TABLE 2.

Oligonucleotide primers used in this study

Primer no.Primer nameSequencea
392XFP-primerCATAACCTTCGGGCATGGCACTC
397TEF-termCTGGGCAGATGATGTCGAGGC
511TEF-promAGGATTTGCCACTGAGGTTCTTC
549G4-CaWAL1CATATCAACTTAAATTTGGG
555G1-CaWAL1CCTTATATTCTCATCCATCC
556Kpnl-WAL1ttcaggtaccGGATAATGATGATCAACTGTAGTTG
557Xbal-WAL1ataatctagaCCAATGAATCTATTTTTTACCACTC
577G1-WAL1CCAATGAATCTATTTTTTACCACTC
599U3GGAGTTGGATTAGATGATAAAGGTGATGG
600U2GTGTTACGAATCAATGGCACTACAGC
601H2CAACGAAATGGCCTCCCCTACCACAG
602H3GGACGAATTGAAGAAAGCTGGTGCAACCG
676S1-CaWAL1GAATAACTTTGAATCACTTTCAAATAATTTTTTCTTTTTTCTTTCTTCTCCTCCTCCTCGCGGGAATACTGAGTGAGTGGATGGGTGAGTGAGTGAGTCGGgaagcttcgtacgctgcaggtc
677S1-MAL2p-WAL1ATATAATCGAGCCACCGTTGCATCGATTATTTTATTGTTGGCTTTTGGAATAGCCCGTTTAACTTTTTCTTTATCTTGAGTAGTTAATATCCCCATtgtagttgattattagttaaaccac
720G1-CaWAL1-GFPccggaattcGCTAATACTGGCGGAGGAATTTC
742G4-MAL2-WAL1CGTTGAGCAGTATTCACATCC
956S1-CaWAL1-GFPAGCCGATGCACCACCTGCTACTTTAGCCGATGCATTAGCTTCTGCTTTGAATAAGAGGAAAGAAAAAGTTGCTCAAAGTGATGATGAAGAAGATGATGATTGGggtgctggcgcaggtgcttc
957S2-CaWAL1GTTACTTCATCTTTATAATTTTATCTTGATTGAATATCCGAAACATTCAACATTTCAATCACTCGGCAACTATCCTTAATTTTCGTATTTTTTTATTGGtctgatatcatcgatgaattcgag
975XL1-CaWAL1TCTTGCTAGGATACAGTTCTCACATCACATCCGAACATAAACAACCatggggatattaactactcaagataaag
976XL2-CaWAL1ATGACAAGTTCTTGAAAACAAGAATCTTTTTATTGTCAGTACTGAttaccaatcatcatcttcttcatcatcac
  • a Capital letters correspond to C. albicans genomic DNA. Bold capital letters correspond to the A. gossypii TEF promoter or TEF terminator. Italic capital letters correspond to GFP. Lowercase letters correspond to 5′- terminal regions of primers containing restriction sites (bold) or to 3′-terminal annealing regions for the amplification of transformation cassettes. All sequences are written from 5′ to 3′.