This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cornillon, S.
Right arrow Articles by Cosson, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cornillon, S.
Right arrow Articles by Cosson, P.

 Previous Article  |  Next Article 

Eukaryotic Cell, September 2008, p. 1600-1605, Vol. 7, No. 9
1535-9778/08/$08.00+0     doi:10.1128/EC.00155-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Involvement of Sib Proteins in the Regulation of Cellular Adhesion in Dictyostelium discoideum{triangledown} ,{dagger}

Sophie Cornillon, Romain Froquet, and Pierre Cosson*

Geneva Faculty of Medicine, Cell Physiology and Metabolism Department, Centre Médical Universitaire, 1 Rue Michel Servet, 1211 Geneva 4, Switzerland

Received 5 May 2008/ Accepted 21 July 2008


arrow
ABSTRACT
 
Molecular mechanisms ensuring cellular adhesion have been studied in detail in Dictyostelium amoebae, but little is known about the regulation of cellular adhesion in these cells. Here, we show that cellular adhesion is regulated in Dictyostelium, notably by the concentration of a cellular secreted factor accumulating in the medium. This constitutes a quorum-sensing mechanism allowing coordinated regulation of cellular adhesion in a Dictyostelium population. In order to understand the mechanism underlying this regulation, we analyzed the expression of recently identified Dictyostelium adhesion molecules (Sib proteins) that present features also found in mammalian integrins. sibA and sibC are both expressed in vegetative Dictyostelium cells, but the expression of sibC is repressed strongly in conditions where cellular adhesion decreases. Analysis of sibA and sibC mutant cells further suggests that variations in the expression levels of sibC account largely for changes in cellular adhesion in response to environmental cues.


arrow
INTRODUCTION
 
Adhesion of eukaryotic cells is essential for many cellular functions, such as attachment and migration on a substratum, phagocytosis, or establishment of intercellular contacts. It is involved in many complex biological processes, such as multicellular development, immune response, wound healing, or tumor spreading. Dictyostelium discoideum amoebae adhere to a wide range of substrates and can achieve very fast cellular migration and very efficient phagocytosis (3). They are also amenable to genetic analysis and thus represent a widely used system for analyzing cellular adhesion (7), migration (16), and phagocytosis (8, 14).

Many gene products essential for efficient adhesion of Dictyostelium cells to its substrate or to phagocytic particles have been identified by screening libraries of random mutants or by analyzing targeted knockout mutants (1, 13, 15, 18). Several of these gene products are homologous to genes involved in integrin-dependent adhesion in mammalian cells. Thus, talin and a myosin exhibiting a FERM domain (myosin VII in Dictyostelium and myosin X in mammals) are involved in adhesion of Dictyostelium cells (21, 22) as well as in integrin-dependent adhesion of mammalian cells (20, 26). More recently, SibA was identified as a transmembrane protein essential for efficient adhesion and present at the surface of Dictyostelium cells (12). SibA presents features also found in integrin β chains, interacts with talin, and likely represents the functional equivalent of mammalian integrins in Dictyostelium, although its phylogenetic relationship to mammalian integrins remains a matter of speculation (12, 14). Four close homologs of SibA can be identified in the Dictyostelium genome (SibB to SibE), the functions of which are unknown (12). Since all Sib proteins are capable of interacting with talin (12), it seems likely that they could all play a role in cellular adhesion.

Here, we report that cellular adhesion is tightly regulated by growth conditions in vegetative Dictyostelium cells, and we investigated the possibility that this could be the result of changes in the expression of Sib proteins. Our results suggest that variations in cellular adhesion can largely be accounted for by changes in the levels of expression of SibC.


arrow
MATERIALS AND METHODS
 
Cell culture and cellular assays. Cells were cultured at 21°C in HL5 medium (14.3 g/liter peptone [Oxoid, Hampshire, England], 7.15 g/liter yeast extract, 18 g/liter maltose monohydrate, 0.641 g/liter Na2HPO4·2H2O, 0.490 g/liter KH2PO4). Unless otherwise specified, they were not allowed to reach a density of more than 106 cells/ml.

All mutants used here were derived from the parental DH1-10 strain (9, 13), referred to herein as the wild type for simplicity. The sibA mutants were described previously (12). The ampA mutant cells (2), countin mutant cells (17), smlA mutant cells (4), cmf mutant cells (25), cf50 mutant cells (5), and aprA mutant cells (6) were kind gifts of D. Blumberg (University of Maryland) and R. Gomer (Rice University).

