TABLE 2.

Oligonucleotide primers used for real-time PCR

Primer namePrimer sequence
ACT1FTTGGTGATGAAGCCCAATCC
ACT1RCCATATCGTCCCAGTTGGAAA
GSY1FTGCCTTGCCATTATGTAGAAAAAG
GSY1RTCGGTACTACCAGCACACAAGTATC
PFK1FTGATGCTCCTGGTATGAATCCA
PFK1RCGGCATAAACATCACAACCATAA
TPS3FAGCACAATCCCCGTTGGTATAG
TPS3RTCCGCCATTCTGTGACTTGTT
ACO1FTCCACCAGAAGACCGTGCTT
ACO1RTTACCATCCCATGGTTTGAATG
IDH2FCTGGGAACCAGTCGATGTCA
IDH2RACGGAGTCAACAGCTGGTTGT
FUM12.3FTGATGTTGGTCACTGCATTGAA
FUM12.3RTTTTGTGAGCGTTCTTTGCAA
ORF19.5267FCAACTACCACTGTTCTTGCCAGTAC
ORF19.5267RTGTTATCATCACTACTTGAGGGATCAG
CHT3FAGAGCCGCTGGATCAGGTTA
CHT3RTGAAACATCCCACATTGAAATACC
DSE1FCCCAGAAAAAAACCATAGCAGTACTA
DSE1RCTTGTCATGGATTTGTGCAGTATTATAA
PGA38FTCAACTACCATTTCCTCACTATCATCA
PGA38RGATGACAAGTTCGGTGCAACA
SCW11FCTACACTTCCAGCACATCCTCAA
SCW11RGGCCGGAATATCTCCACTAGAA