TABLE 2.

Oligonucleotides used in this study

NameSequencePurpose
CGL2p-GFPGTATCACCAGTCTAACATCATGCTCAAGGGCGAGGAGCTGTTCACCCloning of cgl2::GFP fusion
CGL2 Stab-STOP-GFPAGGGGGAAGTGGGGGGAGCAATCCATGGACCTACTTGTACAGCTCGTCCATGCCGCloning of cgl2::GFP fusion
426cgl2-BamHI-tub1000-fwdGCGTAATACGACTCACTATAGGGCGAATTGGGATCCAATAAGGATACACATGATCGCloning of benAp
426cgl2-tub1000-revGGAAAGTCGAATGCCTACTTGGCTTTGAGCTGGGAACGCGAGGTCAGCCloning of benAp
Up-pRS426-Cc TRP1fwdACGACTCACTATAGGGCGAATCCATGATGATGACGGTAGACCloning of trp1
Down-benA-Cc TRP1revGATCATGTGTATCCTTATTAGATCTGAGTCGGTACTTCAAGTTCCCCloning of trp1
Up-pRS426-pab1fwdACGACTCACTATAGGGCGAATTGCGAAGCAACTGAAGGAGCCloning of pab1
Down-benA-pab1revGATCATGTGTATCCTTATTGGATCCTTCTTCTGGCATCTTTCCTCCloning of pab1
Down-pRS426-pab1revGTCGACCTCGAGGGGGGGCCCTTCTTCTGGCATCTTTCCTCCloning of pab1
benAlnt4-GFPrevTAATTTTGGCCAGCACAACGCATGCTTGCGACAGGGATACATACCCTGCAGGCACTTGTACAGCTCGTCCATGCCloning of cgl2::GFPhp
benAlnt4-GFPfwdAGCATGCGTTGTGCTGGCCAAAATTAATGATCATCACGTGATAGGCTTCCAGATCTTGTACAGCTCGTCCATGCCloning of cgl2::GFPhp
CGL2-GFPrevAAGTGGGGGGAGCAATCCATGGACAAGGGCGAGGAGCTGTTCCloning of cgl2::GFPhp
155 (GFP fwd real time)ACATGGTCCTGCTGGAGTTGenomic PCR and qRT-PCR of cgl2::GFP
68 (CGL2-Term)CGAACCGCTCTGAGGGAGGGenomic PCR of cgl2::GFP and cgl2::GFPhp
39 (GFP-(270)rev)GCCTTCGGGCATGGCGGGenomic PCR of cgl2::GFPhp
Down-CGL2-pab1revTCATTATCACGGTGGAACGGTTGCTGGATCCTTCTTCTGGCATCTTTCCTCCloning of pab1
185 (RT-PCR-rev-cgl2)CCAGCGAGAATCCTAAGCAqRT-PCR of cgl2::GFP
186 (RT-PCR-fwd-benA)GTCATGTCCGGTATCACCACqRT-PCR of benA
187 (RT-PCR-rev-benA)GGGAAAGGAACCATGTTGAqRT-PCR of benA
CGL2-RNAi-II5GTTGGTCTCTTTTTGGATTCTTGCloning of cgl2hp
CGL2-RNAi-OO3GTATGAAGTCCGTTGGTGTCGCCloning of cgl2hp
CGL2-RNAi-O5CGGCGCCTGGGGCCCGGAGGCloning of cgl2hp
CGL2-RNAi-I3TCTCTTGAATTCTCTTGAAAGCAGGGGGAAGTGGGGGGCloning of cgl2hp
CGL2-RNAi-I5TTCAAGAGAATTCAAGAGAAGCAGGGGGAAGTGGGGGGCloning of cgl2hp
CGL2-RNAi-O3GCAAGAATCCAAAAAGAGACCAACAAACCTAATGCTCTACCACCTTTTCGTCCloning of cgl2hp
61 (GFP)ATGAGCAAGGGCGAGGAGCGFP hybridization probe
134 (GFPrev)CTTGTACAGCTCGTCCATGCGFP hybridization probe
71 (Cgl2FusSeq2)AGTGATATCCGGTGGTCAGCcgl2 hybridization probe
184 (CGL2ORFRev2)TCAGCGTACGGGATGCGTTCcgl2 hybridization probe
119 (07pab2006fwd)TTGTGGCGTTGAAGAGTACGpab1 hybridization probe
120 (07pab2637rev)CATGGCTGATGCTTAATTGCpab1 hybridization probe
54 (TRP1F-Forward)GCCGGTCTCGACTATCCAGGTGTAGGtrp1 hybridization probe
38 (TRP1SeqTerm)GACCCCCTCAAACACTATTGGtrp1 hybridization probe
180 (Cgl3PromFwd)TCTGCCTCTGCTAGCTTGTCcgl3 hybridization probe
126 (CGL3rev)ACGGTTGATTCGAGTCTGcgl3 hybridization probe