Skip to main content
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems
  • Log in
  • My Cart

Main menu

  • Home
  • Articles
    • Archive
  • About the Journal
    • About EC
    • For Librarians
    • For Advertisers
    • FAQ
  • ASM
    • Antimicrobial Agents and Chemotherapy
    • Applied and Environmental Microbiology
    • Clinical Microbiology Reviews
    • Clinical and Vaccine Immunology
    • EcoSal Plus
    • Eukaryotic Cell
    • Infection and Immunity
    • Journal of Bacteriology
    • Journal of Clinical Microbiology
    • Journal of Microbiology & Biology Education
    • Journal of Virology
    • mBio
    • Microbiology and Molecular Biology Reviews
    • Microbiology Resource Announcements
    • Microbiology Spectrum
    • Molecular and Cellular Biology
    • mSphere
    • mSystems

User menu

  • Log in
  • My Cart

Search

  • Advanced search
Eukaryotic Cell
publisher-logosite-logo

Advanced Search

  • Home
  • Articles
    • Archive
  • About the Journal
    • About EC
    • For Librarians
    • For Advertisers
    • FAQ
Articles

β(1-3)Glucanosyltransferase Gel4p Is Essential for Aspergillus fumigatus

Amandine Gastebois, Thierry Fontaine, Jean-Paul Latgé, Isabelle Mouyna
Amandine Gastebois
Unité des Aspergillus, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Thierry Fontaine
Unité des Aspergillus, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jean-Paul Latgé
Unité des Aspergillus, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: jplatge@pasteur.fr
Isabelle Mouyna
Unité des Aspergillus, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
DOI: 10.1128/EC.00107-10
  • Article
  • Figures & Data
  • Info & Metrics
  • PDF
Loading

ABSTRACT

The β(1-3)glucanosyltransferase GEL family of Aspergillus fumigatus contains 7 genes, among which only 3 are expressed during mycelial growth. The role of the GEL4 gene was investigated in this study. Like the other Gelps, it encodes a glycosylphosphatidylinositol (GPI)-anchored protein. In contrast to the other β(1-3)glucanosyltransferases analyzed to date, it is essential for this fungal species.

β(1-3)Glucan is the main component of the fungal cell wall (11). In fungi, β(1-3)glucans are synthesized by a plasma membrane-bound glucan synthase complex. Neosynthesized glucans are then extruded into the periplasmic space (2, 3, 9), where they become branched and covalently linked to other cell wall components, resulting in the formation of three-dimensional rigid structures. In the search of transglycosidase in the filamentous fungus Aspergillus fumigatus, β(1-3)glucanosyltransferases were identified and classified as a unique family (GH72) in the Carbohydrate-Active enZYmes database (http://www.cazy.org/ ). These enzymes cleave the β(1-3) bond of a β(1-3)glucan oligosaccharide with at least 10 glucose units and transfer the newly formed reducing end (>5 glucose units) to the nonreducing end of another β(1-3)glucan oligosaccharide, resulting in the elongation of the β(1-3)glucans. This reaction can proceed in vitro until the neosynthetized β(1-3)glucan becomes insoluble. Initially demonstrated biochemically, the requirement for long-chain β(1-3)glucan oligosaccharide has now been confirmed by the analysis of the first crystal structure obtained in this transglycosidase family (7, 8). First discovered in Aspergillus fumigatus and named Gelp for glucan elongase, this activity has been found in all fungal species investigated to date and could be assigned to orthologous proteins, such as Gasp or Phrp, that were known to be involved in cell wall integrity but were endowed with an unknown biochemical function (12, 13, 14).

