TABLE 2.

Primers used in this study

SequenceaName
AAGCCGAAGTCGACTATGTCLEU2 primer 1
cacggcgcgcctagcagcggGGATATTGGTTTTAAAAGAAAGGLEU2 primer 3
gtcagcggccgcatccctgcACAGTATATACAGTAGTTAGCLEU2 primer 4
TGACAAATGAATTCAGTCAGLEU2 primer 6
GATGCCTTAGCTCATTCTTCLEU2 Upstream Check
GACCAGACTCTATCCCAAAGLEU2 Downstream Check
CTTGCCTGGTGACCATGTCGLEU2 ORF 5′
ACCGACTTCTGTAGTAGAGCLEU2 ORF 3′
GGACAGAAAGTTATTGTACAGARG4 primer 1
cacggcgcgcctagcagcggGATTATTCTTGATAGCTGTTATGARG4 primer 3
gtcagcggccgcatccctgcGTCATATAATAATCACAGTATTGARG4 primer 4
TCAGACGATCTTTACAATGGARG4 primer 6
CAAGAGTAGTCTCAAATAAACCARG4 Upstream Check
CGTTTGGAAGCTGTATATCGARG4 Downstream Check
CTGGTACTAAAGTATACACACARG4 ORF 5′
CACTTTTAGCAGTACCACCAARG4 ORF 3′
ccgctgctaggcgcgccgtgTGTGGAATTGTGAGCGGATApDDB57 (URA3) primer 2
gcagggatgcggccgctgacTTTCCCAGTCACGACGTTpDDB57 (URA3) primer 5
TATCGATACCGTCGACCTCGURA3 Right (near primer 2)
AATTCGCCCTATAGTGAGTCURA3 Left (near primer 5)
GGAACTGATATTATCATTGTTGGURA3 Internal (near primer 2)
TGTTTCCGTTTATACCATCCURA3 Internal (near primer 5)
GATGTTCTTGAAGCGTAAAACURA3 left flank (near primer 2)
CACCGTCGATAGTTTTACGGURA3 right flank (near primer 5)
GGATCCAATCATCACTGGTGC. maltosa LEU2 5′
ACCTACCCATGTCTAGAAAGC. maltosa LEU2 3′
GTTTGATACCATGGCAAGCATACC. albicans HIS1 5′
CTAGAAAACCGTACCAGGTGAACC. albicans HIS1 3′
AAGAACATTTCTGTACCGCAC. dubliniensis ARG4 5′
ACAAAAGCTATTTGCATCGTC. dubliniensis ARG4 3′
TTTTGTTGTGAAGATACACGEFG1 primer 1
cacggcgcgcctagcagcggGTTATATTCTTGGTAGTCAAATAGEFG1 primer 3
gtcagcggccgcatccctgcTATCATTCGTGTACATCACCEFG1 primer 4
TGGAAAAGACAATGACTTACEFG1 primer 6
GGAAACATACATACACTAACEFG1 Upstream Check
CTTGTTCGAATATTTTAGATACEFG1 Downstream Check
TTGGGCAGTGACAGCTTTACTUP1 primer 1
cacggcgcgcctagcagcggGATGGAAGAAGTTGTGTTGTTUP1 primer 3
gtcagcggccgcatccctgcGTAGTATATATATATGTGAGAAATUP1 primer 4
GGAGTATCTAATGATTCCAATUP1 primer 6
CTTTTACAAAACACTCTTGTGTUP1 Upstream Check
TTCGATAGAGGCACGTAACTTUP1 Downstream Check
ATATTTATTTATATACTTATTTATRBD1 primer 1
cacggcgcgcctagcagcggATATTGTTGAATCTTTTAGGGGAGRBD1 primer 3
gtcagcggccgcatccctgcAGAAAAGAATTGATTAGAAATGTCRBD1 primer 4
TGGATAGATCTTTGTTAATCTTTCRBD1 primer 6
AGGAATCAAACATCCCACTTTATTRBD1 Upstream Check
TAAGCATTATAAAAGGGGTGGTTCRBD1 Downstream Check
ccgctgctaggcgcgccgtgACCAGTGTGATGGATATCTGCUniversal primer 2 (for HIS1, LEU2, and ARG4 cassettes)
gcagggatgcggccgctgacAGCTCGGATCCACTAGTAACGUniversal primer 5 (for HIS1, LEU2, and ARG4 cassettes)
ATTAGATACGTTGGTGGTTCHIS1 Left (near primer 2)
AACACAACTGCACAATCTGGHIS1 Right (near primer 5)
AGAATTCCCAACTTTGTCTGLEU2 Left (near primer 2)
AAACTTTGAACCCGGCTGCGLEU2 Right (near primer 5)
ACACAGAGATACCTTGTACTARG4 Left (near primer 2)
ACGGAGTACCACATACGATGARG4 Right (near primer 5)
TAATAAGCTTCCCACGTTAACAATTTCATCAAGRPS10 5′ HindIII
TAATGTCGACGCCATGTTGTACTTGAGTTGGTGRPS10 5′ SalI
TAATGATATCGGATAATGATAACTGAAGAGAAGRPS10 3′ EcoRV
TAATCCGCGGCTCGACTATTACTCATTGATAAAGACRPS10 3′ SaclI
TTAACTCGAGTATACAAGCCAATGAAAGGGGTRBD1 5′ XhoI
TTAACTCGAGGGAAATTGGGCATATTTTGTTCRBD1 3′ XhoI
TTAAGAGCTCTTTGACATCAACGGCAATACTUP1 5′ SacI
TTAAGAGCTCCTTGGGGCAACTCGTATAACTUP1 3′ SacI
  • a Sequences in lowercase correspond to exogenous, complementary sequences introduced to primers 2, 3, 4, and 5 for mutually primed synthesis in the second round of fusion PCR.