To create a sibC knockout strain (see Fig. S1 in the supplemental material), we obtained from the DictyEnsembl genome server (http://dictyensembl.bioch.bcm.tmc.edu/) a vector created by recovering, after SpeI digestion of the genomic DNA, a DIV6 (uracil-selection) vector inserted at a DpnII site within the sibC coding sequence (position 2543 in the sibC coding sequence). This vector thus contains the flanking regions of its insertion site in sibC and can be used to create a specific knockout strain. The genomic sequence was excised from this vector by using KpnI (position 3601 in the sibC coding sequence) and PvuII (position 2171) and subcloned in a blasticidin resistance vector (pSP-Bsr, composed of the Bsr resistance cassette inserted in a pSP73 vector). The resulting vector was linearized with SpeI (position 864 in the sibC coding sequence) and used to transfect DH1-10 cells. After blasticidin selection, individual clones were tested by PCR (11) using the following pair of primers: TGTAAAGGTTGCACAAACAGTGG (position 968 in the sibC coding sequence) and GTCAGTGAGCGAGGAAGCGG (within the pSP-Bsr vector). As described previously (10), a correct insertion results in a 1,300-bp PCR fragment (see Fig. S1 in the supplemental material).

We tried repeatedly with no success to create a sibA sibC double knockout strain by using the DictyEnsembl vector described above and uracil selection. This failure may reflect the fact that the sibA sibC double deletion is not viable in Dictyostelium.

Irrespective of the conditions under which cells were preincubated, unless otherwise specified, phagocytosis and fluid phase uptake were always measured by incubating a shaken suspension of cells for 20 min at 21°C in fresh HL5 medium containing 0.5 µm-diameter Fluoresbrite YG carboxylate microspheres (referred as "latex beads"; Polysciences, Warrington, PA) or 10 µg/ml of Alexa647-labeled dextran (Molecular Probes, Eugene, OR). The internalized fluorescence was measured in a fluorescence-activated cell sorter after rinsing the cells twice at 4°C with HL5 medium containing 0.1% sodium azide (13). The number of internalized latex beads could be deduced from the internalized fluorescence by comparing it to the fluorescence of a single latex bead. To measure phagocytosis of beads in phosphate buffer, the cells were rinsed once with phosphate buffer (2 mM Na2HPO4, 14.7 mM KH2PO4), phagocytosis was performed in phosphate buffer containing fluorescent latex beads, and then the internalized fluorescence was determined as described above.

To obtain conditioned HL5 medium, 2 x 106 wild-type cells were implanted in fresh HL5 medium and grown for 24 h. The medium was then collected and filtered. Freezing and storage at –20°C did not affect the properties of conditioned medium (CM) (data not shown). In the experiments described in Fig. 5, the CM was diluted 1:2 in fresh HL5 medium to induce a less stringent inhibition of cellular adhesion. In the recovery experiment presented in Fig. 6, cells (100,000 cells/ml) were plated in a petri dish in fresh HL5 medium and grown overnight before the experiment (final concentration, <106 cells/ml). The medium in this experiment was conditioned by the growing cells themselves.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 5. sibA and sibC mutant cells adapt differently to culture conditions. Wild-type (WT) and sibA or sibC mutant cells were incubated for 4 h under conditions inducing optimal or nonoptimal adhesion, as described in the legend to Fig. 4, before measuring their abilities to phagocytose latex beads in HL5 medium. The CM used in these experiments was medium conditioned by wild-type cells, but similar results were obtained with medium conditioned by sibA or sibC mutant cells. (Top) A typical experiment, where results are expressed as the number of beads internalized per cell under each condition. (Bottom) The averages and the standard errors of the means for the results of at least four independent experiments, where results are expressed as percentages of phagocytosis in mutant cells compared to those in wild-type cells under the same conditions. Phagocytosis in sibC mutant cells was significantly different from that in wild-type cells (Student's t test, P < 0.05). Phagocytosis was significantly different under optimal conditions versus under nonoptimal conditions for sibA mutant cells (P < 0.05), but not for sibC mutant cells (P > 0.2).


Figure 6
View larger version (19K):
[in this window]
[in a new window]

  		FIG. 6. Kinetic analysis of cellular adhesion in wild-type (WT) and sibA and sibC mutant cells. Wild-type and sibA or sibC mutant cells were grown overnight in a petri dish, i.e., under nonoptimal conditions for adhesion; cells adhered to the plate and conditioned their culture medium. At time zero, they were switched to conditions favoring optimal adhesion (suspension in fresh HL5 medium), and phagocytosis efficiency was tested at the indicated times over a period of 2 hours. Phagocytosis increased dramatically with time in sibA mutant cells, presumably reflecting upregulation of sibC expression. sibC mutant cells presented a constant phagocytosis defect at all time points. This experiment was repeated with very similar results. As described in the legend for Fig. 7, these observations are compatible with the notion that SibA and SibC play redundant roles in cellular adhesion and that variations in cellular adhesion largely reflect changes in sibC expression.

