| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Eukaryotic Cell, April 2009, p. 627-639, Vol. 8, No. 4
1535-9778/09/$08.00+0 doi:10.1128/EC.00246-08
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Cornelius J. Clancy,1,2,
Shaoji Cheng,1
Suresh B. Raman,1
Kenneth A. Iczkowski,3 and
M. Hong Nguyen1*
Department of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania,1 VA Pittsburgh Health System, Pittsburgh, Pennsylvania,2 Department of Pathology, University of Colorado, Denver, Colorado3
Received 23 July 2008/ Accepted 28 January 2009
|
|
|---|
|
|
|---|
As a strategy to identify C. albicans genes that are expressed during the course of candidiasis in humans, we previously used pooled sera from human immunodeficiency virus-infected patients with active oropharyngeal or esophageal candidiasis to screen a C. albicans genomic DNA expression library (12, 36). We identified over 60 C. albicans genes that encoded proteins of diverse function that reacted with antibodies in the pooled sera (12, 36). We implicated several proteins identified by our screening in the regulation of yeast-hyphal morphogenesis and the pathogenesis of mucosal and/or disseminated candidiasis (3, 4, 12-14, 37). Among these previously unstudied regulators of candidal virulence were Not5p, a component of the CCR-NOT transcription-regulatory complex (13), Irs4p, an EH domain-containing protein that interacts with the 5' phosphatase Inp51p and regulates phosphatidylinositol-(4,5)-bisphosphate levels (3, 4), and Set1p, a histone 3 lysine 4 methyltransferase (37). Interestingly, these proteins, like many identified by our screening, are known or predicted to localize to intracellular compartments, suggesting that they appear at the C. albicans cell surface at some point in the life cycle or that they are released from cells following cell death (13).
One of our previously unstudied genes corresponds to orf19.4590 in the Candida Genome Database (http://www.candidagenome.org). orf19.4590 encodes a protein of 1,112 amino acids that contains an RFX domain of approximately 103 amino acids at positions 427 to 530. This domain has 25.8% amino acid identity to the RFX domain of Saccharomyces cerevisiae Rfx1p (also known as Crt1p). RFX domains are unique winged-helix DNA binding domains that are conserved across eukaryotes (18, 20). Rfx1p, the sole member of the RFX protein family in S. cerevisiae, localizes transcriptional repressors to the promoters of DNA damage response genes like RNR2, -3, and -4 and HOG1 (25, 53). In response to DNA damage, Mec1p hyperphosphorylates Rad9p, which activates the protein kinase Rad53p (40, 49, 51). S. cerevisiae Rad53p is required for all transcriptional and cell cycle arrest responses (1, 52), the former of which are mediated, at least in part, by Rfx1p. When Rfx1p is phosphorylated by Rad53p, the transcriptional repressor complex is deactivated and DNA damage response genes are derepressed. As is true across eukaryotes (43), DNA checkpoint proteins are conserved in C. albicans. Moreover, they are essential for the filamentation of C. albicans cells in response to genotoxic stress (2, 45). Indeed, deactivation of the C. albicans Mec1-Rad53 pathway through deletion of RAD53 or RAD9 completely abolishes filamentous growth in response to DNA damage, including true hyphal growth (45). Conversely, activation of the DNA checkpoint by deletion of C. albicans RAD52, a gene responsible for the repair of double-stranded DNA breaks by homologous recombination, results in hyperfilamentous growth (2, 11, 15).
Based on these observations, we hypothesized that C. albicans orf19.4590 is involved in DNA damage responses and morphogenesis. Given the role of morphogenesis in candidal virulence, we further hypothesized that deletion of orf19.4590 would adversely affect the pathogenesis of mucosal and disseminated candidiasis in mice.
