Leishmania Adaptor Protein-1 Subunits Are Required for Normal Lysosome Traffic, Flagellum Biogenesis, Lipid Homeostasis, and Adaptation to Temperatures Encountered in the Mammalian Host

The adaptor protein-1 (AP-1) complex is involved in membranetransport between the Golgi apparatus and endosomes. In theprotozoan parasite Leishmania mexicana mexicana, the AP-1 µ1and ${sigma}$ 1 subunits are not required for growth at 27°C but areessential for infectivity in the mammalian host. In this study,we have investigated the function of these AP-1 subunits inorder to understand the molecular basis for this loss of virulence.The µ1 and ${sigma}$ 1 subunits were localized to late Golgi andendosome membranes of the major parasite stages. Parasite mutantslacking either AP-1 subunit lacked obvious defects in Golgistructure, endocytosis, or exocytic transport. However, thesemutants displayed reduced rates of endosome-to-lysosome transportand accumulated fragmented, sterol-rich lysosomes. Defects inflagellum biogenesis were also evident in nondividing promastigotestages, and this phenotype was exacerbated by inhibitors ofsterol and sphingolipid biosynthesis. Furthermore, both AP-1mutants were hypersensitive to elevated temperature and perturbationsin membrane lipid composition. The pleiotropic requirementsfor AP-1 in membrane trafficking and temperature stress responsesexplain the loss of virulence of these mutants in the mammalianhost.

INTRODUCTION

Top

INTRODUCTION

Members of the genus Leishmania are sand fly-transmitted parasiticprotozoa that can cause localized cutaneous lesions or disseminatingmucocutaneous and lethal visceral disease in humans. There havebeen an estimated 12 million cases of leishmaniasis worldwide,resulting in more than 60,000 deaths (11). There are currentlyno vaccines against leishmaniasis, and current drug therapies(pentavalent antimonials, miltefosine, amphotericin B, and pentamidine)are inadequate because of high toxicity, lack of efficacy, expense,and the emergence of antimonial-resistant parasites (11). Infectionof the mammalian host is initiated by flagellated Leishmaniapromastigotes that develop within the midgut of the female sandfly vector. Infective promastigotes are phagocytosed by macrophagesand differentiate to small aflagellate amastigotes in an acidifiedphagolysosome compartment. Amastigotes are proliferative-stageorganisms and can spread to other macrophages during host celldivision or following host cell lysis, thus perpetuating thediseased state. For many species of Leishmania, promastigotedifferentiation to amastigotes can be induced by exposure tothe elevated temperatures (33°C to 37°C) and low pHencountered in the macrophage phagolysosome (61). Leishmaniaadaptation to elevated temperature and differentiation is clearlyassociated with a robust heat shock response (58). However,there is increasing evidence that other metabolic processesmay also contribute to the thermotolerance of these parasitesand their capacity to adapt to conditions in the mammalian host(10, 34, 46).

A number of recent studies have highlighted the importance ofendosome-lysosome function in parasite differentiation and virulencein macrophages and susceptible strains of mice (5). Leishmaniamutants lacking lysosomal cysteine proteases (59) or ATG4, acomponent of the autophagosome assembly pathway (6), displaydefects in promastigote-amastigote differentiation and attenuatedvirulence in animal models. Similarly, overexpression of a dominantnegative form of VPS4, an ATPase involved in endosomal transport,also prevented normal parasite differentiation (6). Endosometrafficking and lysosome function may be required for autophagicprotein turnover during promastigote-amastigote differentiation(5), as well as the degradation of exogenous macromoleculesand nutrient scavenging in the macrophage phagolysosome (40).