To examine cell substrate adhesion, cells were first incubated for 4 h either in suspension in fresh HL5 medium or attached to plastic in a well filled with conditioned HL5 medium. They were then recovered, resuspended in fresh HL5 medium, allowed to attach to a glass coverslip for 10 min, and observed for 15 min by phase-contrast microscopy and interference reflection microscopy (IRM) (24), using an Axiovert 100 microscope (Carl Zeiss AG) coupled to a Hamamatsu Photonics camera and Openlab 3.0.6 software. Contact surfaces were determined using the MetaMorph offline software.

Real-time PCR. To assess the effect of cell culture conditions, 107 cells were incubated for 4 h either adherent to a petri dish in CM (8 ml) or in suspension in fresh HL5 medium (8 ml). Under the latter condition, the medium was changed every hour to prevent cells from conditioning the medium.

Cellular RNAs were extracted using the NucleoSpin RNA II kit (Macherey-Nagel, Düren, Germany). cDNA were synthesized from 1 µg of total RNA by using random hexamers and SuperScript II reverse transcriptase (Invitrogen, Basel, Switzerland), following the supplier's instructions. Sybr green assays were designed using the program Primer Express version 2.0 (Applied Biosystems, Foster City, CA) with default parameters. Amplicon sequences were aligned against the Dictyostelium genome by BLAST to ensure that they were specific for each gene being tested. Oligonucleotides were obtained from Invitrogen. The efficiency of each design was tested with serial dilutions of cDNA. Oligonucleotide sequences are described in Table 1. PCR mixtures (10-µl volumes) contained diluted cDNA, 2x Power Sybr green master mix (Applied Biosystems), and 300 nM of forward and reverse primers. PCRs were performed on an SDS 7900HT instrument (Applied Biosystems) with the following parameters: 50°C for 2 min, 95°C for 10 min, then 45 cycles of 95°C for 15 s and 60°C for 1 min. Each reaction was performed in three replicates on 384-well plates. Raw threshold cycle (CT) values obtained with SDS 2.2 software (Applied Biosystems) were imported in Excel and normalization factor and fold changes were calculated using the geNorm method (23).


View this table:
[in this window]
[in a new window]

  		TABLE 1. Oligonucleotide sequences used for real-time PCR

Two reference genes were used to normalize PCRs, with equivalent results (Table 1): the Ig7 gene (mitochondrial large subunit rRNA) and actin.


arrow
RESULTS
 
Regulation of cell adhesion in Dictyostelium. The ability of Dictyostelium cells to adhere to a substrate can be assessed simply by measuring their ability to phagocytose latex beads in a shaken suspension. This property has been instrumental in isolating mutant cells with defects in cellular adhesion, which do not efficiently bind latex beads and consequently fail to phagocytose them (13, 18). Fluid phase uptake occurs essentially by macropinocytosis in Dictyostelium (19), a process that involves the actin cytoskeleton in a manner similar to phagocytosis but is independent of cell adhesion. Therefore, when cellular adhesion is specifically affected, uptake of fluid phase is unchanged relative to that of wild-type cells (13). A combined measurement of phagocytosis and of macropinocytosis is thus a simple and quantitative method to measure variations in cellular adhesion (13).

We noticed repeatedly during our experiments that the efficiency with which Dictyostelium cells performed phagocytosis varied strongly depending on the conditions under which the cells were grown prior to the experiments. In particular, an increase in cellular density correlated with a decrease in phagocytosis. Similarly, we observed that cells that were grown adherent to a surface seemed to phagocytose less efficiently than cells grown in a shaken suspension. While these variations were avoided in previous studies by growing cells under standardized conditions, they suggested that cellular adhesion in Dictyostelium might be regulated by a series of environmental cues.

In order to study the regulation of phagocytosis in Dictyostelium, we compared the abilities of wild-type Dictyostelium cells grown under different conditions to phagocytose latex beads. Note that, irrespective of the conditions to which the cells were exposed prior to the test, the phagocytosis test itself was always performed for 20 min in a shaken suspension in fresh HL5 medium. Thus, these experiments can only reveal relatively stable changes in cellular physiology and would not detect rapidly reversible changes. Phagocytosis was strongly decreased in a dense culture of wild-type cells compared to in cells grown under more diluted conditions (Fig. 1A), while the ability to perform macropinocytosis did not diminish (Fig. 1B). These results suggested that cells reaching a high density show a specific defect for adhesion to and phagocytosis of latex beads. In agreement with this interpretation, we observed that phagocytosis of beads performed in phosphate buffer, which relies on a different adhesion machinery (13, 18), was not affected by growth conditions (Fig. 1C).


