TABLE 1.

Primer sequences for RT-PCR experiments

PrimerSequence (5′-3′)
HSP12 5′AGAGTCAATTTCTCTAGTAGAGGT
HSP12 3′AACTCCACTCACGTATTCAGCA
FLO1 5′AGTGCATTATTTGCTGCTACC
FLO1 3′AGCATGACAAGCATCATTATGA
MNN4-4 5′AGTTGAAAATCCAAGTGAAGGATACGG
MNN4-4 3′CAAAATCATGGAATCTTGTCAACGATCTC
CHK1 5′TCCCCAAATGCCTGAAATGGAC
CHK1 3′GCTACGATCACGGGTAACCAAC
AHP1 5′ATGTCATTTAAAGAAGGTTCC
AHP1 3′CTTGGCTAAAACAGCATCAAT
PYC2 5′GAAGGTGATGATATTGAAGAT
PYC2 3′GACCAACATAGAATCATAATG
ALS1 5′CAGGATACCCAACTTGGAAT
ALS1 3′CCAGTATTCAGTAGTAGTGA
GPH1 5′GGATTATCTTACCCCATCAACT
GPH1 3′GTCATTTGGATACAACACTGA
STL1 5′AGAACCACAACTGCTGGATTA
STL1 3′AGCTTCAGCAACAATAGCATC
ACTIN 5′GACGGTGAAGAAGTTGCTGC
ACTIN 3′CAAACCTAAATCAGCTGGTC