGCT
UBC9 3′flankFTTAGGGATCCGTAAGAGAATTTGCTGAAACCATG
UBC9 3′flankRATTAGCGGCCGCAGCCTATTCGATCATTATTT
PCR to confirm knockout linesUBC9KOupstreamFTTGTTATCCTTATGACCAAATTTTCTA
UBC9WTupstreamRTGAGCCTAATATTGATAGTCCTGCT
MTTpRTTTGCTAACCATAGCCAAAAT
RT-PCR assay of conditional linesUBC9WT5′UTRFTCAATTCAGATTCAGCGAAA
UBC9WT5′UTRRGCTGATTTCCAATCTTCTTCC
UBC9CodingF+startATCGGGTACCATGTAGCAACAAAATA
UBC9CodingR-stopACTGGAATTCGTCTTTTTTTTTCATGGT
GFP-UBC9 constructUBC9-startFCACCTAGCAACAAAATAAAGAAGTAAATGAATTAG
UBC9+stopRTCAGTCTTTTTTTTTCATGGTTTCAGCAAA
UBC9-mCherry constructUBC9CodingF+startATCGGGTACCATGTAGCAACAAAATA
UBC9CodingR-stopACTGGAATTCGTCTTTTTTTTTCATGGT
UBC93′FlankFATCGGCGGCCGCAAAATTCACAAATTAAA
UBC93′FlankRTGACGAGCTCAAAGGAGAGAACCAA