Three members of the A. fumigatusGEL family are expressed during mycelial growth.In A. fumigatus, the GEL family contained 7 open reading frames (ORFs) named GEL1 (AFUA_2G01170), GEL2 (AFUA_6G11390), GEL3 (AFUA_2G12850), GEL4 (AFUA_2G05340), GEL5 (AFUA_8G02130), GEL6 (AFUA_3G13200), and GEL7 (AFUA_6G12410). Gel2p to Gel7p showed 37, 24, 28, 26, 29, and 26% identity with A. fumigatus Gel1p (AfGel1p), respectively. Among them, only GEL1, GEL2, and GEL4 were expressed constitutively during mycelial growth. Quantitative real-time PCR (qRT-PCR) assays using RNA extracted at different times of culture and amplified as described previously (10) showed that among those 3 genes, GEL4 was the most expressed at all times of growth (Fig. 1). GEL1 and GEL2 were previously characterized. Disruption of GEL1 did not result in a phenotype, whereas a gel2 mutant and the double mutant gel1 gel2 exhibited slower growth, associated with a decrease of β(1-3)glucan content, an increase of chitin, and abnormal conidiogenesis (14). The function of GEL4 is reported here.

Fig. 1.
  • Open in new tab
  • Download powerpoint
Fig. 1.

Expression level of the GEL1, GEL2, and GEL4 genes during growth. Gene expression was determined by real-time RT-PCR in resting conidia (0 h), germinated conidia (8 h), and mycelia (20 h) incubated in 3% glucose-1% yeast extract at 37°C. Triplicate biological RT-PCR assays were performed using 1× iQ SYBR green master mix, and expression levels were normalized to those of TEF1. The threshold cycle (2−ΔΔCT) method was used to determine fold changes of expression. Primer pairs used were Gel1a (TTCGCTACCGTTGATGCTTTCG)-Gel1b (TGCGGCTACGGATGTACTGAC); Gel2a (GCCTCTCCGACGCTAACAC)-Gel2b (GGTATTGGACTCGCCGCTAG); Gel4a (ATACGCCACCGACGAGGAC)-Gel4b (GGAAGAATCACCGCACCACTC); and Tef1a (CCATGTGTGTCGAGTCCTTC)-Tef1b (GAACGTACAGCAACAGTCTGG).

GEL4 is an essential gene in A. fumigatus.To delete GEL4, a deletion cassette containing the hygromycin resistance marker inserted inside the GEL4 ORF was constructed (Fig. 2 A). The resulting fusion PCR product was used for transformation of protoplasts of the A. fumigatusakuBΔKu80 strain (4). In spite of repeated attempts, no mutant was recovered by classical gene replacement experiments, suggesting that this gene was essential. The heterokaryon rescue technique recently used to demonstrate gene essentiality in A. fumigatus (10, 15) was applied here. The presence of both wild-type and mutant alleles in heterokaryons was shown by PCR and Southern blotting, the primer pair GEL4heteroc1-GEL4heteroc2 amplified a DNA fragment corresponding to the wild-type allele, and the amplification obtained with primers GEL4heteroc1-HYGRO indicated the presence of the GEL4-deleted allele (Fig. 2B and C). Uninucleate conidia isolated from this heterokaryon were unable to germinate and grow on selective medium, even in the presence of 1.2 M sorbitol, indicating that GEL4 was essential for A. fumigatus.

Fig. 2.
  • Open in new tab
  • Download powerpoint
Fig. 2.

(A to C) Deletion of GEL4 in A. fumigatus using the heterokaryon rescue method. (A) Strategy used to insert the hygromycin resistance gene (HPH) inside GEL4 (E, EcoRI site). (B and C) PCR and Southern blot analyses showing the presence of both wild-type and mutated alleles in the heterokaryon (H) and the absence of the mutated allele in the wild-type strain (WT). The PCR primer pair used in the heterokaryon and in the wild-type strain to show the presence of a wild-type allele is GEL4heteroc1 (CCAAACCAAATCATCAGCCCCAGCCCCAATC)-GEL4heteroc2 (GTAGTCGGCCAAGTCGGCACGGATGTGGGCG), and the pair used to show the presence of a deleted allele is GEL4heteroc1-HYGRO (CGACAGCGTCTCCGACCTGATGCAGCTCTC). For Southern blotting, genomic DNA was digested with EcoRI and hybridized with probe A. DNA isolated from the wild-type strain showed one band of 6.3 kb corresponding to a copy of the wild-type allele, whereas the DNA isolated from the heterokaryon showed the wild-type allele and the mutated allele at 4.1 kb (see panel A). (D) Solubilization of membrane-bound Gel4p with GPI-PLC. Aqueous upper phase (marked “A”) and detergent lower phase (marked “D”) after Triton X-114 partitioning of GPI-PLC-treated (+) or control (−) membranes; immunolabeling with anti-Gel4p hyperimmune antiserum.

