Article Figures & Data
Figures
- FIG. 1.
Predicted FRP1 and FRE2 regulatory sites. Predicted Rim101 (lines) and Sfu1 (asterisk) regulatory sites within the FRP1 and FRE2 promoter regions are shown.
- FIG. 2.
EMSA of promoter regions containing putative Rim101 binding sites. Protein extracts from the wild-type (WT) (DAY286; lanes 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, and 17) or rim101Δ/rim101Δ (DAY5; lanes 3, 6, 9, 12, 15, and 18) strain grown at pH 8 were incubated with radiolabeled DNA probes for endogenous (+) (lanes 1, 3, 4, 6, 7, and 9) or mutated (−) (lanes 2, 5, and 8) FRE2 (−876, −443, −22) oligomers or endogenous (+) (lanes 10, 12, 13, 15, 16, and 18) or mutated (−) (lanes 11, 14, and 17) FRP1 (−981, −626, −164) oligomers and analyzed by EMSA.
- FIG. 3.
FRE2 and FRP1 promoter lacZ fusions identify important Rim101 binding sites. β-Galactosidase assays were performed on PFRE2-lacZ and PFRP1-lacZ reporter strains grown at pH 4 or pH 8 or at pH 4 with 200 μM BIP. At least three independent transformants were used to determine average Miller units and standard deviation. n-fold induction was determined by comparison of the expression of a given construct in either pH-8- or BIP-grown cells to expression in pH-4-grown cells. rim101Δ/Δ, rim101Δ/rim101Δ.
- FIG. 4.
Deletion analysis of the FRP1 promoter. β-Galactosidase assays were performed with the PFRP1-lacZ and derivative reporter strains grown at pH 4 or pH 8 or at pH 4 with 200 μM BIP. At least three independent transformants were used to determine average Miller units and standard deviation. n-fold induction was determined by comparison of the expression a given construct in either pH-8- or BIP-grown cells to expression in pH-4-grown cells.
- FIG. 5.
EMSAs of the region predicted to contain the BIP-dependent site. Thirty-base-pair oligomers spanning −220/−190, −200/−170, −180/−150, −160/−130, −140/−110, and −120/−90 in relation to the FRP1 START codon were incubated with protein extracts from wild-type C. albicans (DAY286) grown at pH 4 (lanes 1, 4, 7, 10, 13, and 16), pH 4 with 200 μM BIP (lanes 2, 5, 8, 11, 14, and 17), or pH 8 (lanes 3, 6, 9, 12, 15, and 18). Free probe (open arrowhead), a nonspecific gel shift (closed arrowhead), and specific gel shifts (arrows A to C) are indicated.
- FIG. 6.
Competition assays between the −220/−190 and −160/−130 regions. Radiolabeled probes for the −160/−130 region (lanes 1 to 7) and −220/−190 region (lanes 8 to 14) were incubated with protein extracts from wild-type (DAY286) cells and −160/−130 region (lanes 2 to 4 and 12 to 14) or −220/−190 region (lanes 5 to 7 and 9 to 11) cold competitor. Competitor was added at 50-fold (lanes 2, 5, 9, and 12), 100-fold (lanes 3, 6, 10, and 13), or 500-fold (lanes 4, 7, 11, and 14) excess. Control reactions lacking competitor are included (lanes 1 and 8).
- FIG. 7.
The FRP1 promoter is bound by Hap5 via the CCAAT site. (A) EMSAs of the −160/−130 region containing the endogenous CCAAT site (lanes 1 to 4) or mutated TGCGC site (lanes 5 to 7). Protein extracts were obtained from wild-type (WT) (DAY286) cells grown in M199 (pH 4) (lanes 2 and 5), M199 (pH 4) plus 200 μM BIP (lanes 3 and 6), or M199 (pH 8) medium (lanes 4 and 7). (B) EMSAs of the −160/−130 region using protein extracts from wild-type (DAY286; lanes 2 to 4) or hap5Δ/hap5Δ (DAY1062; lanes 5 to 7) cells grown as for panel A. fp, free probe lane with no protein extract.