|
|
|---|
-D-glucose) at 30°C unless otherwise noted. To induce hyphal formation in liquid media, C. albicans strains grown overnight on YPD agar were subcultured into liquid YPD supplemented with 5% fetal calf serum (FCS) at 37°C. To induce hyphal formation on solid media, overnight-grown C. albicans strains in YPD at 30°C were subcultured onto Spider medium, medium 199 (Gibco-BRL; adjusted to pH 7.5), and YPD medium supplemented with 5% FCS and grown at 37°C. A diploid S. cerevisiae rfx1 deletion strain (strain Hom14-D-1-34125; purchased from Open Biosystems, Huntsville, AL) was grown in YPD containing 200 µg/ml of G418. |
View this table: [in a new window] |
TABLE 1. Candida albicans and Saccharomyces cerevisiae strains used in this study
|
Construction of C. albicans RFX2 mutants. For reasons elucidated in the Results and Discussion sections, we renamed orf19.4590 C. albicans RFX2. Disruptions of both alleles of C. albicans RFX2 were performed using the SAT1 flipper method (38). The proximal fragment (F1) at bp –898 to +346 relative to ATG of RFX2 was amplified by PCR using the primers 5'-CAAGTCACGTAGGGCCCCCTAAACTCAAACAACTTTGC and 5'-ATATACTCGAGGATCTAGCTCTGATGATCTG; the ApaI and XhoI restriction sites, respectively (underlined), were introduced. The distal gene fragment (F2) at bp +2557 to +3178 relative to the ATG of RFX2 was amplified using the primers 5'-TGGGCCATCTTCCGCGGACCACATCAATGGGTGAAG and 5'CTCATAGATTACACGAGCTCAGGGTTGGGTGTCATGTAGT, which contained the introduced SacII and SacI restriction sites (underlined). Following amplification, the fragments were digested with appropriate restriction enzymes and ligated sequentially into the plasmid pSFS2, resulting in pSFS2-RFX2. The disruption cassette was released by digesting pSFS2-RFX2 with ApaI and SacI, and it was transformed into C. albicans strain SC5314 by electroporation. Nourseothricin-resistant (NouR) transformants were selected on YPD plates containing 200 µg/ml of nourseothricin at 30°C.
After confirmation of disruption by PCR and Southern analysis, NouR colonies were grown in YPMal (1% yeast extract, 1% Bacto peptone, 2% maltose) at 30°C for 6 h. Thereafter, the culture was diluted, plated on YPD agar plates supplemented with 15 µg/ml nourseothricin, and incubated at 30°C. Smaller colonies were parallel streaked on YPD agar with 10 µg/ml nourseothricin and YPD agar to verify nourseothricin sensitivity. Genomic DNA was then isolated from several individual nourseothricin-sensitive (NouS) colonies, and excision of the cassette was verified by Southern blotting. To disrupt the second copy of RFX2, the NouS strain was transformed with pSFS2-RFX2. A screening process for nourseothricin susceptibility similar to that for the single RFX2 copy disruption was performed. The rfx2 null mutant strains were confirmed by PCR and Southern analysis.
To reinsert one copy of RFX2 at its own locus, the open reading frame was amplified from bp 117 upstream of the start codon to bp 465 downstream from the stop codon by PCR. The primers used were 5'-GCTACAGGTACCTGAGAGTGATCTAGAATAGTG and 5'-CAAGTCAACGTAGGGCCCGTGTGAGGGTATTATCGTGA, in which KpnI and ApaI sites, respectively (underlined), were induced. The amplified fragment and F2, described above, were sequentially cloned into pSFS2. The reinsertion cassette was released by KpnI/SacI digestion and used to transform a NouS rfx2 null mutant. The success of the reinsertion was confirmed by Southern blot analysis.
RT-PCR. RNA was isolated using the RiboPure-Yeast kit (Ambion, Austin, TX). Contaminating chromosomal DNA was removed by treatment with DNase I and removal reagents provided in the RiboPure-Yeast kit. cDNA was made using the ImProm-II reverse transcription system (Promega, Madison, WI). PCR was performed on cDNA templates using primers designed from the sequences of the genes of interest (Table 2), under the following conditions: 1 min at 94°C, 1 min at 55°C, and 1 min at 68°C, preceded by denaturation for 5 min at 94°C and followed by a final extension cycle for 7 min at 68°C. The reactions were initially carried out at 30 cycles; for individual genes, additional cycles were performed to verify that expression ratios remained constant until maximal amplification intensity was achieved. The absence of genomic DNA contamination was controlled by including the constitutively expressed housekeeping gene EFB1 (elongation factor 1β gene) as an internal mRNA control (12). EFB1 contains an intron, such that PCR products from templates of genomic DNA and cDNA yield distinct product sizes of 891 and 526 bp, respectively. PCR products for the genes of interest were sequenced to verify that the desired C. albicans genes were amplified. Measurements of amplified band intensities were made with the ABI Prism 7700 SDS instrument (Applied Biosystems, Foster City, CA) based on ethidium bromide staining. We used EFB1 to normalize the transcript concentrations for each studied gene. EFB1 has been shown to be a useful internal standard for RT-PCR by our laboratory and others because its levels of expression in living C. albicans cells are similar in the conditions under which we performed our experiments (12, 41, 42). Furthermore, we showed by Northern blot analysis that the transcript levels of EFB1 quantitated against C. albicans ACT1 in the wild-type SC5314, rfx2 null mutant, and heterozygous mutant strains were similar (data not shown). All RT-PCR experiments were performed in triplicate on at least two separate days, and the average and standard deviation of the concentration of each band were calculated. The levels of expression by S. cerevisiae and C. albicans mutant strains were compared with those from the appropriate wild-type strains. The difference in levels of expression was considered significant if the mutant/wild-type ratio of expression was >2 and the difference was statistically significant (P value < 0.05).