Another group of proteins that play key roles in regulatingendocytic membrane transport in eukaryotic cells are the heterotetramericadaptor protein (AP) complexes. Eukaryotic cells may containup to four AP complexes that each comprises two large subunits( ${alpha}$ , β, ${gamma}$ ), a medium µ-subunit, and a small ${sigma}$ -subunit.AP-1 (comprising β1/ ${gamma}$ 1/µ1/ ${sigma}$ 1 subunits) is expressedin all eukaryotic cells and may have pleiotropic functions (8).In animals, the AP-1 adaptor complex is required for the assemblyof clathrin-coated vesicles on the trans-Golgi network (TGN)(9, 48) and the bidirectional transport of the mannose-6-phosphatereceptor and lysosomal membrane proteins between the TGN andendosomes (14, 36, 41). Specific isoforms of AP-1 may also targetproteins from TGN/endosomes to the basolateral plasma membranesof polarized epithelial cells (16). In Saccharomyces cerevisiae,AP-1 is thought to regulate endosome-to-TGN protein transport.However, trafficking defects are observed only when the functionof either clathrin or other coat proteins is also disrupted(17, 22). In contrast, deletion of the AP-1 µ1 adaptinsubunit in Schizosaccharomyces pombe has pleiotropic effectson protein secretion, vacuole fusion, and cytokinesis (28).In the slime mold Dictyostelium discoideum, AP-1 is requiredfor normal growth and protein targeting to conventional lysosomes(31), while in several other protists, this complex is involvedin targeting proteins to specialized lysosome compartments (42,54). These studies suggest that AP-1 complexes can fulfill avariety of functions in the eukaryotic endocytic pathway andthat in some cases redundancy with other vesicle coat complexescan occur, leading to a wide variety of phenotypes in variousAP-1 knockout organisms.

Recent studies have shown that AP-1 is essential for the growthof the major developmental stages of Trypanosoma brucei (1).RNA interference knockdown of AP-1 subunits leads to pleiotropiceffects in endosomal membrane traffic and cell division, althoughprotein transport to the lysosome is apparently not affected(1, 44). In contrast, genetic deletion of AP-1 µ1 or ${sigma}$ 1subunits in Leishmania mexicana mexicana has little effect onthe growth of promastigote stages in rich medium (19). However,these mutants are highly attenuated in ex vivo macrophage infectionstudies and in vivo mice infections (19). The function of thisAP-1 complex in Leishmania has not yet been defined, and thebasis for the loss of infectivity remains unclear. In this study,we have localized the Leishmania AP-1 complex subunits to theendosome and trans-Golgi apparatus. We show that the LeishmaniaAP-1 mutants have no apparent defect in endocytosis, exocytosis,or Golgi structure. However, they display clear defects in lysosometransport, flagellar biogenesis, and lipid homeostasis. Significantly,these mutants are highly sensitive to elevated temperaturesencountered in the mammalian host and are unable to differentiateto mammal-infective amastigote stages. This study highlightsthe important role endocytic traffic plays in regulating Leishmanialipid homeostasis, thermotolerance, and infectivity in the mammalianhost.

MATERIALS AND METHODS

Top

MATERIALS AND METHODS

Cell culture and growth curves. L. m. mexicana wild-type (MNYC/BZ/62/M379), ${Delta}$ µ1, and ${Delta}$ ${sigma}$ 1promastigotes were cultivated at 27°C in RPMI-1640 containing10% fetal bovine serum (iFBS). Axenic amastigotes were obtainedby suspending stationary-phase promastigotes (1 x 10⁶ to 2 x10⁶ cells/ml) in RPMI-1640 supplemented with 20% iFBS, pH 5.5,and incubating them at 33 to 34°C (3). Cellular growth wasmeasured by the protein bicinchoninic acid assay (Pierce). Partialinhibition of sphingolipid or sterol biosynthesis was achievedby the addition of 1 µg/ml myriocin (Sigma) or 2 µg/mlketoconazole (Sigma), respectively (45, 55).