- FIG. 8.
Hap5 via the CCAAT site governs FRP1 promoter activity. β-Galactosidase assays were performed on wild-type (WT) cells containing the PFRP1-8-lacZ (data also shown in Fig. 4) and PFRP1-8*TGCGC-lacZ reporters and on hap5Δ/hap5Δ cells containing the PFRE2-lacZ and PFRP1-8-lacZ reporters grown at pH 4 or pH 8 or at pH 4 with 200 μM BIP. At least three independent transformants were used to determine average Miller units and standard deviation. Induction (n-fold) was determined by comparison of the expression of a given construct in either pH 8- or BIP-grown cells to expression in pH 4-grown cells.
- FIG. 9.
Hap43 is required for iron limitation-specific promoter binding. EMSAs of the −160/−130 probe incubated with protein extracts derived from wild-type (WT) (DAY286; lanes 1 to 3), hap5Δ/hap5Δ (DAY1062; lanes 4 to 6), hap41Δ/hap41Δ (DAY1083; lanes 7 to 9), or hap43Δ/hap43Δ (DAY1085; lanes 10 to 12) cells are shown. Protein extracts were obtained from cells grown in M199 (pH 4) (lanes 1, 4, 7, and 10), M199 (pH 4) plus 200 μM BIP (lanes 2, 5, 8, and 11), or M199 (pH 8) medium (lanes 3, 6, 9, and 12).
- FIG. 10.
Growth of the wild-type (WT) (DAY286), rim101Δ/rim101Δ (DAY5), hap5Δ/hap5Δ (DAY1062), ftr1Δ/ftr1Δ (DAY609), hap41Δ/hap41Δ (DAY1083), and hap43Δ/hap43Δ (DAY1085) strains on YPG plates with or without 150 μM BPS after 3 days of incubation at 37°C.
Tables
- TABLE 1.
Strains used in this study
Name Genotype Reference BWP17 ura3Δ::λimm434 his1::hisG arg4::hisG 58 ura3Δ::λimm434 his1::hisG arg4::hisG DAY5 ura3Δ::λimm434 his1::hisG arg4::hisG rim101::URA3 58 ura3Δ::λimm434 his1::hisG arg4::hisG rim101::ARG4 DAY286 ura3Δ::λimm434 his1::hisG pARG4::URA3::arg4::hisG 12 ura3Δ::λimm434 his1::hisG arg4::hisG DAY609 (CTA87.4) ura3Δ::λimm434 his1::hisG arg4::hisG ftr1::ARG4 31 ura3Δ::λimm434 his1::hisG arg4::hisG ftr1::URA3 DAY1061 ura3Δ::λimm434 his1::hisG arg4::hisG hap5::ARG4 This study ura3Δ::λimm434 his1::hisG arg4::hisG HAP5 DAY1062 ura3Δ::λimm434 his1::hisG arg4::hisG hap5::ARG4 This study ura3Δ::λimm434 his1::hisG arg4::hisG hap5::URA3-dpl200 DAY1082 ura3Δ::λimm434 his1::hisG arg4::hisG hap41::ARG4 This study ura3Δ::λimm434 his1::hisG arg4::hisG HAP41 DAY1083 ura3Δ::λimm434 his1::hisG arg4::hisG hap41::ARG4 This study ura3Δ::λimm434 his1::hisG arg4::hisG hap41::URA3 DAY1084 ura3Δ::λimm434 his1::hisG arg4::hisG hap43::ARG4 This study ura3Δ::λimm434 his1::hisG arg4::hisG HAP43 DAY1085 ura3Δ::λimm434 his1::hisG arg4::hisG hap43::ARG4 This study ura3Δ::λimm434 his1::hisG arg4::hisG hap43::URA3 - TABLE 2.
