Table 1.

Oligonucleotides used for the amplification of various fragments of the putative FDX5 promoter and the corresponding constructs used for reporter gene analyses

OligonucleotideSequencea
FDX5_revCACTCGAGTCTTTCGGAAGAGTCGCGACGGAC
FDX5_CL24CGGGCCCTACACCTTGGAGCCGAGATT
FDX5_CL27TGGGCCCTCACTGGAGGTACCGCAGGTGG
FDX5_CL30AGGGCCCGCGCGAGTGTACCTGAGGTC
FDX5_CL31TGGGCCCTCACTGGAGATACCGCAGGTGG
FDX5_CL32TGGGCCCTCACTGGAGATACCGCAGGTGGCGCGCGAGTATACCTGAGGTC
FDX5_CL36TGGGCCCTCACTGGAGGTACCGCAGGTGGCGCGCGAGTATACCTGAGGTC
FDX5_CL41CGGGCCCTACACCTTGGAGCCGAGATTGGCTTGGCGGTACTGGGGTGTCACTGGAGGTACCGCAGGTGGCGCGCGAGTATACCTGAGGTC
  • a ApaI and XhoI restriction sites are underlined. Inserted mutations are indicated in boldface type.