Cloning and episomal gene expression. For episomal complementation of L. m. mexicana ${Delta}$ µ1 and ${Delta}$ ${sigma}$ 1 promastigotes, L. m. mexicana genes encoding µ1 and ${sigma}$ 1 were cloned into the pX vector, which had been modified withthree copies of the influenza hemagglutinin peptide epitope(HA) within the multiple cloning site (39). Amplification ofthe µ1 and ${sigma}$ 1 genes from genomic DNA was performed withprimers 1 (GTACCCGGGATGGCGTCGGTGCTGTACATC) and 2 (GTACGGATCCGTCCGTTCGTATCTCGTATAC)for µ1 and 3 (GTACCCCGGGATGATTCAGTTCCTGCTGCTG) and 4 (GTACGGATCCTACACCCTTGATGGCGTTG)for ${sigma}$ 1; these primers contained unique BamHI and SmaI restrictionsites (underlined) to allow in-frame placement of the genesupstream of the triple HA epitope. The gene encoding the L.donovani myo-inositol transporter(MIT) was amplified from L.donovani genomic DNA by use of primers 5 (GACTGGATCCATGCGAGCATCTGTCATGCTATGTG)and 6 (ATCCTTGGGCTCGTGCGGAGCTGCTTTG) and cloned into pXG'-GFPto generate a C-terminal green fluorescent protein (GFP) fusionprotein. The T. brucei GRIP domain GFP fusion protein was createdpreviously by our laboratory (25, 35). All constructs were sequencedand then transfected into ${Delta}$ µ1, ${Delta}$ ${sigma}$ 1, or wild-type L. m. mexicanapromastigotes by electroporation (47). Parasites were culturedin drug-free media for 24 h, and positive transfectants weresubsequently selected by the addition of 10 µg/ml of G418sulfate. Following adaptation, parasites were maintained inmedium containing 100 µg/ml of G418 sulfate.

FM4-64 and BODIPY-C₅-ceramide staining. Endocytic compartments were labeled with the vital dye FM4-64as previously described (39). Briefly, FM4-64 (final concentrationof 10 µM) was mixed with parasites growing in normal culturemedia, and cells were examined by fluorescence microscopy atpredesignated time intervals, typically 5 to 10 min for labelingof endosomal compartments and 30 min for labeling of the multivesiculartubule (MVT) lysosome. The promastigote MVT lysosome was alsodelineated with BODIPY-C₅-ceramide [N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)sphingosine;Molecular Probes Inc.] as previously described (25).

Microscopy. For immunofluorescence microscopy, L. m. mexicana promastigoteswere fixed in phosphate-buffered saline (PBS) containing 4%paraformaldehyde (0°C, 15 min) and then immobilized on poly-L-lysine-coatedcoverslips. The coverslips were immersed in methanol (0°C,5 min), washed three times with PBS, immersed in 50 mM ammoniumchloride (0°C, 10 min), and then incubated in PBS containing1% bovine serum albumin (BSA) (25°C, 30 min). Coverslipscontaining fixed parasites were probed with the following primaryantibodies: anti- ${alpha}$ -tubulin (1:500 dilution, clone DM1A; Sigma),L3.8 anti-gp63 (1:100 dilution; kindly provided by Thomas Ilg),monoclonal anti-HA (1:80 dilution; Roche), polyclonal anti-SMP-1(1:400 dilution [55]), and L8C4 anti-paraflagellar rod protein(1:4 dilution; kindly provided by Keith Gull). Antibodies tothe Leishmania GRIP protein were generated by immunizing NewZealand White rabbits with a glutathione-S-transferase proteinfused to the C-terminal 173 residues of the L. major GRIP protein(100 µg). Polyclonal antibodies from immunized rabbitsreacted with a specific 120-kDa protein (data not shown) andwere used at a dilution of 1:500. Sections were subsequentlyincubated with Alexa Fluor 594 or 488 goat anti-rabbit, anti-mouse,or anti-rat secondary antibodies. All antibodies were dilutedwith 1% BSA in PBS. The coverslips were mounted in Mowiol 4-88(Calbiochem) containing Hoechst dye and cells viewed with aZeiss Axioplan2 microscope equipped with an AxioCam Mrm digitalcamera. Transmission electron microscopy was carried out asdescribed previously (39).

