TABLE 2.

Oligonucleotides used for this study

Primer name or useSequence (5′-3′)
Nourseothricin acetyltransferase (NAT) reconstruction
    JOHE8758TTATGGACAAGGCATACTCATATAAAG
    JOHE8759ATGGCGGCCGCCACTCTTGAC
    JOHE8760ATGGCGGCCGCCACTCTTGACGATACGGCTTACCGTTACAGAACCAGTGTCCCAGGTGATGCTGAAGCCATCGAAGCACTTGATGGTAG
    JOHE8761CATCGAAGCACTTGATGGTAGTTTCACAACCGATACTGTCTTCCGAGTCACAGCCACCGGTGATGGATTCACTTTGCGAGAAGTCCCTGTTG
    JOHE8762TTTGCGAGAAGTCCCTGTTGATCCACCTCTTACTAAAGTATTTCCTGATGATGAATCAGATGATGAATCAGATGCAGGTGAAGACGGCG
    JOHE8763GATGCAGGTGAAGACGGCGATCCAGACTCCAGAACATTCGTCGCTTACGGTGACGATGGAGACCTTGCAGGATTCGTTGTCGTCTCTTAG
    JOHE8764GGATTCGTTGTCGTCTCTTACTCCGGCTGGAACAGACGTCTTACCGTCGAAGATATCGAAGTCGCCCCAGAACACCGTGGTCACGGTGTCG
    JOHE8765CACCGTGGTCACGGTGTCGGTAGAGCTTTGATGGGTCTTGCTACAGAATTTGCACGTGAAAGAGGTGCAGGTCACCTCTGGTTGGAAGT
    JOHE8766GGTCACCTCTGGTTGGAAGTCACTAACGTTAACGCACCTGCTATCCATGCGTACCGACGTATGGGTTTCACCCTTTGTGGACTGGATACC
    JOHE8767CCCTTTGTGGACTGGATACCGCACTGTACGACGGAACCGCATCTGACGGAGAGCAAGCTCTTTATATGAGTAATGCCTTGTCCATAA
Voltage-gated chloride channel 1 (CLC1) disruption
    1 JOHE8986ACTCTTACGCTTCAACTTCGG
    2 JOHE8988CAACGGTGACGCTGTGAGGCTTGGTGTTCGCCGTGG
    3 JOHE8987CCACGGCGAACACCAAGCCTCACAGCGTCACCGTTG
    4 JOHE8990CATTCTGTATCCCATCCAGAAGAGATGTAGAAACGAG
    5 JOHE8989CTCGTTTCTACATCTCTTCTGGATGGGATACAGAATG
    6 JOHE8992TTGTCAAGAAGGTCGAGCAC
Voltage-gated chloride channel 2 (CLC2) disruption
    1 JOHE9227GACGATCGGGATCGGAAAC
    2 JOHE9229CAGCTCACATCCTCGCAGCCGTATAGTGGAAAGGGAG
    3 JOHE9228CTCCCTTTCCACTATACGGCTGCGAGGATGTGAGCTG
    4 JOHE9230CTTCAATGCCCTGTGCCGAAGAGATGTAGAAACTAG
    5 JOHE9231CTAGTTTCTACATCTCTTCGGCACAGGGCATTGAAG
    6 JOHE9232ATCCGAACCTCCAGAACC
MAP kinase 2 (MPK2) disruption
    1 JOHE9584ACAACTCTGACCGAGAAC
    2 JOHE9586CAGCTCACATCCTCGCAGCTTCCGTAGAGTGGGACAAG
    3 JOHE9585CTTGTCCCACTCTACGGAAGCTGCGAGGATGTGAGCTG
    4 JOHE9588GCCAAATACCGCTTGATCAAGAGATGTAGAAACTAG
    5 JOHE9587CTAGTTTCTACATCTCTTGATCAAGCGGTATTTGGC
    6 JOHE9589GACTAGCGTATGAGCAAG
MAP kinase 2 (MPK2) plus upstream predicted gene disruption
    1 JOHE9929GGCGAGATAAACTGGAAC
    2 JOHE9931CAGCTCACATCCTCGCAGGATTTCACAGCGTCTTCG
    3 JOHE9930CGAAGACGCTGTGAAATCCTGCGAGGATGTGAGCTG
    4 JOHE9588GCCAAATACCGCTTGATCAAGAGATGTAGAAACTAG
    5 JOHE9587CTAGTTTCTACATCTCTTGATCAAGCGGTATTTGGC
    6 JOHE9589GACTAGCGTATGAGCAAG
Predicted gene upstream of MPK2 disruption
    1 JOHE9929GGCGAGATAAACTGGAAC
    2 JOHE10952CAGCTCACCTCCCGCAGATTCCTTCTCCTTTCAAC
    3 JOHE8672AGGCTGCGGGAGGTGAGC
    4 JOHE8677GAAGAGATGTAGAAACGAG
    5 JOHE10943CTCGTTTCTACATCTCTTCGCTTTGGATGAGAAGGAG
    6 JOHE9404CCTTGTCAAACACTCTGG
Inverse PCR from T-DNA
    JOHE8956AACAGTTGCGCAGCCTGAATG
    JOHE8957AGAGGCGGTTTGCGTATTGG