Table 2.

Primers used in the study

Primer namePrimer sequencePurpose
Cht3F1CGACGCGTATGCTATACTTGTTAACTATATTTTCCHT3 overexpression
Cht3R1CTAGCTAGCATTATAGATAACCACTGTACTTGGT
Sun41F1ATGAGATTTTCACAAGCTACTGTTSUN41 overexpression
Sun41R1CTAGCTAGCATTATACAAGACAAAGTCAGCTTC
qCht3F2ACTACCTCCACAGCACCAACqPCR
qCht3R2GTAGAAGTGGCAGGTTTAGTTG
qSun41F2TGTGAATGGGGTGTCAAGAAqPCR
qSun41R2AGCACCACCTCTCCAAGTGT
qAct1 F1GAAGCCCAATCCAAAAGAqPCR
qAct1 R1CTTCTGGAGCAACTCTCAATTC
qAls3 F1CGGTTGCGACTGCAAAGACqPCR
qAls3 R1GACCAACCCAAAACAGCATTCC
qHwp1 F1CAGTTCCACTCATGCAACCATCqPCR
qHwp1 R1GCAATACCAATAATAGCAGCACCG
qYwp1 F1CTG ATA TTC GTA ATG CTG GTA AAG TGqPCR
qYwp1 R1GGA GTT TCA CCC ATT AAT CTT CTT C
qEce1 F1CCGGCATCTCTTTTAACTGGqPCR
qEce1 R1GAGATGGCGTTCCAGATGTT
qCax4 F1TCAATTCATGGGATTTTTCGqPCR
qCax4 R1CCCCGTAATTAATCCAGCAA
qNrg1 F1TGCAACCCCAACAAACACTAqPCR
qNrg1 R1TGACGTTGTTGATATGATGCTG
qTec1 F1TGGTGCTTATTCACGTGTCCqPCR
qTec1 R1GTGGTGGTCATGCCAATAGT
qRBT4 F1CGATGCTGATGGTGGTAATGqPCR
qRBT4 R1TTGGTCATCTGAAGGGAAGC