Triton X-100 extractions and immunoblotting. L. m. mexicana promastigotes (2 x 10⁷) were harvested by centrifugation(2,000 x g, 10 min), washed with ice-cold PBS, and resuspendedin 200 µl Triton X-100 lysis buffer (1% Triton X-100,25 mM HEPES, pH 7.4, 1 mM EDTA, and complete protease inhibitorcocktail [Roche]) at 0°C or 25°C for 30 min. The extractwas centrifuged (14,000 x g, 20 min, 4°C) and the pelletwashed with ice-cold PBS. The protein in the supernatant wasprecipitated by the addition of 9 volumes of acetone (–20°C,16 h). Precipitated protein pellets, or cells that had beenharvested and washed thoroughly in PBS, were solubilized in1% sodium dodecyl sulfate (100°C, 3 min) and protein levelsdetermined using the bicinchoninic acid assay with BSA as thestandard (Pierce). Protein (40 µg) was separated by 10%or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresisand transferred to nitrocellulose membranes. Nitrocellulosemembranes were blocked with 5% powdered skim milk in Tris-bufferedsaline containing 0.05% Tween 20 (TTBS). The blots were probedwith the following antibodies: anti-GFP (1:1,500 dilution; Roche),L3.8 anti-gp63 (1:10,000 dilution; kindly provided by T. Ilg),monoclonal anti-AP3 (1:5,000 dilution), and monoclonal anti-LT15(6:1,000 dilution). AP3 and LT15 bind to epitopes in L. m. mexicanasecreted acid phosphatase and proteophosphoglycan, respectively(24), and were kindly provided by Thomas Ilg. All antibodieswere diluted in 5% powdered skim milk-TTBS. Bound antibody wasdetected using enhanced chemiluminescence (Amersham) and exposureto X-ray film (Biomax MR; Kodak).

Lysosome transport assay. A new assay was developed for measuring endosome-to-lysosometransport. We have recently shown that several polytopic membraneproteins are targeted to the lysosomes of trypanosomatid parasitesfor degradation and that GFP-tagged versions of these proteinscan be used as markers for the mature lysosome in live parasites(33). A GFP-tagged version of the L. donovani MIT (MIT-GFP)is constitutively transported to the MVT lysosome of L. m. mexicanapromastigotes when these parasites are cultivated in inositol-repletemedium, providing a stable marker for this organelle (reference29 and unpublished data). L. m. mexicana wild-type and µ1and ${sigma}$ 1 mutant promastigotes were transfected with pX-NEO plasmidencoding MIT-GFP and parasites were cultivated in RPMI mediumcontaining myo-inositol and iFCS. Transfected parasites wereincubated with FM4-64 as described above and harvested at indicatedtime points for fluorescence microscopy. Lysosomal transportwas assessed by quantitating the number of live parasites thatcontained detectable overlap in FM4-64 and GFP fluorescence(as depicted by yellow staining). Images of 70 to 100 cellswere examined at each time point for quantitation.

LME assay. Promastigotes were incubated in RPMI medium, 10% iFCS containingL-leucine methyl ester (LME) (10 to 60 mM) at 27°C for 2h (23). Viability was measured by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-dephenyltetrazoliumbromide] assay (37). Briefly, cells containing LME were incubatedin triplicate with 900 µg/ml of MTT for 2 h at 27°C.The reaction was stopped and formazan crystals were solubilizedby adding 0.04 M hydrochloric acid in isopropanol for 30 minat 25°C. The absorbance was then measured at 592 nm.

RESULTS

Top

RESULTS

Leishmania AP-1 µ1 and ${sigma}$ 1 subunits localize to the Golgi and endosomes. We have previously shown that the L. m. mexicana AP-1 µ1and ${sigma}$ 1 subunits are not required for growth at 27°C but areessential for virulence in the mammalian host. In order to definewhich processes mediated by AP-1 are essential for virulence,we investigated the function of these subunits in more detail.Their subcellular localization was investigated by expressingHA-tagged versions of the µ1 and ${sigma}$ 1 subunits in L. m. mexicana ${Delta}$ µ1 and ${Delta}$ ${sigma}$ 1 promastigotes, respectively. Epitope taggingwas necessary, as antibodies raised against the L. m. mexicanaAP-1 proteins failed to detect native proteins in immunofluorescencestudies, although both proteins were detected in immunoblottingexperiments and shown to be constitutively expressed in alllife cycle stages (19). The epitope-tagged µ1-HA₃ and ${sigma}$ 1-HA₃ were functional, as the complemented mutant parasiteswere capable of differentiating to amastigotes when incubatedat 33°C, a temperature that kills the mutant strains (seebelow). The epitope-tagged proteins were localized to a clusterof punctate structures near the anterior ends of both promastigoteand in vitro-differentiated amastigote stages (Fig. 1A). Thesestructures were invariably juxtaposed to the kinetoplast (mitochondrialDNA) and the flagellar pocket, the sole site of exo- and endocytosisin these parasites, consistent with an endosomal and/or Golgiapparatus localization (35, 39). We have previously shown thatectopically expressed proteins containing a C-terminal GRIPdomain are targeted to the trans-Golgi cisternae of Leishmania(35). Antibodies to the endogenous Leishmania GRIP protein weregenerated and Leishmania promastigotes expressing the HA-taggedAP-1 subunits fixed and labeled with anti-HA and anti-GRIP antibodiesprior to immunofluorescence microscopy. As shown in Fig. 1B,the two AP-1 subunits colocalized with the endogenous trans-Golgimarker, as well as a more heterogeneous population of vesicles(Fig. 1A and B) that are indistinguishable from early endosomes(35, 39). When expression of µ1-HA₃ and ${sigma}$ 1-HA₃ was increasedwith higher drug selection, a strong cytoplasmic staining wasdetected, indicating that membrane recruitment is saturable(data not shown). These results suggest that the AP-1 ${sigma}$ 1 andµ1 subunits associate with both the anterior endosomesand late Golgi membranes, analogous to the situation found forother eukaryotes (9).

