TABLE 2.

Oligonucleotide primers used in this study

PrimerSequencea
sla1FL5′TAGTCGAC(SalI)ATGCGGCCGGC(NotI)ATGTCAACTGAAGAACAGAAGG3′
5′TAGTCGAC(SalI) TTAGCGGCCGC (NotI)ACTCCGAAGCGGCCGAAGGCT3′
sla1ΔC5′-TAGTCGAC(SalI) ATGCGGCCGGC (NotI)ATGTCAACTGAAGAACAGAAGG3′
5′-TAGTCGAC(SalI) TTAGCGGCCGC (NotI) TGAGCTCGTCCTCGCCCC3′
sla1La5′TAGTCGAC(SalI) ATGCGGCCGGC (NotI) ATGTCAACTGAAGAACAGAAGG3′
5′TTTGTCGAC(SalI) TCAGCGGCCGC (NotI) TTTCCATGACGCTCTTG3′
sla1RRM5′ATGTCGAC(SalI) TAGCGGCCGC (NotI)ATGAGTCCTGAACTTCTT3′
5′TAGTCGAC(SalI) TTAGCGGCCGC (NotI) TGAGCTCGTCCTCGCCCC3′
sla1CT5′AAAGTCGAC(SalI) TGCGGCCGC(NotI) ATGGAGCTCACTATAATG3′
5′-TAGTCGAC(SalI) TTAGCGGCCGC (NotI) ACTCCGAAGCGGCCGAAGGCT3′
sla1ΔRNP15′ATGTCGAC(SalI) TAGCGGCCGC (NotI) ATGAGTCCTGAACTTCTT3′
5′-TTAGCGGCCGC(NotI) TAAATTTTTTATCGTC3′
sla1ΔRNP215′AAAGCGGCCGC(NotI) ATGGGTGATGAAAAAGAT3′
5′TTAGCGGCCGC(NotI) TAAATTTTTTATCGTC3′
sla1ΔRNP25′AAAGCGGCCGC(NotI) ATGGGTGATGAAAAAGAT3′
5′TAGTCGAC(SalI) TTAGCGGCCGC (NotI)TGAGCTCGTCCTCGCCCC3′
sla1RRM(FS)5′TAGCGGCCGC(NotI)ATGGTCCTGAACTTCTT3′
5′TAGTCGAC(SalI) TTAGCGGCCGC (NotI)TGAGCTCGTCCTCGCCCC3′
Mutagenesis primer (KRRR to KELR)5′AAAGAGCTCCGTTTTGACGCTTTT3′
5′AAAGAGCTCTTTGCTGCTAAACTT3′
  • a The upper and lower sequences indicate the sense and antisense primers, respectively. The boldface and underlined sequences in the mutagenesis primers indicate the mutated region. Restriction enzyme sites are underlined.