|
View this table: [in a new window] |
TABLE 2. Primers used for RT-PCR
|
For RT-PCR experiments, C. albicans cells were grown in individual wells of a six-well plate (Costar) at 30°C with 200 rpm shaking until log phase. The supernatant was removed after centrifugation at 1,200 x g for 10 min. The uncovered six-well plate was irradiated at 10 mJ/cm2 using the UV cross-linker. Immediately after irradiation, 2 ml of 30°C-prewarmed YPD was added to each well. After 1- and 3-hour incubations at 30°C, the yeast cells were harvested for RNA extraction.
Susceptibility testing. Log phase C. albicans cells were tested against hydroxyurea (10, 20, 30, 40, 50, and 60 mg/ml), methyl methanesulfonate (MMS; twofold dilution from 12 mM to 0.325 mM), bleomycin (twofold dilution from 16 µg/ml to 0.5 µg/ml), streptonigrin (twofold dilution from 1.6 µg/ml to 0.05 µg/ml), ethyl methanesulfonate (twofold dilution from 120 mM to 1.67 mM), H2O2 (17.6, 13.2, 8.8, 6.6, and 4.4 mM), NaCl (0.7 mM), and ethanol (10%). For heat shock experiments, log phase C. albicans cells were diluted 10-fold in YPD and placed in 1-ml Eppendorf tubes. The tubes were placed in a 48°C water bath for 3 min, and 100 µl of the samples was plated onto Sabouraud dextrose agar (SDA) plates for colony enumeration.
Agar invasion assay. Overnight-grown Candida cells in YPD at 30°C were resuspended in fresh YPD to achieve a concentration at 106 CFU/ml. Two microliters of this inoculum was spotted onto the surfaces of YPD agar plates, which were then incubated for 48 h at 30°C. Cells that had not invaded the agar were washed away by rubbing the plate with a gloved finger while rinsing under running water. Cross-sectional slices of the agar-invasive growth were photographed.
Adherence to BECs.
Adherence to buccal epithelial cells (BECs) was measured as previously described (12, 39). Briefly, BECs pooled from three investigators were dispensed into 10 ml of phosphate-buffered saline (PBS), washed, and adjusted to a final concentration of 1 x 105 epithelial cells/ml PBS. Then, 0.5 ml of the epithelial cells was incubated in a glass tube with 0.5 ml of C. albicans cells at a concentration of 1 x 106 cells/ml in a shaking incubator at 35°C for 1 hour. Following incubation, the cells were vacuum filtered through prewet 20-mm-diameter polycarbonate filters with 10-µm pore size (Millipore, Billerica, MA) mounted on a filter manifold (Millipore, Bedford, MA). Each filter was washed 10 times with PBS to remove unattached Candida cells. The washed filters were then removed and pressed gently onto glass slides. The slides were air dried, heat fixed for 1 min, Gram stained, and examined by light microscopy. The Candida cells attached to 100 BECs were counted in multiple fields. Each experiment was performed in duplicate and repeated at least twice on two different days. Results for each strain were expressed as the mean percentage of adherence ± standard deviation (i.e., mean number of Candida cells/100 BECs). The difference in adherence to BECs between the wild-type and mutant strains was determined using Student's t test; a P value
0.05 was considered significant.
Murine model of OPC.
