TABLE 4.

Cloning constructs from plasmid Bluescript KS(+)

GeneRegion amplified with respect to ATGCloning primerSequenceaCloning construct (insert size, kb)
TAC1+1 to +2947CaZNC2-BamHIGCGCAAAGGATCCTTAAATCCCCAAATTATTGTCAAAGAAAAApDS1048 (2.9)
CaZNC2-XhoGCGCAAACTCGAGATGGACACTTCACTGTCACTGGGAACTCAC
ZNC1+1 to +2770CaZNC1-Xba2GCGCAAATCTAGATGCTGGATGTTAATGATACACTTAATCCTpDS1047 (2.7)
CaZNC1-XhoGCGCAAACTCGAGTTATATATTTTGCTCATTAAATCCTAAAGA
ZNC3+1 to +3034CaZNC3-Xho2GCGCAAACTCGAGTTAGTTATAAAATATATCAGGAAAGTTCAApDS1043 (3)
CaZNC3-XbaGCGCAAATCTAGATGGATCCTGCTTATGATATACAATCGCA
  • a Restriction sites are underlined.