Gel4p is a GPI-anchored protein.In membrane preparations, Gel4p with an apparent Mr of 70 was detected with an antiserum obtained from a rabbit immunized with the peptide C445DFDGKAQTKKGADA460 of Gel4p conjugated to keyhole limpet hemocyanin (KLH). A membrane fraction was treated with phosphatidylinositol (PI)-phospholipase C (PLC) of Bacillus thuringiensis (able to cleave the glycosylphosphatidylinositol [GPI] anchor) and submitted to a partitioning with Triton X-114, as described previously (12). Following this treatment, Gel4p was present in the aqueous phase, whereas it remained in the detergent phase in the absence of PI-PLC treatment (Fig. 2D). These data showed that Gel4p was bound to the membrane through a GPI anchor.

Gel4p has β(1-3)glucanosyltransferase activity.The sequence similarities of Gel4p with Gel1p and Gel2p, including the conservation of the two aspartic acid residues essential for the transglycosidase activity, FF(A/S)GNEV (E is the acid-base donor) and F(F/L)SE(Y/F)GCN (E is the nucleophilic residue) (13), suggested that Gel4p had β(1-3)glucanosyltransferase activity typical of the GH72 family (5, 13, 17). In order to analyze the enzymatic activity of Gel4p, a recombinant Gel4p (rGel4p; encompassing amino acids 20 to 488) was produced in Pichia pastoris by following a strategy used previously to produce rGel1p and rGel2p (14). Gel4p produced in P. pastoris had an apparent Mr of 70 and was glycosylated, as shown by a reduction in Mr to 52 after peptide N-glycosidase F (PNGase F) treatment (data not shown). The recombinant Gel4p was incubated with reduced laminarioligosaccharides of different sizes, and the products of the reaction were analyzed using a Dionex high-performance anion-exchange chromatography with pulsedelectrochemical detection (HPAEC-PED) system with a CarboPac PA200 column, as described previously (14). As an example, Fig. 3 shows the results of the incubation of rGel4p with an oligosaccharide of 26 glucose residues (G26r). The major products obtained were in agreement with those obtained using the previously described two-step reaction scheme (7), as follows: the enzyme acted first as an endoglucanase, released short laminarioligosaccharides, and transferred the new reducing ends formed to another oligosaccharide, resulting in the elongation of the β(1-3)glucan chain, until it became water insoluble (corresponding with the largest peak of the HPAEC profile shown in Fig. 3). Transfer activity was seen with other oligosaccharides of lower degrees of polymerization (rG11, rG13, or rG14). Degradation of the reaction products by an endo(β1-3)glucanase (as described in reference 6) resulted in the release of glucose and laminaribiose, without that of branched oligosaccharide, confirming that the transfer product contained only linear β(1-3)glucan chains. The analysis comparing rGel4p to rGel1p under the same experimental conditions showed that rGel4p had a higher avidity for the β-glucan than rGel1p (Fig. 3).

Fig. 3.
  • Open in new tab
  • Download powerpoint
Fig. 3.

HPAEC analysis of products obtained from the incubation of the recombinant Gel1p and Gel4p with reduced laminarioligosaccharides. Recombinant proteins (1.17 μg purified) were incubated with 9 mM reduced laminarioligosaccharide containing 26 glucose units in 28 μl of 50 mM sodium acetate buffer, pH 5.5, at 37°C. Aliquots (1.5 μl) supplemented with 200 μl 50 mM NaOH were analyzed by HPAEC with a CarboPac PA200 column (3 by 250 mm; Dionex) and a pulsed electrochemical detector. Note that the last peak (indicated by an arrow) corresponds to water-insoluble products.

