TABLE 1.

Primers used in this study

Gene or vectorFirst primerSecond primer
NameSequenceaNameSequencea
Actin, RT-PCRAct1-sTTCTCCACCACTGCCGAGCGAct1-aGCGGTGAACGATGGAGGGAC
Actin, RT-PCRAct2-sAATGGTTCGGGTATGTGCAAGGAct2-aGGGACCGCTCTCGTCGTACTC
SCD1, RT-PCRScd1-sTGGGAGGCGATGCCAGCGGATScd1-aGCTCGCGGCCCTCTGCAAACA
BRN1, RT-PCRBrn1-sTGGGTGGCCGCATTATCCTCABrn1-aGAAGCAGACGACGCGGGCAAT
BRN2, RT-PCRBrn2-sCATTGCCGCTGGTCTTCTCGGBrn2-aAAGCCACAACCCTCGCAACAT
CMR1, RT-PCR, transformant verificationctrl-sGCAATCATCGCCGCCCAAGAV-aaacaggtaccGACGGCGGGCGAACATCCAG
CMR1, transformant verification and intron analysissGCCAATCCAATCTGCCCCATaCAATGCGAGAGGACAGCGAAA
CMR1 deletion vector, 5′ flankd-SacI-stacgagcTCCCTGCCATCGCTGAGTCTTd-XhoI-aaggctcgAGGGGTTGTTGGTGATGGCTG
CMR1 deletion vector, 3′ flankd-NheI-statgctAGCGGGCGTCTTCGGCGTTGd-BglII-acatagatCTGCCAAAGACAATCAACACTGG
CMR1 genomic sequence outside 5′ and 3′ flanks5′oCCGCACGCACCTCCACCTCG3′oGCAAGAAGAGGAGGATGGATGG
Hygr cassette, promoter and terminatorptrpGGTCGTTCACTTACCTTGCTTGttrpGGTGTTCAGGATCTCGATAAG
ttrpeGTGAATGCTCCGTAACACCCAATAC
CMR1p-GFP vector, GFP RT-PCRGFP-BamHI-sgaagGATCCCATGGTGAGCAAGGGCGFP-SpeI-atgaactagtCTTGTACAGCTCGTCCATGCCGT
CMR1p-GFP vector, CMR1 promoterp-XhoI-scaactcgAGCACCGGGCAGGACAGGACTp-BamHI-acaaggATCCGGCTCGAATGTCTACTGCTC
CMR1p-GFP vector, 3′ flank3′-BglII-staccatagatCTCCTCGTTTGTTCATTCGCCC3′-SacI-ataggagcTCAAGTGGGCGGGTGGTTGTA
Mating type-specific gene MAT1-1MAT1-1sGTCGTCGATGGTGATGAAAGAAAMAT1-1aCCGCACTGGAGCTCAAATGGT
Mating type-specific gene MAT1-2MAT1-2sGTTGCATCTCCGTCTGCGCCAMAT1-2aGGCTGCAAGGATGACTGGCAT
  • a The lowercase letters represent sequence with no homology to template DNA, whereas homologous regions are shown in uppercase.