Figure 1
View larger version (14K):
[in this window]
[in a new window]

  		FIG. 1. Cell density affects phagocytosis. Wild-type cells were plated at 6 x 103 (1), 1.8 x 104 (2), 6 x 104 (3), or 1.8 x 105 (4) cells/ml. Two days later, the cell densities were approximately 105 (1), 4 x 105 (2), 106 (3), and 3 x 106 (4) cells/ml, respectively. Two hundred thousand cells from each plate were collected, rinsed, and incubated for 20 min in fresh HL5 medium containing fluorescent latex beads (A) or fluorescent dextran (B) or in phosphate buffer (PB) containing fluorescent latex beads (C). The cells were then washed, and internalized fluorescence was measured by fluorescence-activated cell sorter analysis. The internalized material was expressed as a percentage of the value obtained for the most diluted cells. The averages and the standard errors of the means for the results of three independent experiments are shown. When cellular density increased, phagocytosis in medium efficiency decreased significantly (Student's t test, P < 0.05) while macropinocytosis of fluid phase increased. Phagocytosis in phosphate buffer, which relies on different adhesion mechanisms, was not affected.

One possible effect of increasing cellular density is that cells might exhaust some nutrients and/or accumulate secreted cellular products in the medium. To examine this possibility, we assessed the effect of exposing cells to CM for 4 hours prior to assessing phagocytosis. Cells incubated in CM phagocytosed significantly less particles than cells incubated in fresh medium (FM) (Student's t test, P < 0.05) (Fig. 2A). More detailed analysis revealed that this was due to the accumulation of an unidentified secreted cellular factor in the CM (see Fig. S2 in the supplemental material). We also observed in these experiments that cells grown attached to a substratum phagocytosed less efficiently than cells preincubated in a shaken suspension (Student's t test, P < 0.05) (Fig. 2A). This effect was additive with the effect of the CM (Fig. 2A). Under all these conditions, macropinocytosis remained essentially unchanged, suggesting that the phagocytosis defect observed reflected a specific decrease in cellular adhesion (Fig. 2B). These results indicate that the ability of cells to perform phagocytosis can vary strongly between optimal conditions (cells in suspension in FM) and nonoptimal conditions (adherent cells in CM).


Figure 2
View larger version (17K):
[in this window]
[in a new window]

  		FIG. 2. Environmental cues regulating Dictyostelium phagocytosis. Dictyostelium cells (2 x 105 cells) were incubated for 4 h in 1 ml of either FM or CM. During this period of time, cells were either allowed to attach to a substrate (Adh.) or kept in a shaken suspension (Susp.). Following this incubation, cells were resuspended, and their ability to phagocytose latex beads (A) or to macropinocytose fluid phase (B) was determined as described in the legend to Fig. 1. The averages and standard errors of the means for the results of three independent experiments are indicated. All values are significantly different from the values obtained after incubating cells in suspension in FM (P < 0.05). These results indicate that adherent cells, as well as cells incubated in CM, downregulate their phagocytosis efficiency relative to cells grown in suspension in FM. a.u., internalized fluorescence (arbitrary units).

In order to ensure that changes in phagocytosis efficiency were caused by changes in cellular adhesion, we tested cellular adhesion directly on a substrate. For this, cells were preincubated under conditions promoting optimal or minimal phagocytosis; then, they were plated on a glass coverslip, and their adhesion to the substrate was visualized by IRM. Cells preincubated under conditions promoting efficient phagocytosis adhered more efficiently to the substrate than cells incubated under conditions inhibiting phagocytosis (Fig. 3). This result confirmed that the observed variations in phagocytosis efficiency reflected changes in cellular adhesion.


Figure 3
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 3. Changes in phagocytosis reflect modifications in cellular adhesion. Dictyostelium cells were preincubated for 4 h under conditions promoting efficient phagocytosis (suspension [susp.] in FM) or under conditions inhibiting it (adherent [adh.] cells in CM). The cells were then recovered, resuspended in FM, incubated on glass coverslips, and observed by phase-contrast microscopy and by IRM. The areas of approximately 100 individual cells in tight contact with the coverslip were measured. This experiment was repeated two times with very similar results. These results reveal that cellular adhesion is stimulated under conditions promoting efficient phagocytosis.

Changes in cellular adhesion are correlated to changes in sibC mRNA levels. Variations in cellular adhesion might be caused by variations in the levels of adhesion molecules expressed at the cell surface. Based notably on their resemblance to integrin β chains, Sib proteins appear as likely cell surface adhesion molecules involved, notably in adhesion of Dictyostelium cells to their substrate and to phagocytic particles (12, 14).

