TABLE 5.

Deletion constructs from cloning vectors containing URA3-blaster from pMB7 (11)

GeneRegion deleted with respect to ATGDeletion primerSequenceaDisruption construct (deletion size)
TAC1+1154 to +1419Deletion performed by removal of an internal PstI-BglII fragmentpDS1052 (265 bp)
ZNC1+550 to +1993CaZNC1-PstGCGCAAACTGCAGATCGTTATGGTTATATTCTATACTGCCATCpDS1049 (1.4 kb)
CaZNC1-BglCAATCAATCATTAGCTGGAGCTAGATCTATGTTG
ZNC3+531 to +2543CaZNC3-BglGCGCAAAGATCTTGGAGAGGGCTAGATTTATCTGTCTTTGCTpDS1065 (2 kb)
CaZNC3-Pst2GCGCAAACTGCAGCATCATCATCGACTTCTTTCCAACCACCTA
  • a Restriction sites are underlined.