TABLE 2

Primers used in this study

PrimerPrimer sequence (5′ → 3′)
SEC15-5DRAAAAATACAGAAATCAACACCAAATAAATAACAGCGCAATACCATATAGCTCAGTACCAAACACCAATCAGTTTTCCCAGTCACGACGTT
SEC15-3DRGGTAAATAAATAGAGAAAAAATATAACAAACAGTTGAACCCACGGCATGTAATTACAATCACTATTTATATGTGGAATTGTGAGCGGATA
TetSEC15-5DRAAAGTGAATCCGAAAAAAAAAAGAGAGGACTACTTAGACCCCTCTGAGTTGGACAATACGAAAAAAAAAAGTAATACGACTCACTATAGGG
TetSEC15-3DRGAACTTGCTTGGAATACTTTCCATTCAAGGATGTCCTTGTTTTACTGTTCCTTATCTGTGTTGATGGCATCTAGTTTTCTGAGATAAAGCTG
SEC15-5DetCCGCCGCAAGGGTTTGTGCC
SEC15-3DetTCTGGGCATGGAAAATCTCG
tetSEC15-5DetGTGACAACACCATGTCCTCG
tetSEC15-3DetAGACTATCAACAACAGGCCC
RT-SEC15-5DetAGCTTCCCAGTGACATTCCC
RT-SEC15-3DetGGCAAAATTGGCTTCGTCGT
SEC15-5SOBGTGACAACACCATGTCCTCG
SEC15-3SOBAGACTATCAACAACAGGCCC
MLC1-GFP/NAT1-5DRAAAAGGGGTCAATGTAACTTCTGATGGAAATGTGGATTATGTTGAATTTGTCAAATCAATTTTAGACCAAGGTGGTGGTTCTAAAGGTGAAGAATTATT
MLC1 -GFP/NAT1-3DRTCAAGTACTACATAAAACTTCAAATAAACGGTATCCAATTCGAACAAGACTATACAATAACTATAATTTGCGTTAGTATCGAATCGACAGC
MLC1-5DetGATTCCAAGGTGTCAACTTTC
MLC1-3DetGGCATATATTACTCTCCAAAG
GFP-UPCACCTTCACCGGAGACAG
SPA2-GFP/NAT1-5DRGACGGTGGAAGAAGCTAGTCTTAAAGAAGATATTGCTTATCTTGATGCTAGAATAAGTCAAAATCTTGAAGGTGGTGGTTCTAAAGGTGAAGAATTATT
SPA2-GFP/NAT1-3DRTATACAAGAACATAAATACATCGCAATTTATTTTCTAATTTCTTTTTTTTCATTTTATTTATTCTCTAGCCGTTAGTATCGAATCGACAGC
SPA2-5DetGGGAGAAAAGCCTGATACTTC
SPA2-3DetTCGATAATTCCTACAAATAC
EXO70-GFP/NAT1-5DRCACGAAAAATAAATCAAAATACGTTAAGTATGATAAATTGAATTTTGAAAAGTTGTTGAACGAGAGGTTAGGTGGTGGTTCTAAAGGTGAAGAATTATT
EXO70-GFP/NAT1-3DRCTGTACCATTTCAGTTGATGTACAAAGAACCGTACACTACCAAAACACTAGTTGTACTTTATTTCCTATTCGTTAGTATCGAATCGACAGC
EXO70-NAT5DetACTGGTGGTGGGACTGTTAC
EXO70-NAT3DetTGAGTGGCGTGTATGTCAGC