Sequences of primers used in this study
Primer Sequencea FRE2−22 5a tgtacaattttcaacaCCAAGaagagtttcctaaa FRE2−22 3a tttaggaaactcttCTTGGtgttgaaaattgtaca FRE2−22 mut5a tgtacaattttcaacaGCCGGCagagtttcctaaa FRE2−22 mut3a tttaggaaactctGCCGGCtgttgaaaattgtaca FRE2−443 5a tttttataaattaatGCCAAGccatttttatttct FRE2−443 3a agaaataaaaatggCTTGGCattaatttataaaaa FRE2−443 mut5a tttttataaattaatGCCGGCccatttttatttct FRE2−443 mut3a agaaataaaaatggGCCGGCattaatttataaaaa FRE2−876 5a agaactaattgaaaGCCAAGaaaagttatatggaa FRE2−876 3a ttccatataacttttCTTGGCtttcaattagttct FRE2−876 mut5a agaactaattgaaaGCCGGCaaaagttatatggaa FRE2−876 mut3a ttccatataacttttGCCGGCtttcaattagttct PFRP1−981 5a ggtacatcatgaatCCAAGaattaccgatccgatt PFRP1−981 3a aatcggatcggtaattCTTGGattcatgatgtacc PFRP1−981 mut 5a ggtacatcatgaatGCCGGCattaccgatccgatt PFRP1−981 mut 3a aatcggatcggtaatGCCGGCttcatgatgtacc PFRP1−636 5a aacacaacgaagtaGCCAAGaatctggcactagca PFRP1−636 3a tgctagtgccagattCTTGGCtacttcgttgtgtt PFRP1−636 mut 5a aacacaacgaagtaGCCGGCaatctggcactagca PFRP1−636 mut 3a tgctagtgccagattGCCGGCtacttcgttgtgtt PFRP1−164 5a cgcagttttcggattCTTGGCatagaaacgataaa PFRP1−164 3a atttatcgtttctatGCCAAGaatccgaaaactgcg PFRP1−164 mut 5a cgcagttttcggattGCCGGCatagaaacgataaa PFRP1−164 mut 3a tttatcgtttctatGCCGGCaatccgaaaactgcg PFRE2−876 m1 ataatagaactaattgaaaGCCGGCaaaagttatatggaattgct PFRE2−876 m2 agcaattccatataacttttGCCGGCtttcaattagttctattat PFRE2−443 m1 tcctttttttataaattaatGCCGGCccatttttatttcttacag PFRE2−443 m2 ctgtaagaaataaaaatggGCCGGCattaatttataaaaaaagga PFRP1−981 m1 cgggaattcgaatGCCGGCattaccgatccgattcctcct PFRP1−981 m2 aggaggaatcggatcggtaatGCCGGCttcatgatgtacc PFRP1−636 m1 aactgaacacaacgaagtaGCCGGCaatctggcactagcaacatc PFRP1−636 m2 gatgttgctagtgccagattGCCGGCtacttcgttgtgttcagtt PFRP1−164 m1 aatttcgcagttttcggattGCCGGCatagaaacgataaatccac PFRP1−164 m2 gtggatttatcgtttctatGCCGGCaatccgaaaactgcgaaatt FRP1-1 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgatttgatgagcctgtagatgacg FRP1-2 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgattgcacttcctggagcagtaac FRP1-3 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgattaagcaggcatcatccaagta FRP1-4 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgattacattgaccaactaaaccag FRP1-5 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgatttttgcacagtctggtaataa FRP1-6 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgattcagcagatactaaaagaatc FRP1-7 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgattgttaaacccgaaagaaaagt FRP1-8 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgattgtaaaatttcgcagttttcg FRP1-9 