View larger version (86K):
[in this window]
[in a new window]

FIG. 1. Localization of AP-1 subunits to the Golgi and endosomal membranes. (A) L. m. mexicana ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1 parasites expressing HA-tagged ${sigma}$ 1 or µ1 proteins were fixed and analyzed with anti-HA antibodies in log-phase or stationary-phase promastigote or axenic amastigote growth. The distribution of anti-HA antibody (green fluorescence), nucleus and kinetoplast (mitochondrial DNA) distribution (blue fluorescence), and differential interference contrast (DIC) images are shown in the left, middle, and right, respectively. Representative images of the entire cell population are shown. (B) L. m. mexicana ${Delta}$ ${sigma}$ 1 or ${Delta}$ µ1 promastigotes expressing HA-tagged ${sigma}$ 1 or µ1 proteins were fixed and stained with anti-HA (green) and antibodies directed to the endogenous TGN GRIP protein (red). The merged image shows the partial overlap of HA and GRIP staining (yellow).

Loss of µ1 or ${sigma}$ 1 results in an altered MVT lysosome morphology. To investigate whether loss of the AP-1 µ1 and ${sigma}$ 1 subunitsresulted in altered endocytic and lysosome transport, wild-typeand mutant parasites were incubated with the endocytic tracerFM4-64. FM4-64 rapidly labels the anteriorly localized endosomes,prior to being transported to the distinctive MVT lysosome,which extends from near the flagellar pocket to the posteriorend of wild-type promastigotes (Fig. 2A) (18, 39, 56). In ${Delta}$ µ1or ${Delta}$ ${sigma}$ 1 promastigotes, FM4-64 was internalized into early endosomalcompartments following a 10-min incubation, indicating thatthe µ1 and ${sigma}$ 1 subunits are not required for endocytosis.However, subsequent transport of FM4-64 from anterior endosomesto the extended MVT lysosome was not observed for the mutantpromastigotes, even when the time of FM4-64 labeling was extendedup to 4 h. Instead, FM4-64 accumulated in a series of vacuolesat the anterior ends of these parasites, between the nucleusand the flagellar pocket (Fig. 2A). As these vacuoles appearto be the terminal compartment labeled by FM4-64, they may reflectthe fragmentation of the MVT lysosome.

View larger version (56K):
[in this window]
[in a new window]

FIG. 2. Loss of AP-1 subunits induces fragmentation of tubular lysosomes. (A) L. m. mexicana wild-type (WT), ${Delta}$ ${sigma}$ 1, or ${Delta}$ µ1 promastigotes were incubated with the endocytic marker FM4-64 for the indicated times and the distribution of dye was determined by fluorescence microscopy. Representative images of the entire cell population are shown. (B) Wild-type and AP-1 mutant parasites were incubated with the vital dye BODIPY-C₅-ceramide, and the distribution of dye was monitored by fluorescence and DIC microscopy. Representative images of the entire cell population are shown.

BODIPY-C₅-ceramide is another vital stain for the MVT lysosome(25). Unlike FM4-64, this fluorescent lipid marker selectivelylabels the MVT lysosome and not the early endosomes of wild-typeparasites (Fig. 2B) (39). BODIPY-C₅-ceramide accumulated inthe unusual anterior vacuoles of the AP-1 mutant parasites (Fig.2B), providing a second line of evidence that these vacuolescorrespond to a fragmented MVT lysosome.

