TABLE 1.

Primer pairs used in recombination and structural analysis of the C. neoformans MAT locus

Primer pairSequenceTm (°C)a
Pairs used in recombi- nation analysisb
    JOHE7607 (6)ATAGACATCCTCAACTTGTCCAC66
    JOHE7608AAGTTCAGCTGCTGAACGATCG
    JOHE7609 (5)TTGAGCGTCATATTGGTCATGAC66
    JOHE7610GAAGACCGTCATCACACACAAG
    JOHE7611 (8)GGACGACACTGTCACAATCATC66
    JOHE7612GAAATCGCACCGTGAGCTGAG
    JOHE7613 (7)GAACGACACTGTCACAATCATG66
    JOHE7614GAAATCGCACCGTGAGCTTCC
    JOHE7615 (3)GGTGTGCGAGGATGTAGTATGG66
    JOHE7616ATCCGCTCCTTCTATCAGTTCC
    JOHE7617 (4)TTCGACCTGTGATAGCTCTTCC66
    JOHE7618TGCTTGACTCGGAAGAGGAGC
    JOHE7619 (1)GATTCCATTCCACTTGCATTACG66
    JOHE7620GTGAGGAAGGTAGGGGAGTAGT
    JOHE7621 (2)CCATTCCACTTGCATTATTATTACG66
    JOHE7622GTGAGGAAGGTAGGGGAGTATC
Pairs used in struc- tural analysisc
    JOHE3069GATTTATCTCAGCAGCCACG60
    JOHE5299ACAGCTAGTTCAACCATGGC
    JOHE5935CCTTCTACATCATCATATGTCACTTC64
    JOHE5795CGACGCAACAAGTCTGCTCG
    JOHE5724TTACCCACGTGGAGACAAC60
    JOHE5727CGATGGAATGTACATGTCTTG
    JOHE5867CGACGATCTCCAAGTTCTCG50
    JOHE5598ATCACCTAGAATGCAGC
    JOHE5870ATCCGCATGCTCGTCTATCC62
    JOHE5875CGTTACGAATACCTGATCACG
    JOHE5874TTCAGTGTATGAACTGCCCAC62
    JOHE5801TACCTTGGTCCGATCGAGACG
    JOHE5653TTTCGTCCTGAACAACCCAC60
    JOHE5877TTCTGCTGACCTTTAGTAGTAC
    JOHE5561TTGGTTCGACGCCAATGACG60
    JOHE5740CAACACAACCATCTGTAATGC
    JOHE5567GCATTACAGATGGTTGTGTTG60
    JOHE5570TCGTTCCCTGTTCTATTATCTG
    JOHE5741CAGATAATAGAACAGGGAACGA62
    JOHE5910GTTGATACACCGTTGTTGTACC
  • a Tm, annealing temperature.

  • b Numbers in parentheses correspond to those shown for the primer combinations in Fig. 6.

  • c Listed according to their position spanning the MAT locus from left to right (Fig. 7).