In order to assess the levels of sib mRNAs, we extracted cellular RNAs from cells preincubated under conditions promoting optimal cellular adhesion (cells in suspension in FM) or under those inhibiting it (adherent cells in CM), and we determined by quantitative reverse transcription (RT)-PCR the number of sib mRNAs. The relative abundance of individual transcripts can be estimated using the number of amplification cycles necessary to obtain half-maximal amplification (CT). These estimated transcript quantities cannot be compared rigorously, since they can depend on the primers used for amplification, but they allow a rough evaluation of the relative abundance of various transcripts, information otherwise lost during the normalization process. In this instance, this comparison was facilitated by the fact that control genes were amplified with very similar efficacies under all conditions used (data not shown). In cells incubated in FM, amplification of sibA and sibC was very efficient (approximate CT, 20), while it was very inefficient for sibB and sibE (approximate CT, 30), suggesting that only sibA and sibC were expressed abundantly in vegetative cells (Fig. 4). This was further suggested by analysis of gene expression during multicellular development of starved cells; levels of sibA and sibC mRNAs decreased in developing cells, while expression of sibB and sibE increased (data not shown). No significant amplification of sibD was seen under any condition (data not shown). Since both SibA and SibC are expressed in vegetative cells, SibC could, in principle, function as an alternative adhesion molecule, accounting for example for the residual cellular adhesion of sibA knockout cells.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 4. sibC transcription is affected by culture conditions. Ten million cells were incubated for 4 h, either under conditions stimulating cellular adhesion (cells in suspension in FM, labeled +) or under conditions where cellular adhesion was inhibited (adherent cells in CM, labeled –). Cellular RNAs were then extracted and reverse transcribed for real-time PCR experiments. The approximate quantity of transcripts for each gene was deduced from the CT values (1011/2CT). The averages and standard errors of the means for the results of three independent experiments are indicated. No significant variation was observed for control genes under these different conditions (data not shown). sibC is the only gene for which transcription was significantly reduced under conditions inhibiting cell adhesion (Student's t test, P < 0.05). a.u., arbitrary units.

Only minor variations in the levels of expression of sibA, sibB and sibE were detected in cells incubated in CM (Fig. 4). On the contrary, the level of sibC mRNA was dramatically reduced under these conditions (Fig. 4). This observation suggested the possibility that changes in cellular adhesion could be caused by variations in the level of expression of sibC.

Modulation of cellular adhesion in sibA and sibC mutant cells. If SibA and SibC both function as adhesion molecules at the surface of vegetative Dictyostelium cells and only SibC expression varies under our experimental conditions, then genetic inactivation of either sibA or sibC should alter cellular adhesion but in a different manner. In sibA knockout cells, cellular adhesion would rely exclusively on SibC and should thus be more strictly dependent on growth conditions. Conversely, in sibC knockout cells, since the levels of SibA are not altered by culture conditions, cellular adhesion should be less sensitive to culture conditions (see Fig. 7).


Figure 7
View larger version (23K):
[in this window]
[in a new window]

  		FIG. 7. Defective adhesion in sibA and sibC mutant cells. Our experiments suggest that SibA and SibC act as redundant adhesion molecules at the cell surface and that the variable levels of expression of sibC participate in the regulation of cell adhesion. Under conditions favoring adhesion (cells in suspension in FM), sibC (ovals marked C) is highly expressed, while it is down modulated under conditions inhibiting cellular adhesion (adherent cells in CM). Accordingly, sibA (ovals marked A) mutant cells are more sensitive than wild-type (WT) cells to these environmental cues (because their adhesion relies solely on SibC), while sibC mutant cells respond minimally to environmental cues (because sibC expression is abrogated).

To analyze this, we created a sibC knockout strain (see Fig. S1 in the supplemental material) and compared it to wild-type and sibA knockout cells. We tested the ability of each strain to phagocytose beads after culture under conditions favoring optimal adhesion (cells in suspension in FM, labeled +) or nonoptimal adhesion (adherent cells in CM, labeled –). Note that in these experiments, the CM was diluted two times that used in Fig. 2, accounting for the fact that wild-type cells were still capable of relatively efficient phagocytosis under nonoptimal conditions. These conditions were chosen to facilitate accurate measurement of phagocytosis under nonoptimal conditions and to allow meaningful comparisons between wild-type and mutant cells. We observed that under optimal conditions, sibA mutant cells did not present a strong defect relative to wild-type cells (72% ± 7% of wild-type phagocytosis; n = 5) (Fig. 5). Under nonoptimal conditions, phagocytosis was much more affected in sibA mutant cells than in wild-type cells so that sibA cells phagocytosed 10 times less efficiently than wild-type cells (7% ± 2% of wild-type phagocytosis; n = 5) (Fig. 5). On the contrary, under both conditions, sibC mutant cells phagocytosed approximately two times less efficiently than wild-type cells (Fig. 5).