To further investigate the nature of the anterior vacuoles thataccumulate in the AP-1 mutants, wild-type and mutant promastigoteswere fixed and analyzed by transmission electron microscopy.Analysis of serial sections of >20 cells of each cell linerevealed no change in the ultrastructure of the flagellar pocket,the single Golgi apparatus, the acidocalcisomes, or the tubularendosomes of the AP-1 mutants (Fig. 3; also see Fig. S1 in thesupplemental material). The subcellular localization of theGFP-GRIP chimera, which is selectively targeted to the Golgi,was also unaltered in the ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1 mutants (see Fig. S1Bin the supplemental material). However, both mutants containeda population of large (>50-nm) multivesicular bodies (MVBs)at the anterior ends of the cells that were absent from wild-typepromastigotes (Fig. 3). Each of the MVBs contained a limitingmembrane and a heterogeneous population of internal membranevesicles (Fig. 3B and C), reminiscent of the structure of theMVT lysosome (39). Quantitative analysis of serial sectionsrevealed that L. m. mexicana ${Delta}$ µ1 promastigotes contained8.15 ± 3.26 large MVBs per cell, while none were detectedin wild-type promastigotes. The MVB structures were largelyrestricted to the anterior end of mutant promastigotes and arelikely to correspond to the structures labeled in live parasiteswith FM4-64 and BODIPY-C₅-ceramide. Collectively, these resultssuggest that the deletion of the AP-1 adaptor subunits resultsin the fragmentation of the MVT lysosome but has little effecton the organization of the Golgi and early endosome membranes.

View larger version (60K):
[in this window]
[in a new window]

FIG. 3. Ultrastructures of L. m. mexicana ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1 promastigotes. Wild-type (A), ${Delta}$ µ1 (B), and ${Delta}$ ${sigma}$ 1 (C) promastigotes were harvested in log-phase growth, fixed, and analyzed by transmission electron microscopy. fp, flagellar pocket; k, kinetoplast; g, Golgi; *, acidocalcisome; arrowheads, large MVBs.

Endosome-to-lysosome transport is decreased in ${Delta}$ µ1 and ${Delta}$ ${sigma}$ 1 parasites. To investigate whether the altered lysosome morphology in theAP-1 mutants reflected changes in endosome-to-lysosome membranetransport, we developed an in vivo assay to measure this step.Wild-type and AP-1 mutant strains were transfected with a plasmidencoding a polytopic membrane protein MIT-GFP. This proteinis localized to the cell surface but is also constitutivelytransported to the MVT lysosome under myo-inositol-replete conditions,providing a stable marker for this compartment (Fig. 4A). Inthe AP-1 mutant strains, this construct is targeted to anteriorvacuoles that are indistinguishable from those labeled withBODIPY-C₅-ceramide and FM4-64 (Fig. 4B to D). MIT-GFP-expressingwild-type and mutant parasites were pulse-labeled with FM4-64,and the colocalization of GFP and FM4-64 fluorescence (yellowstaining) was used as a measure of endosome-to-lysosome transport.As expected, FM4-64 was transported to the GFP-positive MVTlysosome within 30 min in wild-type promastigotes (Fig. 4A).In contrast, FM4-64 transport to the GFP-positive vacuoles ofthe AP-1 mutant parasites was detected only after 1 to 2 h (Fig.4B to D). Quantitative analyses indicated that membrane transportfrom the endosomes to the fragmented lysosomal vacuoles of AP-1mutants is approximately fourfold slower than endosome-to-MVTlysosome transport in wild-type parasites (Fig. 4E).

