TABLE 2.

Oligonucleotides used in this study

OligonucleotideSequence
Oligonucleotides used for a wild-type HIS1 gene cloning and HIS1-pTR cassette
    5′-His1CGGGATCCAGAATGTGCCGTTGTGTTTG
    3′-His1CGGGATCCGTACCAGGTGAACTGTTTAATTG
Oligonucleotides used for generating his1 null mutant required for GPI gene overexpression library construction
    HISKN-1AAAGGGCAGATTATACGAAAAATGCTGTAACTTATTGAGTGGTGCCGATATACAGTTTAGAGTTTTCCCAGTCACGACGTT
    HISKN-1BAGATCTAATAGATTAGATATAGCACTTTCTACAAACTTGCCAATTGCATTAATCTTCTTGGTTTTCCCAGTCACGACGTT
    HISKN-2ATTAAAGGTGTGTACATCAAGGTGGTAGATAAAGATGGTATAAGACAGATTGAGTCAAATTTGTGGAATTGTGAGCGGATA
    HISKN-2BTCTACAATTTGATATCTCGAGTACCAATATATCGGTTGCACCAGCTTTCTTCAATTCGTCTGTGGAATTGTGAGCGGATA
    HisConfirm1CCAGACCGTTTGTTATTTGCTG
    HisConfirm2GTCAAGGAATTACAAACGAGAATGC
    5-detectGTTTTCCCAGTCACGACGTTGTAAAACGAC
    3-detectTGTGGAATTGTGAGCGGATAACAATTTCAC
Oligonucleotides used for making and confirming IFF4 conditional overexpression/suppression strain
    P1ACCACCATATTGCGCTTTTCTA
    P2ACAGCTTTATCTCAGAAAAACTAGTTCCGTTTTCTTTCACGTCAAC
    P3CGACAAACACAACGGCACATTCTGGCTTTAACGATTTGCAAAATTTAG
    P4ACCACTGTTGGTAATAGATCC
    PH1GTCGTCGCTGTGTTTGTC
    PH2CGTTGGAGAAGGTAATTGTGA
    P5AGTGGAATCACCATTAGCAGA
    P6CTAAATTTTGCAAATCGTTAAAGCC
    IFF4KN1GCACCAATCTCATCAAGTGAGTTTATTAGTTTGGAATCGTGTTTTCCCAGTCACGACGTT
    IFF4KN2GGATGTTTCAAACGGTAATTCGCTCCAACAAGAGGGTTCATGTGGAATTGTGAGCGGATA
    IFF4CONF1CACTTTAGCTAAAGTATCATCTACTG
    IFF4CONF2TTCGGAATAGGATGGTTTGAC
Oligonucleotides used for detecting IFF4 in vivo expression
    IFF4 specific 1CTGCACCAATCTCATCAAGTGA
    IFF4 specific 2GATCCACCAGCACTTGAGGA
    EFB1aATTGAACGAATTCTTGGCTGAC
    EFB1bCATCTTCTTCAACAGCAGCTTG
Oligonucleotides used for confirming URA3-IRO1 in its original locus
    URA3 Conf1TGCTGGTTGGAATGCTTATTTG
    URA3 Conf2TGCAAATTCTGCTACTGGAGTT