The roles of SibA and SibC in adhesion and phagocytosis were also tested by analyzing changes in phagocytosis in cells switched from nonoptimal conditions to optimal conditions (Fig. 6). For this, cells were seeded in fresh HL5 medium (100,000 cells/ml) and grown overnight in a petri dish. Under these conditions, the cells were adherent and the medium was conditioned (lightly) by the growing cells. At time zero, cells were switched to conditions promoting optimal adhesion (suspension in FM). We then recorded the adhesion efficiency at different times by testing on an aliquot of cells the phagocytosis of beads. Over a period of 2 hours, the phagocytic ability of wild-type cells increased slightly. sibA mutant cells initially showed a dramatic phagocytic defect, but it was gradually lost. On the contrary, the defect seen in sibC mutant cells was remarkably stable with time.

Together, these results indicate that SibA is essential for efficient adhesion under nonoptimal conditions but dispensable under optimal conditions (when SibC is expressed). On the contrary, SibC modulation mostly provides a means to rapidly regulate cellular adhesion. An interpretation of these results is proposed in Fig. 7.


arrow
DISCUSSION
 
In this study, we report that cellular adhesion of Dictyostelium cells is modulated by their growth conditions. Two parameters were shown to modify the ability of cells to adhere to phagocytic particles: cells adhering to a substrate down modulate their adhesion capacities, and a cellular factor(s) secreted in the medium down modulates cellular adhesion. The two effects are additive and can account for huge variations in the adhesion efficiency of cells.

Our results strongly suggest that modulation of cellular adhesion is linked largely to changes in the expression of SibC, as proposed in Fig. 7. Accordingly, at high cellular densities, the concentration of the inhibitory secreted factor(s) increases. This triggers a strong decrease in the expression of sibC in all cells, which presumably accounts for the decrease in cell adhesion and phagocytosis. Indeed, analysis of the phenotypes of sibA and sibC knockout strains strongly suggests that they act as redundant cell surface adhesion molecules and that variations of cellular adhesion in our experimental conditions are due largely to changes in the expression level of SibC. However, our results by no means exclude the possibility that other parameters contribute to variations in cellular adhesion. Indeed, a strict interpretation of the simple working model described in Fig. 7 would predict that sibC mutant cells should be completely nonresponsive to culture conditions, while our experiments show some variation of cellular adhesion in these cells.

The secretion of an adhesion-inhibiting molecule in the medium represents a regulatory mechanism by which individual cells can adjust their physiology as a function of cellular density. Indeed, the concentration of the inhibitory factor in the medium would essentially reflect the concentration of cells. Several similar quorum-sensing mechanisms have previously been identified in Dictyostelium cells, and they coordinate notably the initiation of multicellular development (25). To our knowledge this is the first characterized mechanism allowing a coordinate regulation of cellular adhesion in vegetative Dictyostelium cells. Conceptually, it is reminiscent of AmpA, a secreted molecule with disintegrin and ornatin domains, which negatively regulates cell-cell interactions during Dictyostelium multicellular development but is not expressed in vegetative cells even at high cellular density (2). In order to determine if the inhibitor detected in our study could have been identified previously, we assessed its presence in the supernatants of various mutant cells. We still detected an adhesion-inhibiting activity in medium conditioned by ampA mutant cells (2), countin mutant cells (17), smlA mutant cells (4), cmf mutant cells (25), cf50 mutant cells (5), and apra mutant cells (6; data not shown), suggesting that we have uncovered a new quorum-sensing molecule in Dictyostelium. Unfortunately, we could not purify this factor, and its identity remains to be established.

One could envisage several physiological roles for the regulation of adhesion by amoebae in their natural environment. Firstly, enhancing cellular adhesion in cells that are in suspension would allow them to adhere to a substrate to colonize it. Conversely, cells adhering to a specific substrate might adjust the efficiency of adhesion to achieve efficient motility. The regulation of adhesion by the status of the cells (adherent versus nonadherent) described in this study would achieve precisely these effects. Secondly, when cells reach a high density in their natural habitat, it might be ecologically advantageous for at least some of them to detach from the substrate in an attempt to colonize new niches. This could be achieved by the quorum-sensing mechanism described in this study.

