TABLE 2.

Oligonucleotides used in this study

PrimerSequence (5′ to 3′)Comment(s)
FR55ATGACCATGATTACGCCAATdENA1 and TdCRZ1 sequencing
FR77GTAAAACGACGGCCAGTTdENA1 and TdCRZ1 sequencing
FR94AATCATCGGCAACCTTAGTdCRZ1 sequencing
FR103GGCGACATGCTACGACTTCTdCRZ1 sequencing
FR136GTGGTTAAATAGGACATCGCTdCRZ1 sequencing
FR90TGCTACTGAAAAGACAAGGTdENA1 sequencing
FR96GCTTACAGGCGAGGAATTTdENA1 sequencing
FR135TGAGTCCTTGCCTATCGCTdENA1 sequencing
FR110CCTCGTTCTGCTTTGACATdENA1 sequencing
FR117CAGGATATCAAGGGTAAGCTTdENA1 sequencing
FR376AATGGTTCAGACGTCGCTdENA1 sequencing
FR377CCAGCTGATCACTTCGGTdENA1 sequencing
FR101CCTAAAGCCCAAACTATAACATdCRZ1 sequencing, verify correct targeting of the natMX4 module
FR142CGAAGTCGACAGCTCAATCAPCR amplification of TdCRZ1 3′ side
FR141TGAATTCGGGTAAGAAAAGGPCR amplification of TdCRZ1 3′ side
FR140CATTGAGCTCCTTGGAAGGPCR amplification of TdCRZ1 5′ side
FR139ATTCGGATCCTAAGTCACTCPCR amplification of TdCRZ1 5′ side
FR126TTCAGTGCCGAAGGGACTACVerify correct targeting of the natMX4 module
FR76GTCAAGGAGGGTATTCTGGVerify correct targeting of the natMX4 module
FR75AGTTAAGTGCGCAGAAAGVerify correct targeting of the natMX4 module
FR96GCTTACAGGCGAGGAATTTdENA1 probe for Northern blotting
FR121GCTGCACCAACAGACAAAGTdENA1 probe for Northern blotting
FR390GGTATGTTCTAGCGCTTGACT1 probe for Northern blotting
FR391TCTGGGGCTCTGAATCTTACT1 probe for Northern blotting