View larger version (46K):
[in this window]
[in a new window]

FIG. 4. Endosome-to-lysosome trafficking is perturbed in ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1 cells. (A) Wild-type (WT) L. m. mexicana cells expressing MIT-GFP were incubated with FM4-64 for 30 min and examined by fluorescence microscopy. MIT-GFP is both expressed at the cell surface and internalized into the MVT lysosome when the medium contains myo-inositol. (B to D) ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1 promastigotes expressing MIT-GFP were incubated for 30 (B) or 120 (C) minutes with FM4-64, and the localizations of GFP (green signal) and FM4-64 (red signal) were determined by fluorescence microscopy. The boxed regions shown in panels B and C are magnified and shown in panel D. Representative images of the entire cell population are shown throughout. (E) L. m. mexicana wild-type, ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 promastigotes expressing MIT-GFP were analyzed for overlap of lysosomal GFP fluorescence and FM4-64 fluorescence at the indicated time intervals. Eighty to 100 cells were examined for each time point and the percentage of cells showing overlap in GFP/FM4-64 fluorescence was measured. The standard deviation was calculated from three separate samples (error bars). (F) L. m. mexicana wild-type, ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 promastigotes were incubated with LME for 2 h and cellular viability was measured against control (nontreated) cells by use of the MTT assay. Error bars represent the standard deviations for three samples.

Lysosomal transport can also be assessed indirectly by measuringsensitivity to the lysomotropic amino acid ester LME (23). LMEuptake results in lysosome swelling and disruption, leadingto cell death. Wild-type parasites were found to be markedlymore sensitive to LME than were either of the AP-1 mutants (Fig.4F), supporting the conclusion that lysosomal transport is reducedin the mutant cell lines.

In contrast, we could find no significant defect in the localization,targeting, or secretion of soluble proteins, glycosylphosphatidylinositol(GPI)-anchored proteins, or transmembrane proteins in the ${Delta}$ µ1and ${Delta}$ ${sigma}$ 1 parasites (data not shown), suggesting that AP-1 doesnot play a significant role in the surface transport or secretionof soluble or membrane-bound proteins in Leishmania parasites.

Sterols accumulate in the fragmented lysosomes of the L. m. mexicana AP-1 mutants. Defects in lysosomal transport are known to lead to changesin sterol trafficking and homeostasis in other eukaryotes (32).To determine if the loss of the AP-1 subunits affects the distributionof sterols in Leishmania, wild-type and mutant promastigoteswere labeled with a highly fluorescent polyene macrolide, filipin.Filipin specifically intercalates into sterol-rich membranesand can be used to visualize these membranes in live and fixedcells (27). Similar patterns of filipin staining were observedfor log-phase wild-type and AP-1 mutant promastigotes. Specifically,filipin staining was almost entirely restricted to the plasmamembrane surrounding the cell body, the flagellum, and the flagellumpocket (Fig. 5, top). In contrast, marked differences were observedin the filipin staining patterns of wild-type and AP-1 mutantstationary-phase promastigotes. While filipin staining of stationary-phasewild-type promastigotes was essentially the same as that seenfor the log phase, a distinct population of intracellular membraneswere strongly labeled in the stationary-phase AP-1 mutant promastigotes(Fig. 5). These intracellular membranes were largely concentratedat the anterior end of the parasites and were indistinguishablefrom the fragmented lysosomes of these parasites. Total levelsof ergosterol, as determined by gas chromatography-mass spectrometry,were unchanged for both wild-type and mutant parasites (datanot shown). These results show that ergosterol preferentiallyaccumulates in the fragmented lysosomes of the AP-1 mutantsin stationary-phase growth.

View larger version (53K):
[in this window]
[in a new window]

FIG. 5. L. m. mexicana AP-1 mutants accumulate sterols in intracellular compartments. L. m. mexicana wild-type, ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 parasites were harvested in log - and stationary-phase (stat) culture, and fixed cells were stained with filipin. Labeled parasites were viewed by fluorescence microscopy. (Bottom) Detail of anterior region of stationary-phase promastigotes. Images represent the entire cell population.

Promastigote ${Delta}$ µ1 and ${Delta}$ ${sigma}$ 1 parasites have defects in flagellum biogenesis. In the course of our analysis of the L. m. mexicana AP-1 mutants,we noted that the flagella of ${Delta}$ ${sigma}$ 1 promastigotes shortened dramaticallywhen this mutant entered the stationary growth phase (Fig. 6A to C).The L. m. mexicana ${Delta}$ µ1 mutant promastigotes also exhibitedshorter flagella in stationary phase, although to an extentlesser than that seen for the ${Delta}$ ${sigma}$ 1 mutant (Fig. 6A). The shortflagella of ${Delta}$ ${sigma}$ 1 stationary-phase promastigotes retained the normalaxoneme with nine plus two microtubule doublets (Fig. 6B) butlacked the paraflagellar rod proteins that are present onlyin emergent portions of the flagella in wild-type parasites(Fig. 6D).