A phylogenetic tree of the GH72 β(1-3)glucanosyltransferase family showed that its members can be grouped into 3 subfamilies based on the presence or absence of CBM43 (1), a carbohydrate-binding module most commonly associated with β(1-3)glucan binding activity and a serine/threonine-rich region that contains O-glycosylation putative sites (Fig. 4 A). These two domains are present only in the members of the family that have the most important morphogenetic role (16, 17; M. De Medona Redondo and C. Vazquez de Aldana, personal communication). Although the presence of these domains are not important for β(1-3)glucanosyltransferase activity (17), they may be essential to localize the proteins at the right places for its morphogenetic activity: O-glycosylated stalks elevate the β(1,3)glucan binding domain above the plasma membrane, where the protein is anchored with GPI, and place the catalytic site in the best position to act on the nascent β(1,3)glucan (Fig. 4B).

Fig. 4.
  • Open in new tab
  • Download powerpoint
Fig. 4.

(A) Phylogenetic tree of proteins of A. fumigatus, Schizosaccharomyces pombe, Saccharomyces cerevisiae, and Candida albicans belonging to the GH72 family. Protein alignment was made with ClustalX, bootstrap values were calculated with PhyML, and the tree was drawn with MEGA software. The protein sequences used are from the indicated species, as follows (Swiss-Prot accession numbers are listed in parentheses): from S. pombe, Spgas1p (Q9P378), Spgas2p (Q9USU5), Spgas4p (Q9Y7Y7), and Spgas5p (O13692); from S. cerevisiae, Gas1p (P22146), Gas2p (Q06135), Gas3p (Q03655), Gas4p (Q08271), and Gas5p (Q08193); from Candida albicans, CaPhr1p (P43076), CaPhr2p (O13318), CaPhr3p (Q9P8R2), CaPga4p (Ca019.4035), and CaPga5p (Ca019.3693); and from Aspergillus fumigatus, AfGel1p (AFUA_2G01170), AfGel2p (AFUA_6G11390), AfGel3p (AFUA_2G12850), AfGel4p (AFUA_2G05340), AfGel5p (AFUA_8G02130), AfGel6p (AFUA_3G13200), and AfGel7p (AFUA_6G12410). (Right) Schematized domains of the 3 subfamilies of GH72, consisting of the signal peptide, catalytic domain, cysteine domain or CBM43 (I), S/T-rich domain, and GPI anchor. Aspergillus fumigatus proteins are shown in boldface. (B) Hypothetical representation of the in situ localization of a member of the GH72+ ST+ subfamily, such as AfGel4p. CBM43 directs the catalytic site toward the β(1-3)glucan chain. After being anchored, the catalytic domain is able to modify the oligosaccharide.

FOOTNOTES

    • Received 3 May 2010.
    • Accepted 6 June 2010.
  • Copyright © 2010, American Society for Microbiology