A murine model of OPC was developed as previously described (13) with some modifications. Seven-week-old male ICR mice (Harlan Sprague) with an approximate weight of 20 g were immunosuppressed with 200 mg/kg of body weight of cortisone acetate (Sigma Aldrich, St. Louis, MO) in saline with 0.1% Tween 80 administered subcutaneously on the day before inoculation and day 1 and day 4 after inoculation. Mice received tetracycline hydrochloride in their drinking water (0.5 mg/ml), starting the day before inoculation. For infection, the mice were first anesthetized by intraperitoneal injections with 140 mg/kg of pentobarbital sodium (Nembutal) solution (Abbott Laboratories, North Chicago, IL); this dose kept the mice well sedated for at least 3 h. After the mice were fully sedated, cotton wool balls (diameter, 3 mm) saturated with 50 µl of 1 x 108 CFU/ml of C. albicans were placed sublingually in the oral cavity for 2 h. Fifteen to 17 mice per group were used. The mice were euthanized by CO2 asphyxiation followed by cervical dislocation at 6, 24, and 72 h and on day 7 after infection. The esophagus, mandibular soft tissue, and tongue were dissected free of teeth and bone. The tissue was homogenized in saline, plated onto SDA containing ampicillin (100 µg/ml) and amikacin (60 µg/ml), and incubated at 30°C for 48 h. Tissue burden was enumerated by colony count. Interquartile values were used in the data analysis, and tissue burdens for mice infected with each strain were presented as mean log10 of tissue burden/gram of tissue ± standard deviation. The difference in tissue burden between mice infected with the wild-type or mutant strains was determined by Wilcoxon's test. P values of
0.05 were considered significant. For histopathology study, the tissues were fixed with formalin and embedded in paraffin, after which thin sections were prepared and stained with Gomori methenamine silver stain.
Murine model of disseminated candidiasis (DC).
Seven-week-old, male ICR mice (Harlan Sprague) were inoculated by intravenous injection of the lateral tail vein with 5 x 105 CFU of C. albicans strains in 0.2 ml of normal saline solution. Ten to 12 mice per group were used. Mice were followed until they were moribund, at which point they were sacrificed, or for 30 days. For tissue burden and histopathologic study, 12 mice per group were sacrificed at 6, 24, and 72 h postinfection, respectively, and the kidneys, livers, and spleens were obtained. For the tissue burden study, the kidneys, livers, and spleens were removed, weighed, and then homogenized in normal saline solution and plated on SDA containing ampicillin (100 µg/ml) and amikacin (60 µg/ml). Survival curves were calculated according to the Kaplan-Meier method using the PRISM program (GraphPad Software) and compared using the Newman-Keuls analysis. A P value of
0.05 was considered significant. As in OPC experiments, interquartile values were used in the data analysis. The tissue burdens were logarithmically transformed, and data were presented as mean log10 CFU/g tissue ± standard deviations; the differences in tissue burden between strains were calculated using Wilcoxon's test.
|
|
|---|
To determine if the protein encoded by C. albicans orf19.4590 is functionally related to S. cerevisiae Rfx1p, we measured expression of RNR3 and HUG1 in a diploid S. cerevisiae rfx1 null mutant strain (strain Hom14D-1-34152) transformed with a vector containing orf19.4590 and its flanking regions (Fig. 1). The S. cerevisiae rfx1 null mutant transformed with an S. cerevisiae RFX1 plasmid and the same mutant transformed with the vector alone served as positive and negative controls, respectively. In YPD medium at 30°C, the derepression of RNR3 and HUG1 in the null mutant was fully reversed in the transformants complemented with S. cerevisiae RFX1 (Fig. 1). In transformants complemented with orf19.4590, RNR3 and HUG1 derepression was partially reversed (Fig. 1). As anticipated, RNR3 and HUG1 derepression was unaffected in the S. cerevisiae rfx1 null mutant transformed with the vector alone. Experiments were repeated with independently created S. cerevisiae transformants with similar results. These findings suggest that orf19.4590 has some functional redundancy with S. cerevisiae RFX1.
