TABLE 2.

PCR primers used in this work

PrimeraNucleotide sequence (5′→3′)b
mfαdelFATCACCAACAAACTACTAATCACTCTATAACATCAACTAATTAAATCAACAAAAATAACAGTTTTCCCAGTCACGCGTT
mfαdelRTTCATCTAAACAAACATAAAAGTATGATTTCAGTATGCTTTCCATCTTCTTTACTTACTTTGTGGAATTGTGAGCGGATA
5′-detect (1)TTTTTCATTAAGACCATCATC
3′-detect (2)ATAATGGAGATAGAAACTTT
Ura3detect (4)AGACCTATAGTGAGAGAGCA
ORFΔdetect (3)AAGGAAAAAAGCGGCCGCGAAGCTAAGTCTAAAGGTGG
mfαNotIFAAGGAAAAAAGCGGCCGCGGTTTTAGTTTATATTCAAATCAGG
mfαMluIRCGACGCGTAAATATTGCATAACAATAACA
MTLaFTTGAAGCGTGAGAGGCAGGAG
MTLaRGTTTGGGTTCCTTCTTTCTCATTC
MTLαFTTCGAGTACATTCTGGTCGCG
MTLαRTGTAAACATCCTCAATTGTACCCGA
KEX2FGTTGAAAGAGGAAAGAAGAGGCGG
KEX2RCGTCATCAGCACGCCTAGTGTCGG
  • a Primers mfαdelF and mfαdelR were used to amplify both the HIS1 and the URA3 cassettes from the plasmids pGEMHIS1 and pDDB57, respectively. The numbers in parentheses are used in the text to describe the deletion strategy.

  • b Restriction endonuclease recognition sites are in bold. NotI, 5′-GCGGCCGC-3′; MluI, 5′-ACGCGT-3′. Sequence homologous to the vectors are underlined.