REFERENCES

  1. 1.↵
    1. Barral P.,
    2. Suarez C.,
    3. Batanero E.,
    4. Alfonso C.,
    5. Alché J. D.,
    6. Rodríguez-Garcia M. I.,
    7. Villalba M.,
    8. Rivas G.,
    9. Rodríguez R.
    . 2005. An olive pollen protein with allergenic activity, Ole e 10, defines a novel family of carbohydrate-binding modules and is potentially implicated in pollen germination. Biochem. J.390:77–84.
    OpenUrlCrossRefPubMedWeb of Science
  2. 2.↵
    1. Beauvais A.,
    2. Drake R.,
    3. Ng K.,
    4. Diaquin M.,
    5. Latgé J. P.
    . 1993. Characterization of the 1,3 β glucan synthase of A. fumigatus. J. Gen. Microbiol.139:3071–3078.
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    1. Beauvais A.,
    2. Bruneau J. M.,
    3. Mol P. C.,
    4. Buitrago M. J.,
    5. Legrand R.,
    6. Latgé J. P.
    . 2001. Glucan synthase complex of Aspergillus fumigatus. J. Bacteriol.183:2273–2279.
    OpenUrlAbstract/FREE Full Text
  4. 4.↵
    1. da Silva Ferreira M. E.,
    2. Kress M. R. V. Z.,
    3. Savoldi M.,
    4. Goldman M. H. S.,
    5. Hartl A.,
    6. Heinekamp T.,
    7. Brakhage A. A.,
    8. Goldman G. H.
    . 2006. The akuBKU80 mutant deficient for nonhomologous end joining is a powerful tool for analyzing pathogenicity in Aspergillus fumigatus. Eukaryot. Cell5:207–211.
    OpenUrlAbstract/FREE Full Text
  5. 5.↵
    1. de Medina-Redondo M.,
    2. Arnàiz-Pita Y.,
    3. Fontaine T.,
    4. Del Rey F.,
    5. Latge J. P.,
    6. de Aldana C. R.
    . 2008. The beta-1,3-glucanosyltransferase gas4p is essential for ascospore wall maturation and spore viability in Schizosaccharomyces pombe. Mol. Microbiol.68:1283–1299.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Gastebois A.,
    2. Mouyna I.,
    3. Simenel C.,
    4. Clavaud C.,
    5. Coddeville B.,
    6. Delepierre M.,
    7. Latge J. P.,
    8. Fontaine T.
    . 2010. Characterization of a new β(1-3)-glucan branching activity of Aspergillus fumigatus. J. Biol. Chem.285:2386–2396.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Hartland R. P.,
    2. Fontaine T.,
    3. Debeaupuis J. P.,
    4. Simenel C.,
    5. Delepierre M.,
    6. Latgé J. P.
    . 1996. A novel β(1-3)glucanosyltransferase from the cell wall of Aspergillus fumigatus. J. Biol. Chem.271:26843–26849.
    OpenUrlAbstract/FREE Full Text
  8. 8.↵
    1. Hurtado-Guerrero R.,
    2. Schüttelkopf A. W.,
    3. Mouyna I.,
    4. Ibrahim A. F. M.,
    5. Shepherd S.,
    6. Fontaine T.,
    7. Latgé J. P.,
    8. Van Aalten D. M. F.
    . 2009. Molecular mechanisms of yeast cell wall glucan remodeling. J. Biol. Chem.284:8461–8469.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    1. Klis F. M
    . 1994. Cell wall assembly in yeast. Yeast10:851–869.
    OpenUrlCrossRefPubMedWeb of Science
  10. 10.↵
    1. Lambou K.,
    2. Lamarre C.,
    3. Beau R.,
    4. Dufour N.,
    5. Latgé J. P.
    . 2010. Functional analysis of the superoxide dismutase family in Aspergillus fumigatus. Mol. Microbiol.75:910–923.
    OpenUrlCrossRefPubMed
  11. 11.↵
    1. Latgé J. P
    . 2007. The cell wall: a carbohydrate armour for the fungal cell. Mol. Microbiol.66:279–290.
    OpenUrlCrossRefPubMedWeb of Science
  12. 12.↵
    1. Mouyna I.,
    2. Fontaine T.,
    3. Vai M.,
    4. Monod M.,
    5. Fonzi W.,
    6. Diaquin M.,
    7. Popolo L.,
    8. Hartland R. P.,
    9. Latgé J. P.
    . 2000. Glycosylphosphatidylinositol-anchored glucanosyltransferases play an active role in the biosynthesis of the fungal cell wall. J. Biol. Chem.275:14882–14889.
    OpenUrlAbstract/FREE Full Text
  13. 13.↵
    1. Mouyna I.,
    2. Monod M.,
    3. Fontaine T.,
    4. Henrissat B.,
    5. Léchenne B.,
    6. Latgé J. P.
    . 2000. Identification of the catalytic residues of the first family of β(1-3)glucanosyltransferases identified in fungi. Biochem. J.347:741–747.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Mouyna I.,
    2. Morelle W.,
    3. Vai M.,
    4. Monod M.,
    5. Lechenne B.,
    6. Fontaine T.,
    7. Beauvais A.,
    8. Sarfati J.,
    9. Prévost M. C.,
    10. Henry C.,
    11. Latgé J. P.
    . 2005. Deletion of GEL2 encoding for a beta(1-3)glucanosyltransferase affects morphogenesis and virulence in Aspergillus fumigatus. Mol. Microbiol.56:1675–1688.
    OpenUrlCrossRefPubMedWeb of Science
  15. 15.↵
    1. Mouyna I.,
    2. Kniemeyer O.,
    3. Jank T.,
    4. Loussert C.,
    5. Mellado E.,
    6. Aimanianda V.,
    7. Beauvais A.,
    8. Wartenberg D.,
    9. Sarfati J.,
    10. Bayry J.,
    11. Prévost M. C.,
    12. Brakhage A. A.,
    13. Strahl S.,
    14. Huerre M.,
    15. Latgé J. P.
    . 2010. Members of PMT family in Aspergillus fumigatus differentially affect growth, morphogenesis, and viability. Mol. Microbiol.76:1205–1221.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Muhlschlegel F. A.,
    2. Fonzi W. A.
    . 1997. PHR2 of Candida albicans encodes a functional homolog of the pH-regulated PHR1 with an inverted pattern of pH-dependent expression. Mol. Cell. Biol.17:5960–5967.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    1. Ragni E.,
    2. Fontaine T.,
    3. Gissi C.,
    4. Latgé J. P.,
    5. Popolo L.
    . 2007. The Gas family of proteins of Saccharomyces cerevisiae: characterization and evolutionary analysis. Yeast24:297–308.
    OpenUrlCrossRefPubMedWeb of Science
View Abstract
PreviousNext
Back to top
Download PDF
Citation Tools
β(1-3)Glucanosyltransferase Gel4p Is Essential for Aspergillus fumigatus
Amandine Gastebois, Thierry Fontaine, Jean-Paul Latgé, Isabelle Mouyna
Eukaryotic Cell Aug 2010, 9 (8) 1294-1298; DOI: 10.1128/EC.00107-10