![]() View larger version (23K): [in a new window] |
FIG. 1. HUG1 and RNR3 expression by an S. cerevisiae rfx1 null mutant complemented with C. albicans orf19.4590. Levels of HUG1 and RNR3 expression in wild-type S. cerevisiae strain BY4743, an S. cerevisiae rfx1 null mutant strain, and the S. cerevisiae rfx1 mutant complemented with C. albicans orf19.4590 were assessed by RT-PCR following growth to log phase in YPD at 30°C. The S. cerevisiae rfx1 mutants complemented with S. cerevisiae RFX1 or transformed with the vector alone were used as positive and negative controls, respectively. Data (means ± standard deviations) are expressed as the increases above the expression level of BY4743. The graph shows data from triplicate experiments. Asterisks denote statistical difference (P < 0.05) in the level of expression by the respective strains compared with the level of expression by BY4743.
|
![]() View larger version (39K): [in a new window] |
FIG. 2. Resistance of S. cerevisiae (A) and C. albicans (B) strains to UV irradiation. Log phase yeast cells freshly streaked onto a YPD agar plate were subjected to irradiation (15 mJ/cm2 for S. cerevisiae and 10 mJ/cm2 for C. albicans) using a UV cross-linker and then incubated at 30°C for 24 h for colony enumeration. The percent survival was calculated by the following formula: (number of colonies identified on a plate after UV exposure/number of colonies on a plate without UV exposure) x 100%. The experiments were performed in duplicate on two different days. The data presented are the mean percentages of survival ± standard deviations. Asterisks denote significant difference (P < 0.05) in survival of the respective strains compared with the survival of BY4743 (A) or SC5314 (B).
|
Deletion of C. albicans RFX2 results in increased resistance to UV killing, as well as the derepression of various stress-related genes. To further study C. albicans RFX2, we independently constructed two sets of isogenic mutant strains in which one or both copies of the gene were disrupted and reinsertion strains in which a copy of the gene was reintroduced to the null mutant at the native locus. After verifying the desired disruptions and reinsertions by PCR amplifications and Southern analyses, we demonstrated that the mutant and reinsertion strains had growth rates similar to that of wild-type strain SC5314 in both liquid YPD and minimal media at 35°C (data not shown).
Next, we tested for susceptibility to ionizing radiation, hydroxyurea, and several radiomimetic drugs (bleomycin, MMS, streptonigrin, and ethyl methanesulfonate). Similar to the S. cerevisiae rfx1 null mutant and wild-type strains, the C. albicans rfx2 null mutant was more resistant to UV killing than SC5314 (Fig. 2B). The rfx2 heterozygous mutant and RFX2 reinsertion strains did not significantly differ from SC5314. We found no differences in the sensitivities of the rfx2 null mutant and SC5314 to hydroxyurea, bleomycin, MMS, streptonigrin, or ethyl methanesulfonate (data not shown). We also tested the susceptibility of the C. albicans strains to heat shock at 48°C and oxidative (ethanol, H2O2) and osmotic (NaCl) stresses. The rfx2 null mutant was significantly more resistant than SC5314 to heat shock and 10% ethanol (Fig. 3A and B) but equally susceptible to 0.7 mM NaCl and 13.2 mM H2O2 (data not shown). The rfx2 heterozygous mutant and RFX2 reinsertion strains were more resistant than SC5314 but more susceptible than the rfx2 null mutant to heat shock and 10% ethanol, results reflecting possible haploinsufficiency. As for each of the in vitro phenotypes presented below, independently created heterozygous mutant, null mutant, and reinsertion strains yielded similar results.
![]() View larger version (17K): [in a new window] |
FIG. 3. Effects of C. albicans RFX2 on resistance to heat shock (A) and ethanol (B). For the heat shock assay (A), log phase C. albicans cells were dispensed to 1-ml Eppendorf tubes and exposed to a 48°C water bath for 3 min. The cells were then cultured on SDA plates at 35°C for colony enumeration. For susceptibility to ethanol (EtOH) (B), log phase C. albicans cells were exposed to 10% ethanol at 35°C with shaking at 200 rpm. Hourly optical density (O.D.) readings at 600 nm were obtained up to 12 h. Both experiments were performed in triplicate. The data are presented as the means of all experiments. Asterisks denote significant difference (P < 0.05) in survival of the respective strains compared with the survival of SC5314.
|
|
View this table: [in a new window] |
TABLE 3. Effects of C. albicans RFX2 on the expression of DNA damage genes
|
S. cerevisiae MEC1 encodes a phosphoinositide kinase that functions upstream of Rad53p and Rfx1p as the major checkpoint in the DNA damage response pathway (25, 41). We demonstrated that, as anticipated, C. albicans MEC1 was induced in response to UV exposure (Table 3). The expression pattern was similar for the C. albicans rfx2 null mutant strain, demonstrating that RFX2 does not repress MEC1 and likely functions downstream in the damage response pathway.