From another viewpoint, variations in the efficacy of cellular adhesion could introduce a high degree of experimental variability. Our observations indeed suggest that the exact conditions under which cells are incubated in the hours preceding the experiments can modify significantly the results obtained. It would be advisable for all experiments assessing cellular adhesion or related events (phagocytosis, motility) to ensure that the conditions under which the cells are grown are kept identical from one experiment to another, as well as from one batch of cells to another. When possible, a preincubation in fresh HL5 medium might also increase experimental reproducibility. It is worth noting that in our hands, a significant decrease in adhesion was observed in cells seeded at low density (100,000 cells/ml) and grown overnight in fresh HL5 medium (Fig. 6). In other words, unless specific precautions are taken, the medium in which cells are growing contains a concentration of secreted cellular factor(s) sufficient to repress cellular adhesion at least partially.


arrow
ACKNOWLEDGMENTS
 
We thank Franz Brückert, François Letourneur, and Thierry Soldati for helpful discussions and for critical reading of the manuscript.

This work was supported by a grant from the Fonds National Suisse de la Recherche Scientifique (to P.C.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Geneva Faculty of Medicine, Cell Physiology and Metabolism Department, Centre Médical Universitaire, 1 Rue Michel Servet, 1211 Geneva 4, Switzerland. Phone: (41) 22 379 5293. Fax: (41) 22 379 5338. E-mail: Pierre.Cosson{at}medecine.unige.ch Back

