TABLE 1.

Primer sequences for amplication of AhSub and AhCP inserted into expression vector

ConstructPrimer sequencea
pUbAhSub(f)gF: CCGCCATGGCCATGCGCGCCGTCACCCCTC
R: CCGACTAGTGGCGGTGGGGTACGAAGCAGC
pUbAhSub(pre)gF: CCGCCATGGCCATGCGCGCCGTCACCCCTC
R: ATAACTAGTAGCGAGAGCGCTAGCGCAGAG
pUbAhSub(pre-pro)gF: CCGCCATGGCCATGCGCGCCGTCACCCCTC
R: CCGACTAGTAGCAAGACCCTTGAAGAGGCG
pUbAhSub(pro-m)gF: AATCCATGGCCACGCACGACCCGCTCACGG
R: CCGACTAGTGGCGGTGGGGTACGAAGCAGC
pUbAhSub(m)gF: AATCCATGGACTTCGACTACTCCAAGCACG
R: CCGACTAGTGGCGGTGGGGTACGAAGCAGC
pUbAhSub(pro)gF: AATCCATGGCCACGCACGACCCGCTCACGG
R: CCGACTAGTAGCAAGACCCTTGAAGAGGCG
pUbAhCP(f)gF: ATTGAATTCATGCGTGCCTACTTCGTGGGT
R: TATACTAGTGCACCGGGCGGAGTAAAGCAG
pUbAhCP(pre-pro)gF: ATTGAATTCATGCGTGCCTACTTCGTGGGT
R: ATAACTAGTCTGCGCGCTGGAGATGGAGAC
pUbAhCP(pro)gF: ATTGAATTCATGTCTCTTGCCCCTCTTCACAGG
R: ATAACTAGTCTGCGCGCTGGAGATGGAGAC
pUbAhCP(m)gF: ATTGAATTCATGAACTGCCTGTCCCAGAGCGGC
R: TATACTAGTGCACCGGGCGGAGTAAAGCAG
pUbAhCP(pre)gF: ATTGAATTCATGCGTGCCTACTTCGTGGGT
R: ATAACTAGTAGCGAGAGCGCTAGCGCAGAG
  • a F, forward; R, reverse. Restriction enzyme sites are underlined.