The C. albicans rfx2 null mutant displays hyperfilamentous growth and overexpresses hypha-specific genes. Having confirmed our hypothesis that RFX2 would repress the expression of DNA damage response genes, we evaluated the effects of gene deletion on morphogenesis. Colonies of SC5314, rfx2 heterozygous mutant, and RFX2 reinsertion strains were smooth under non-hypha-inducing conditions on solid agar (YPD at 30°C for 72 h). The colonies of the rfx2 null mutant, on the other hand, were wrinkled (data not shown). Examination of the colony margins revealed extensive filaments for the null mutant and no or minimal filaments for SC5314, heterozygous mutant, and reinsertion strains (Fig. 4). Similar results were obtained following growth on SDA medium at 30°C (Fig. 4). Under hypha-inducing conditions on solid agar (YPD medium supplemented with 5% FCS, medium 199, and Spider medium at 37°C), all strains demonstrated filamentous growth (data not shown). In YPD liquid medium incubated at 30°C, the strains were all in the yeast morphology and indistinguishable from one another. Under hypha-inducing conditions in liquid medium (YPD supplemented with 5% FCS at 37°C), the strains formed extensive hyphae, although those of the null mutant were 20 to 50% longer than those of the SC5314, rfx2 heterozygous mutant, and RFX2 reinsertion strains at the same time points (data not shown). Moreover, the majority of SC5314, heterozygous mutant, and reinsertion cells reverted to yeast forms following overnight growth in YPD plus 5% serum at 37°C, whereas the majority of null mutant cells remained in hyphal and pseudohyphal morphologies (Fig. 5). In addition to a hyperfilamentous phenotype, the rfx2 null mutant strain showed enhanced invasion into solid agar (Fig. 6). The invasive growth of rfx2 heterozygous mutant and RFX2 reinsertion strains was intermediate to that of SC5314 and that of the rfx2 null mutant.
![]() View larger version (88K): [in a new window] |
FIG. 4. Morphologies of C. albicans strains under non-hypha-inducing conditions on solid media. C. albicans cells grown overnight in YPD at 30°C were subcultured onto YPD agar (top) and SDA (bottom) and grown at 37°C for 72 h. (A) SC5314; (B) rfx2 heterozygous mutant; (C) rfx2 null mutant; (D) RFX2 reinsertion strain.
|
![]() View larger version (33K): [in a new window] |
FIG. 5. Morphologies of C. albicans strains after overnight growth. C. albicans strains were grown overnight in YPD supplemented with 5% serum at 37°C. Representative cell morphologies of C. albicans SC5314 and rfx2 heterozygous mutant, rfx2 null mutant, and RFX2 reinsertion strains are pictured. The null mutant existed predominantly as clumps of hyphae (pictured) and pseudohyphae (not shown). Following overnight growth, the cultures were transferred to test tubes and let stand for 15 min (E). As pictured, the filamentous cells of the null mutant precipitated at the bottom of the tube (tube 2). The blastoconidia of SC5314 (tube 1) and the RFX2 reinsertion strain (tube 3) remained in suspension. The tubes containing the rfx2 null mutant (not shown) resembled those containing C. albicans SC5314 and the RFX2 reinsertion strain.
|
![]() View larger version (45K): [in a new window] |
FIG. 6. Agar invasion by C. albicans strains. Overnight-grown C. albicans cells in YPD at 30°C were resuspended in fresh YPD and inoculated onto the surfaces of YPD agar plates, which were then incubated for 48 h at 30°C. Cells that did not invade the agar were washed away, and cross-sectional slices of the agar were photographed.
|
|
View this table: [in a new window] |
TABLE 4. Effects of C. albicans RFX2 on the expression of hypha-specific genes
|
![]() View larger version (13K): [in a new window] |
FIG. 7. Adherence by C. albicans strains to BECs in vitro. C. albicans cells were coincubated with BECs for 60 min, as described in Materials and Methods. Percent adherence is defined as the mean number of C. albicans cells/100 BECs. Data are presented as means of all experiments ± standard deviations.
|
![]() View larger version (15K): [in a new window] |
FIG. 8. Effects of RFX2 on the survival of mice with HDC. Seven-week-old, male ICR mice (Harlan Sprague) were inoculated by intravenous injection of the lateral tail vein with 5 x 105 CFU of C. albicans strains and followed for 30 days.
