TABLE 2.

Oligonucleotidesa

OligonucleotideConstruct(s)Sequence (5′−3′)Site(s) added
External deletions
    TX2025−2025GGCCTCGAGAATTATCGGGTGATTAATAACATGCXhoI
    TX1902−1902GGCCTCGAGGGTAATTATTGGAATGAACGTGXhoI
    TX1840−1840GCCTCGAGACTAAATAGGTAATTGTTTATTTTTAGCXhoI
    TX1782−1782GGCCTCGAGCTAATGATTGTGACTATTGAAAATGXhoI
    TX1657−1657GGCCTCGAGTGGGTCTAGTAATGTTGTGCXhoI
    TX1535−1535GGCCTCGAGGTAAACAAACTCCCACAACCAATCGXhoI
    X2−1410GGCTCGAGGATCTTTCTTTTTCATTTCCCXhoI
    T1365−1366CCGCTCGAGGTGGAAATAAAGCTATGATAAATGXhoI
    T1288−1289CCGCTCGAGTGTTGTTGTCCTCGTCTCGXhoI
    T1241−1242CCGCTCGAGCAAGAAATACAGGAAACCCTCCXhoI
    T1208−1209CCGCTCGAGTTTGGACCTTACACGCACXhoI
    X259−1153GGCTCGAGGAAACATACGATATGTTATTCTTTXhoI
    X348−1063GGCTCGAGGGTAAGAGTTGCCTAACCATTGXhoI
    X580−831GGCTCGAGCCACTAATTCCATCAATAAAATXhoI
    X608−803GGCTCGAGGTGTATTGTTCTCTTCAGTACATTXhoI
    X856−555GGCTCGAGCTCGACTAATCGACTTTACATCAAXhoI
    X1271−140GGCTCGAGCATAGCAACTCTTGTAAAGTCXhoI
    B425ExternalGAATTCCTTGTTTTTGGATCCAAAGEcoRI, BamHI
    H39ExternalGGAAGCTTATTGACGAAACTAAAAGCGHindIII
Internal deletions
    BX1042E, K2GGCCTCGAGCAATGGTTAGGCAACTCTTACCXhoI
    BX1289K2GGCCTCGAGACGTACTTTTTAACTGTCAAACGTG
    BX1657MCCGCTCGAGAGCTAAGAGTTTTTTATGGCATTCXhoI
    T1042SGAAAATAATAGGCTAAGGTTTTTCCTGATGCG
    B1411SCTTTATATGCTAGCAATAAAGTCAAAGAACAAGG
Other constructs
    E15 forGGAGATATCGATTGACCGTATTTCTTCEcoRV
    E15 revGGCGATATCTTGTCGACCAAGCTAAGATTEcoRV
    HCR forGGGCTCGAGAGATCTTTCTTTTTCATTTCCCTTAAAACCGATCAAXhoI
    HCR revGGGGATATCAGATGGTTAGGCAACTCTTACCTTTTCATTTCCEcoRV
    TRO6 forAGATCTTTCTTTTTCATTTCCCTT
    TRO6 revTATTATGGCAAGTTTATCCGCAAT
    NHP-h6 XhoAAAACTCGAGATGCATCATCATCATCATCATGCTCCAGGTGAAAGAAAGAAGTCCXhoI, His6 tag
    NHP-h6CACCATGCATCATCATCATCATCATGCTCCAGGHis6 tag
    NHP SpeAAAAACTAGTTAGGCGGAATTCTTTTTAGCGTATTCAGCCSpeI
    mtHMG forCACCATGTTGAGATCATTTGTAACATCTATTAGTCC
    mtHMG revAAAGTCATCCTCCACTTTGTAGTTTTCC
    HTB1 forCACCATGGCCCCAAAAGCAGAAAAGAAACCAGC
    HTB1 revACTAGAAGCAGATGAGTATTTTGTGACG
    HTA1forCACCATGTCAGGTGGTAAAGGTAAAGCAGGAACTTCC
    HTA1 revCAATTCTTGAGAAGCCTTAACACCACC
    ENO2 forTTGTGGGCCAGACAACCATTTAG
    ENO2 revCCAAAACGTTTTGAACGGTGGTTCC
  • a Underlining, primary engineered restriction site; boldface type, additional engineered restriction site or His, tag.