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Print

Email

Thank you for sharing this Eukaryotic Cell article.

NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.

Enter multiple addresses on separate lines or separate them with commas.
β(1-3)Glucanosyltransferase Gel4p Is Essential for Aspergillus fumigatus
(Your Name) has forwarded a page to you from Eukaryotic Cell
(Your Name) thought you would be interested in this article in Eukaryotic Cell.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
β(1-3)Glucanosyltransferase Gel4p Is Essential for Aspergillus fumigatus
Amandine Gastebois, Thierry Fontaine, Jean-Paul Latgé, Isabelle Mouyna
Eukaryotic Cell Aug 2010, 9 (8) 1294-1298; DOI: 10.1128/EC.00107-10
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
  • Top
  • Article
    • ABSTRACT
    • FOOTNOTES
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • PDF

KEYWORDS

Aspergillus fumigatus
Genes, Essential
Glucan Endo-1,3-beta-D-Glucosidase

Related Articles

Cited By...

About

  • About EC
  • For the Media
  • For Librarians
  • For Advertisers
  • FAQ
  • Permissions
  • Journal Announcements

Authors

  • Submit a Manuscript to mSphere

ASM Journals

ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.

About ASM | Contact Us | Press Room

 

ASM is a member of

Scientific Society Publisher Alliance

 

American Society for Microbiology
1752 N St. NW
Washington, DC 20036
Phone: (202) 737-3600

Copyright © 2021 American Society for Microbiology | Privacy Policy | Website feedback

Print ISSN: 1535-9778; Online ISSN: 1535-9786