TABLE 1.

Primers used in this study

NameSequence (5′-3′)aPosition (promoter or gene)b
Xyn1F-vivo1CTCAAGCAACTACGTAAAACTCCATG−524 to −499 (xyn1 promoter)
Xyn1F-vivo2CACTGGAATACAACATCCTCCGCAAG−481 to −456 (xyn1 promoter)
Xyn1F-vivo3GGAATACAACATCCTCCGCAAGTCCGAC−477 to −450 (xyn1 promoter)
Xyn1R-vivo1ATAGATTGAACGCCACCGCAATATC−276 to −300 (xyn1 promoter)
Xyr1R-vivo2TATGGCAGTAATGCATCGAACCCGG−332 to −356 (xyn1 promoter)
Xyr1R-vivo3GCAGTAATGCAATCGAACCCGGCGCTT−336 to −361 (xyn1 promoter)
Xyr1-4fACIGAC/TGAC/TGTIGTIACITAC/TATA/C/TCA(xyr1 gene)
Xyr1-7rTAA/G/TATICCA/GAAA/GAAA/GAAIGGCATA/GAA(xyr1 gene)
xyn1outfGTCGAGGTCGACGCAAATGG−538 to −526 (xyn1 promoter)
xyn1outrGTGAGTTCAGGCTTTTTCATCTAGAGATG20 to 1 (hph gene)
xyr1M1fGATTGGCAGTCTAAATGCGACATCTT−445 to −420 (xyn1 promoter)
xyr1M1rAAGATGTCGCATTTAGACTGCCAATC−420 to −445 (xyn1 promoter)
xyr1M2fGCGACATCTTAGACGGATGCAC−429 to −408 (xyn1 promoter)
xyr1M2rGTGCATCCGTCTAAGATGTCGC−408 to −429 (xyn1 promoter)
xyr1M3fGCCCCTTGACTTGAAAGGCAGGCT−457 to −434 (xyn1 promoter)
xyr1M3rAGCCTGCCTTTCAAGTCAAGGGGC−434 to −457 (xyn1 promoter)
xyr1ExfCGAGGATCCGAGCTTTCGAGTTCACGCATG163 to 183 (xyr1 gene)
xyr1ExrTTTCTCGAGCTCAATGTGGCCATGAG651 to 635 (xyr1 gene)
Prxyn1.1fTTGGCAGGCTAAATGCGACATCTTAGCCGGA−430 to −400 (xyn1 promoter)
Prxyn1.1rTGCATCCGGCTAAGATGTCGCATTTAGCCTG−396 to −426 (xyn1 promoter)
Prxyn1.1M1fTTGGCAGTCTAAATGCGACATCTTAGCCGGA−430 to −400 (xyn1 promoter)
Prxyn1.1M1rTGCATCCGGCTAAGATGTCGCATTTAGACTG−396 to −426 (xyn1 promoter)
Prxyn1.1M2fTTGGCAGGCTAAATGCGACATCTTAGACGGA−430 to −400 (xyn1 promoter)
Prxyn1.1M2rTGCATCCGTCTAAGATGTCGCATTTAGCCTG−396 to −426 (xyn1 promoter)
Prxyn1.2fCCCCTTGACTTGATTGGCAGGC−443 to −422 (xyn1 promoter)
Prxyn1.2rGGGAGCCTGCCAATCAAGTCAA−418 to −439 (xyn1 promoter)
Prxyn1.2M3fCCCCTTGACTTGAAAGGCAGGC−443 to −422 (xyn1 promoter)
Prxyn1.2M3rGGGAGCCTGCCTTTCAAGTCAA−418 to −439 (xyn1 promoter)
Prcbh1fATATACCAGCGGCTAATAATTG−789 to −768 (cbh1 promoter)
Prcbh1rTGTACAATTATTAGCCGCTGGT−764 to −785 (cbh1 promoter)
Prcbh1mut2D2fATATACCAGCTTATAATAATTG−789 to −768 (cbh1 promoter)
Prcbh1mut2D2rTGTACAATTATTATAAGCTGGT−764 to −785 (cbh1 promoter)
  • a Letters underlined by single lines indicate identified regulatory elements, double lines mark introduced restriction sites. Bold characters indicate mutations within identified motifs.

  • b Positions of the oligonucleotides in the respective promoters or genes are given.