TABLE 2.

Primers used for qRT-PCR analyses

PrimerSequence
CDC24b+GGCCACCAATGCGTCAAC
CDC24bTAGCTGGTAAAACCCCTGCAGTA
CDC24c+ACGTGATTCCGACCTGTCATTTA
CDC24cGATGGCGGGAACTGTGAGA
CDC42c+TCCCCAATCACCCAGGAA
CDC42cTGCAGCTACTATAGCCTCGTCAA
CDC42d+GGGTGAAAAATTGGCTAAGGAA
CDC42dCCTCTTTGAGTCAATGCAGAACA
ACT1+ATGTTCCCAGGTATTGCTGA
ACT1ACATTTGTGGTGAACAATGG
ECE1+CCAGAAATTGTTGCTCGTGTTG
ECE1CAGGACGCCATCAAAAACG
HGC1+AAAGCTGTGATTAAATCGGTTTTGA
HGC1AATTGAGGACCTTTTGAATGGAAA
ALS8+TTGGCAACGTGCACCTTTC
ALS8GTGGTCACGGCGGTAGTACTG
HWP1+CGGAATCTAGTGCTGTCGTCTCT
HWP1TAGGAGCGACACTTGAGTAATTGG
HYR1+CTCAACCTCAGTGCTGCATTAGAA
HYR1AGCCCAAGTAGCACCAGAATGA
SAP5+CAATTATTTGCTAACGTTTGGTCTACTAG
SAP5CTTCGCCGCTTTGAAAACC
SAP6+TCTCCAGGGTTTGTTACCTTAGACTT
SAP6TTAGATTCGGCAGTTGGATCATC
CPH1+GGTGGCGGCAGTGATAGTG
CPH1GTGTACTCCGGTGACGATTTTTC
TEC1+TGGATTCATACCGTATTGGTCATTA
TEC1TCGGGCAATCCTTTGAATAAA
EFG1+TCCCACCACATGTATCGACAA
EFG1GAAGTGCTCGAGGCGTTCA
RIM101+AAGTGACGATTGATGGGTTCAATT
RIM101GCCAAGAACAGCATGGATCATT
CZF1+TAGGCGGTCCACCATTTCC
CZF1GGATAACCAGTGTTTGGCATATACC
NRG1+ACCAACAACCCATGTACCAAAAC
NRG1ATTAGCCCTGGAGATGGTCTGA
TUP1+CTCAAAGGACCGTGGTGTCAT
TUP1GGCCCTGCAACATCAACAAT
BEM2+GATTTATTCCCCCGAGAGTCGTA
BEM2CCCTTCACGATGGGTTAATGTT
RHO3+AAGGGTGTTAACGAAGCATTTTCT
RHO3CATTGTCATTGGCACCTTTAGG