{triangledown} Published ahead of print on 1 August 2008. Back

{dagger} Supplemental material for this article may be found at http://ec.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Benghezal, M., S. Cornillon, L. Gebbie, L. Alibaud, F. Bruckert, F. Letourneur, and P. Cosson. 2003. Synergistic control of cellular adhesion by transmembrane 9 proteins. Mol. Biol. Cell 14:2890-2899.[Abstract/Free Full Text]
    2. 2
  2. Blumberg, D. D., H. N. Ho, C. L. Petty, T. R. Varney, and S. Gandham. 2002. AmpA, a modular protein containing disintegrin and ornatin domains, has multiple effects on cell adhesion and cell fate specification. J. Muscle Res. Cell Motil. 23:817-828.[CrossRef][Medline]
    3. 3
  3. Bozzaro, S., and E. Ponte. 1995. Cell adhesion in the life cycle of Dictyostelium. Experientia 51:1175-1188.[CrossRef][Medline]
    4. 4
  4. Brock, D. A., G. Buczynski, T. P. Spann, S. A. Wood, J. Cardelli, and R. H. Gomer. 1996. A Dictystelium mutant with defective aggregate size determination. Development 122:2569-2578.[Abstract]
    5. 5
  5. Brock, D. A., K. Ehrenman, R. Ammann, Y. Tang, and R. H. Gomer. 2003. Two components of a secreted cell number-counting factor bind to cells and have opposing effects on cAMP signal transduction in Dictyostelium. J. Biol. Chem. 278:52262-52272.[Abstract/Free Full Text]
    6. 6
  6. Brock, D. A., and R. H. Gomer. 2005. A secreted factor represses cell proliferation in Dictyostelium. Development 132:4553-4562.[Abstract/Free Full Text]
    7. 7
  7. Bruckert, F., E. Decave, D. Garrivier, P. Cosson, Y. Brechet, B. Fourcade, and M. Satre. 2002. Dictyostelium discoideum adhesion and motility under shear flow: experimental and theoretical approaches. J. Muscle Res. Cell Motil. 23:651-658.[CrossRef][Medline]
    8. 8
  8. Cardelli, J. 2001. Phagocytosis and macropinocytosis in Dictyostelium: phosphoinositide-based processes, biochemically distinct. Traffic 2:311-320.[CrossRef][Medline]
    9. 9
  9. Caterina, M. J., J. L. Milne, and P. N. Devreotes. 1994. Mutation of the third intracellular loop of the cAMP receptor, cAR1, of Dictyostelium yields mutants impaired in multiple signaling pathways. J. Biol. Chem. 269:1523-1532.[Abstract/Free Full Text]
    10. 10
  10. Charette, S. J., S. Cornillon, and P. Cosson. 2006. Identification of low frequency knockout mutants in Dictyostelium discoideum created by single or double homologous recombination. J. Biotechnol. 122:1-4.[CrossRef][Medline]
    11. 11
  11. Charette, S. J., and P. Cosson. 2004. Preparation of genomic DNA from Dictyostelium discoideum for PCR analysis. BioTechniques 36:574-575.[Medline]
    12. 12
  12. Cornillon, S., L. Gebbie, M. Benghezal, P. Nair, S. Keller, B. Wehrle-Haller, S. J. Charette, F. Bruckert, F. Letourneur, and P. Cosson. 2006. An adhesion molecule in free-living Dictyostelium amoebae with integrin beta features. EMBO Rep. 7:617-621.[Medline]
    13. 13
  13. Cornillon, S., E. Pech, M. Benghezal, K. Ravanel, E. Gaynor, F. Letourneur, F. Bruckert, and P. Cosson. 2000. Phg1p is a nine-transmembrane protein superfamily member involved in dictyostelium adhesion and phagocytosis. J. Biol. Chem. 275:34287-34292.[Abstract/Free Full Text]
    14. 14
  14. Cosson, P., and T. Soldati. 2008. Eat, kill or die: when amoeba meets bacteria. Curr. Opin. Microbiol. 11:271-276.[CrossRef][Medline]
    15. 15
  15. Fey, P., S. Stephens, M. A. Titus, and R. L. Chisholm. 2002. SadA, a novel adhesion receptor in Dictyostelium. J. Cell Biol. 159:1109-1119.[Abstract/Free Full Text]
    16. 16
  16. Franca-Koh, J., Y. Kamimura, and P. Devreotes. 2006. Navigating signaling networks: chemotaxis in Dictyostelium discoideum. Curr. Opin. Genet. Dev. 16:333-338.[CrossRef][Medline]
    17. 17
  17. Gao, T., K. Ehrenman, L. Tang, M. Leippe, D. A. Brock, and R. H. Gomer. 2002. Cells respond to and bind countin, a component of a multisubunit cell number counting factor. J. Biol. Chem. 277:32596-32605.[Abstract/Free Full Text]
    18. 18
  18. Gebbie, L., M. Benghezal, S. Cornillon, R. Froquet, N. Cherix, M. Malbouyres, Y. Lefkir, C. Grangeasse, S. Fache, J. Dalous, F. Bruckert, F. Letourneur, and P. Cosson. 2004. Phg2, a kinase involved in adhesion and focal site modeling in Dictyostelium. Mol. Biol. Cell 15:3915-3925.[Abstract/Free Full Text]
    19. 19
  19. Hacker, U., R. Albrecht, and M. Maniak. 1997. Fluid-phase uptake by macropinocytosis in Dictyostelium. J. Cell Sci. 110(Pt 2):105-112.[Abstract]
    20. 20
  20. Lim, J., A. Wiedemann, G. Tzircotis, S. J. Monkley, D. R. Critchley, and E. Caron. 2007. An essential role for talin during alpha(M)beta(2)-mediated phagocytosis. Mol. Biol. Cell 18:976-985.[Abstract/Free Full Text]
    21. 21
  21. Niewöhner, J., I. Weber, M. Maniak, A. Muller-Taubenberger, and G. Gerisch. 1997. Talin-null cells of Dictyostelium are strongly defective in adhesion to particle and substrate surfaces and slightly impaired in cytokinesis. J. Cell Biol. 138:349-361.[Abstract/Free Full Text]
    22. 22
  22. Titus, M. A. 1999. A class VII unconventional myosin is required for phagocytosis. Curr. Biol. 9:1297-1303.[CrossRef][Medline]
    23. 23
  23. Vandesompele, J., K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, and F. Speleman. 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:RESEARCH0034.[Medline]
    24. 24
  24. Verschueren, H. 1985. Interference reflection microscopy in cell biology: methodology and applications. J. Cell Sci. 75:279-301.[Abstract]
    25. 25
  25. Yuen, I. S., R. Jain, J. D. Bishop, D. F. Lindsey, W. J. Deery, P. J. Van Haastert, and R. H. Gomer. 1995. A density-sensing factor regulates signal transduction in Dictyostelium. J. Cell Biol. 129:1251-1262.[Abstract/Free Full Text]
    26. 26
  26. Zhang, H., J. S. Berg, Z. Li, Y. Wang, P. Lang, A. D. Sousa, A. Bhaskar, R. E. Cheney, and S. Stromblad. 2004. Myosin-X provides a motor-based link between integrins and the cytoskeleton. Nat. Cell Biol. 6:523-531.[CrossRef][Medline]

Eukaryotic Cell, September 2008, p. 1600-1605, Vol. 7, No. 9
1535-9778/08/$08.00+0     doi:10.1128/EC.00155-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Weijer, C. J. (2009). Collective cell migration in development. J. Cell Sci. 122: 3215-3223 [Abstract] [Full Text]  
  • Engler, A. J., Humbert, P. O., Wehrle-Haller, B., Weaver, V. M. (2009). Multiscale Modeling of Form and Function. Science 324: 208-212 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cornillon, S.
Right arrow Articles by Cosson, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cornillon, S.
Right arrow Articles by Cosson, P.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»