|
|
View this table: [in a new window] |
TABLE 5. C. albicans tissue burdens among mice with HDCa
|
![]() View larger version (112K): [in a new window] |
FIG. 9. Histopathology of the tongues (A and B) and esophagi (C and D) of mice infected with C. albicans strains. Mice were infected sublingually with C. albicans SC5314 (A and C) or the rfx2 null mutant (B and D), as described in Materials and Methods. Organs were harvested after 7 days, processed, and stained with hematoxylin-eosin (left) and Gomori methenamine silver (right). In the tongues of mice infected with C. albicans SC5314 (A), an intense intraepithelial lymphocyte response is noted in the squamous epithelium, with associated hyperkeratosis and neutrophils. Fungal elements are extensive and comprise roughly equal measures of hyphae and yeasts. In the tongues of mice infected with the rfx2 null mutant (B), the epithelium has a mild degree of intraepithelial lymphocytosis and only focal keratosis. Fungal elements are less common and predominantly hyphae. In the esophagi of mice infected with C. albicans SC5314 (C), there is a moderate lymphocyte response. As in the tongue, there are extensive yeasts and hyphae. In the esophagi of mice infected with the rfx2 null mutant (D), no inflammation or fungal elements were detected.
|
|
|
|---|
C. albicans RFX2 is one of two genes encoding RFX domain-containing proteins in the genome sequence database. The other is C. albicans orf19.3865, which encodes a protein that more closely resembles the sole RFX domain-containing protein of S. cerevisiae, Rfx1p. Given the sequence homology, we propose that orf19.3865 be named C. albicans RFX1, and we have named our gene RFX2. In this study, we demonstrate that C. albicans RFX2 has at least partial function redundancy with S. cerevisiae RFX1. In S. cerevisiae rfx1 null mutants, DNA damage response genes like RNR3 and HUG1 are derepressed and cells are rendered more resistant to UV killing. Transformation of an S. cerevisiae rfx1 mutant with a plasmid expressing C. albicans RFX2 significantly reduced expression of RNR3 and HUG1 and restored wild-type UV susceptibility. C. albicans wild-type strain SC5314 responded to UV exposure by inducing RFX2, RAD6 (a gene induced by and required for UV resistance), and DDR48 (a gene encoding a Hog1p-induced stress protein). Deletion of RFX2 resulted in significant derepression of RAD6 and DDR48 under nonstressful conditions. Moreover, the C. albicans rfx2 null mutant was more resistant than SC5314 to UV killing, 48°C heat shock, and 10% ethanol, suggesting that the basal derepression of DNA damage and UV-induced genes was protective. Taken together, the data indicate that C. albicans RFX2 can perform at least some of the functions of S. cerevisiae RFX1 and that the genes contribute to similar phenotypes.
UV exposure and other genotoxic insults to C. albicans result in filamentous growth (45). We demonstrate that Rfx2p is a crucial link between DNA damage responses and morphogenesis. As anticipated, exposure of wild-type C. albicans SC5314 to UV radiation induced the expression of hypha-specific genes HWP1, HYR1, ECE1, and, to a lesser extent, ALS3. Deletion of RFX2 resulted in the constitutive overexpression of these genes as well as CEK1. In addition, the rfx2 null mutant demonstrated hyperfilamentous growth on solid agar under non-hypha-inducing conditions. Along these lines, it is notable that genotoxic stress-induced filamentous growth by C. albicans is dependent upon intact DNA damage checkpoints (2, 45). Similar to S. cerevisiae Rfx1p, C. albicans Rfx2p is likely to function as a downstream effector of the highly conserved and well-characterized Mec1-Rad53 DNA checkpoint pathway.