ggcgaattgggcccgacgtcgcatgctcccggccgccatggcggccgcgggaattcgatttgcatgaatgaaaagtatta LacZClaI+200c tacggaaataatcagccatgtcagc FRP1-8-1-5a′ taaaaatgcttttgtgctgcgtaaaatttc FRP1-8-1-3a′ gaaattttacgcagcacaaaagcattttta FRP1-8-2-5a′ gtaaaatttcgcagttttcggattCTTGGC FRP1-8-2-3a′ GCCAAGaatccgaaaactgcgaaattttac FRP1-8-3-5a′ gattCTTGGCatagaaacgataaatccacc FRP1-8-3-3a′ ggtggatttatcgtttctatGCCAAGaatc FRP1-8-4-5a′ taaatccaccaattaaacgatggccgcatc FRP1-8-4-3a′ gatgcggccatcgtttaattggtggattta FRP1-8-5-5a′ tggccgcatcccttgtctgatgataataag FRP1-8-5-3a′ cttattatcatcagacaagggatgcggcca FRP1-8-6-5a′ tgataataaggtttattgaatgcatgaatg FRP1-8-6-3a′ cattcatgcattcaataaaccttattatca FRP1-8-4-mut5a′ taaatccaTGCGCtaaacgatggccgcatc FRP1-8-4-mut3a′ gatgcggccatcgtttaGCGCAtggattta HAP5 5DR aacaaacattcaattaagacgaagaaatacagaaagaccccccaaaacaatactcaaacatttcccagtcacgacgtt HAP5 3DR tattattacaaaatcaaacactatttttaaaatgaacgaaaaaaaaaaaaaaatcctctagtggaattgtgagcggata HAP5 5detect aaaatgcgacaacggaaagg HAP5 3detect caagtgaggaactgagaactg 5′SnaBI CaHIS1 gtagtggaagatattctttattgaaaaatagcttgtcaccggatcctggaggatgaggag 3-detect tgtggaattgtgagcggataacaatttcac HAP41 5DR tacagtatatttattttttcccccatacattaattattctaatcttatgaaattaccatttttcccagtcacgacgtt HAP41 3DR catctcatcacatcacatcacatcaaaaataaaatccgttaattttttactgttccttcagtggaattgtgagcggata HAP43 5DR caaaaaaaaacaacagagtccaaaaaaatacataataattagaatttcaatttgaacaactttcccagtcacgacgtt HAP43 3DR gaaaagaaaagaaaaaaaaaactgaagtgtcggaaatacttcatactgtaagtcaaactagtggaattgtgagcggata HAP41 5detect new ccactagttcactcaattac HAP41 3detect new ccaaatcgagcaaaatcaaacc HAP43 5detect tgtcttccccccaatagact HAP43 3detect tacctttttgaatacattgt HAP41UPFWD2ND tgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgactgaaatttctataattttagcagaa HAP41UPREV2ND ttttaaagaaagtagtaccagctcttttttttgtttccgtttataccatccaaatcccgcaatggtaatttcataagattagaat HAP41DOWNFWD aataattaaataagggtggtaattattactatttacaatcaaaggtggtccttctagatgtgaaggaacagtaaaaaattaacgg HAP41DOWNREV ttacactttatgcttccggctcctatgttgtgtggaattgtgagcggataacaatttcacgtgcgtagtgttcggaagtgttgag HAP43UPFWD tgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacgctgacacaaacgggaacagaaata HAP43UPREV2ND ttttaaagaaagtagtaccagctcttttttttgtttccgtttataccatccaaatcccgcgttgttcaaattgaaattctaatta HAP43DOWNFWD aataattaaataagggtggtaattattactatttacaatcaaaggtggtccttctagatgtagtttgacttacagtatgaagtat HAP43DOWNREV ttacactttatgcttccggctcctatgttgtgtggaattgtgagcggataacaatttcactaaaggtattggtgctgccgcttat URA3FWD2ND gcgggatttggatggtataaacgg URA3REV catctagaaggaccacctttgattg ↵ a Uppercase letters denote the endogenous or mutated putative Rim101 binding site.
