Table 1.

Primers used in this study

Primer namePrimer sequence (5′ → 3′)
SP/PfUIS4-B3DCATCTGAATAAAATGAAGGTTTCTAGGCATACCGTTC
ASP/PfUIS4-B3DACTAGTTTCATCTTTGTCTTTGTCCTCTTTA
SP/PyUIS4Prom-B3DCCGCGGGCTTCTTTGAGCAAATACTG
ASP/PyUIS4Prom-B3DACTAGTTTTATTCAGATGTAATTATGTGCTG
ASP/PyUIS4-B3DACTAGTTATGTATGGGTCAAATGGTT
SP/PyUIS4-B3D/3′UTRAAAAGCTTTTCATTATGAGGGTAATTCAGAAAG
ASP/PyUIS4-B3D/3′UTRAAGGTACCGACTTTTAAAAATAATATATATGAAA
SP/UIS4/T1TCTTTTATTCAGCGATTTTATGATGTTATATATA
ASP/UIS4/T1CGGGATCCCTAAGCTGCTAA
SP/UIS4/T2AAACACCATTTTTGAAAAGA
ASP/UIS4/T2CAAATGCTACATTATATGCA
SP/PfUIS4GAAGGTTTCTAGGCATACCGTTCTTTTAAA
ASP/PfUIS4/1CTAATTCCTCAGAGTCGGATCCATCATTCACC
ASP/PfUIS4/2GGTTCATTCTTGAAATATGGGTGTTCAATG
SP/PfUIS4/C-1GAATTCAATGAAGAGCTGGAAAAACAAAAA
ASP/PfUIS4/C-1GAGCTCTTTTCATCTTTGTCTTTGTCCT
SP/PfUIS4/C-2GAGCTCAAAGAGCTGGAAAAACAAAAA
ASP/PfUIS4/C-2AAGCTTTTCATCTTTGTCTTTGTCCT
SP/PfUIS4/C-3AAGCTTAAGAGCTGGAAAAACAAAAA
ASP/PfUIS4/C-3GCGGCCGCTTCATCTTTGTCTTTGTCCTCTTTAGAA
SP/UIS4/ORFTATAGGATCCAAAATGAAAACCACATACGTTTCTCTC
ASP/UIS4/ORFTAATGAATTCTATGTATGGGTCAAATGGTTTAT
SP/PF_CSPGAGAAAATTAGCTATTTTATCTGTTTCTTCC
ASP/PF_CSPATCAGGATTACCATCCGCTGGTTGCTTTAA
SP/PF_HSP70CCTGACGAAGCTGTCGCTTTAGGTGCTGCT
ASP/PF_HSP70TACACCTCTTGGTGCTGGTGGAATTCCAAC
SP/PfUIS4-KO/5′CCATTTATCATAAAATTGTGGTCC
ASP/PfUIS4-KO/5′GTCGATATCCTTCAACGCTCTCTTATCATCATTTGCAG
SP/PfUIS4-KO/3′GGATCCGACTCTGAGGAATTAGATAGTTCTAAAGAGG
ASP/PfUIS4-KO/3′GTAACAAGCACATTACGTACAG