The attenuated virulence of the rfx2 null mutant is consistent with reports of other hyperfilamentous C. albicans strains, including null mutants in which negative transcriptional regulators encoded by C. albicans TUP1, NRG1, RFG1, and SPT3 were disrupted (6-8, 28, 30, 34, 35). We showed that Rfx2p contributes to pathogenesis by assessing two distinct models of murine candidiasis. During hematogenously disseminated candidiasis (HDC), the rfx2 mutant caused significantly less overall mortality. The null mutant was also less likely than SC5314 to cause DC by mucosal translocation, as demonstrated in cortisone-treated mice that received 2-hour sublingual inoculations of C. albicans. When the inoculation time in these mice was shortened to 1 hour, the null mutant caused lower tissue burdens of infection and less inflammation within oral and esophageal mucosa than SC5314 after 7 days. It is not possible to discern from our data whether the attenuated virulence is a consequence of impaired DNA damage responses, dysregulated morphogenesis, some other process, or a combination of mechanisms. In general, it is unclear whether morphogenesis per se contributes to the pathogenesis of candidiasis rather than morphology-associated patterns of gene expression (24, 46, 48). In fact, pathways regulating C. albicans morphogenesis converge to influence the expression of genes encoding diverse virulence factors (29, 32). Nevertheless, it is notable that the rfx2 mutant not only exhibited derepressed filamentation but also failed to revert back to yeast morphology following overnight growth in liquid medium. To the extent that morphogenesis is a virulence determinant, therefore, the ability to switch back and forth between blastoconidial and filamentous growth might be more important to survival in different environments in vivo than merely the ability to form filaments.
It is interesting that the rfx2 null mutant was significantly more adherent than SC5314 to BECs in vitro and more invasive into solid agar. Although it has long been established that C. albicans hyphae are generally more adherent to host cells than conidia (39), our results in vitro cannot be attributed to the hyperfilamentous growth of the mutant since both strains were tested as yeasts. Indeed, Gram stains confirmed that SC5314 and the null mutant were morphologically similar during the in vitro assay. Rather, Rfx2p is likely to influence adhesion through its role in transcriptional repression. The derepression of HWP1 and ALS3, hypha-specific genes encoding adhesins (46, 55), under basal conditions associated with growth in the yeast morphology supports this hypothesis. The equivalent tissue burdens of SC5314 and the rfx2 null mutant after 6 h of murine OPC, however, highlight several important points: (i) adherence and penetration are not the sole determinants of pathogenicity, even at relatively early time points; (ii) in vitro assays cannot completely replicate complex in vivo systems; and (iii) mechanisms of pathogenesis differ at unique tissue sites.
The precise mechanisms by which Rfx2p contributes to the regulation of the interrelated processes of morphogenesis, virulence, and adherence will need to be elucidated in future studies. At least some of the cellular functions of Rfx2p are likely to be mediated through the transcriptional repressor Tup1p. Tup1p forms an evolutionarily conserved corepressor complex with Ssn6p, which is targeted to specific promoters through interactions with a variety of DNA binding proteins. S. cerevisiae Rfx1p targets Tup1p-Ssn6p to DNA damage response genes. As alluded to earlier, deletion of C. albicans TUP1 results in hyperfilamentous and invasive growth, derepression of hypha-specific genes, and attenuated virulence during murine candidiasis, similar to our observations with the rfx2 null mutant (6-9, 21, 34, 35, 44). Despite the phenotypic similarities, there are morphological differences between rfx2 and tup1 mutants. The rfx2 mutant grows as a mixture of blastospore and filamentous morphologies, whereas the tup1 mutant grows solely as filaments (35). In addition, rfx2 cells are able to form normal hyphal cells under a range of experimental conditions, unlike tup1 cells, which are fixed in a pseudohyphal morphology (35). In this regard, the rfx2 null mutant more closely resembles C. albicans strains with disruptions of NRG1, a gene encoding another DNA binding protein that targets TUP1 (6, 21, 34, 35). Interestingly, Nrg1p appears to regulate some C. albicans genes in a Tup1p-independent manner (34). It is likewise possible that Rfx2p regulates transcription by both Tup1p-dependent and -independent mechanisms.
Finally, our findings indicate that C. albicans Rfx1p cannot fully perform the cellular functions of Rfx2p in the absence of the latter protein. It is unclear at present whether the two RFX domain-containing proteins have similar, overlapping, or independent functions. In considering potential functions for Rfx1p and Rfx2p, it is worth noting that conserved DNA binding proteins like Nrg1p and Rfg1p (the homologue to S. cerevisiae Rox1p) have divergent cellular roles in C. albicans and S. cerevisiae (28, 34). In future studies, therefore, we will characterize the roles of C. albicans Rfx1p in DNA damage response, filamentation, and virulence, as well as determine if Rfx1p and Rfx2p contribute to cellular responses in S. cerevisiae not described.
Research was funded by an NIH Mycology Research Unit Program Project Award (5P01AI061537-02 to C.J.C. and M.H.N.) and supported by the VA Medical Research Service and the University of Florida.
Published ahead of print on 27 February 2009. ![]()
Contributed equally to the study. ![]()
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»