TABLE 2.

Primers used

PrimerSequenceaSequence targetedb
465CGTCCTAAATCTATTTTTATTG5′ CDC42
466GCCCAACACATCAAACGAGATC3′ CDC42
641CGAACTTGGTAGTGGGACCGAATGG3′ CDC42
616GCAACAACCCCATACACACTGGURA3
646CCTCTTTATCCTGTCTGAACCGGHisG
499GCATGGATATTCCATGTCAAGG5′ CDC42
601GATTACGACAGATTACGGCCGTTGCCATATCCATCGACTGcdc42-S71P
602CAGTCGATGGATATGGCAACGGCCGTAATCTGTCGTAATCcdc42-S71P
605CGTATACCACTATTAAATTTCCAGCcdc42-S26I
606GCTGGAAATTTAATAGTGGTATACGcdc42-S26I
607GAAAAATGGTTCCCCGGGGTTCATCACCATTGTCCcdc42-E100G
608GGACAATGGTGATGAACCCCGGGGAACCATTTTTCcdc42-E100G
638GTATGTTGAGTGCACTGCATTGACTCAAAGcdc42-S158T
639CTTTGAGTCAATGCAGTGCACTCAACATACcdc42-S158T
  • a Underlined nucleotides are those changed from wild type to alter amino acids.

  • b This represents either the region of the gene where the primer anneals or the introduced mutation.