View larger version (50K):
[in this window]
[in a new window]

FIG. 6. The L. m.mexicana ${Delta}$ ${sigma}$ 1 mutant displays a distinct flagellum morphology in stationary-phase growth. (A) Wild-type(WT), ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 parasites were harvested while in early log growth (day 2), early stationary growth (day 5), and late stationary growth (day 8), and cell morpholog ies were examined by DIC microscopy. Images shown are representative of the entire cell population. (B) ${Delta}$ ${sigma}$ 1 promastigotes were harvested in stationary phase and fixed cells were examined by transmission electron microscopy. Serial sectioning of the same cell (approximately 180 nm of separation between top and bottom images) demonstrated that the flagellum extended to just beyond the mouth of the flagellum pocket and retained a highly truncated microtubule axoneme. The flagellar pocket is surrounded by a number of MVB s and translucent vesicles. (C) Wild-type, ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 promastigotes were examined for the presence or absence of a flagellum in different growth phases. At least 100 cells were examined for each time point. The results are representative of six independent experiments. (D) Wild-type, ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 promastigotes were harvested in log or stationary growth phase, and fixed parasites were labeled with antibody directed to the paraflagellar rod protein. Fluorescence and corresponding DIC images are shown.

We have recently shown that partial inhibitions of either ergosterol(the major sterol of these parasites) or sphingolipid biosynthesisin Leishmania promastigotes have similar effects on flagellarmorphology (55). Specifically, treatment of wild-type parasiteswith either ketoconazole (an inhibitor of sterol-14'-demethylase,a late step in ergosterol biosynthesis) or myriocin (an inhibitorof the serine:palmitoyl-coenzyme A transferase, the first stepin de novo sphingolipid biosynthesis) resulted in flagellumretraction in stationary-phase promastigotes (55). A similareffect was observed following the genetic disruption of thegene encoding the serine:palmitoyl-coenzyme A transferase (12,60). To test whether the flagellar phenotype of the AP-1 mutantsreflects alterations in membrane lipid homeostasis, the AP-1mutants were cultivated in the presence of low concentrationsof ketoconazole and myriocin (55). At the concentrations used,neither inhibitor had any effect on flagellum length in wild-typeparasites (Fig. 7). However, both inhibitors induced the completeretraction of the flagellum in log-phase ${Delta}$ ${sigma}$ 1 mutant promastigotes(Fig. 7). Significantly, ketoconazole treatment, but not myriocintreatment, had a similar effect on the flagellar length of ${Delta}$ µ1log-phase promastigotes (Fig. 7). These results indicate thatAP-1 is required for normal flagellum biogenesis, possibly byregulating lipid homeostasis in the flagellum membrane.

View larger version (91K):
[in this window]
[in a new window]

FIG. 7. Inhibitors of sterol and sphingolipid biosynthesis enhance the flagellum-shortening phenotype.Wild-type(WT), ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 promastigotes were grown in the absence or presence of low concentrations of myriocin (myr) (1 µg/ml) or ketoconazole (keto) (2 µg/ml) at 27°C for 3 days, and cell morphology was monitored by DIC microscopy. Images represent the entire cell population.

Leishmania AP-1 subunit mutants are highly sensitive to elevated temperature and sterol biosynthetic inhibitors. To further understand why the AP-1 mutant parasite lines areavirulent, we investigated the capacities of these mutants togrow at the elevated temperatures (27°C to 33°C) and/orlow-pH conditions encountered in the mammalian host, which togetherstimulate the process of differentiation from promastigotesinto amastigotes both in vivo and in vitro. Both strains exhibitedgrowth rates essentially identical to those of wild-type parasiteswhen subjected to neutral or low pH at 27°C but displayedgreatly reduced growth and increased cell death when grown at33°C, regardless of the pH (Fig. 8A). Interestingly, theL. m. mexicana ${Delta}$ µ1 promastigotes were consistently observedto be more sensitive to heat shock than were the L. m. mexicana ${Delta}$ ${sigma}$ 1 promastigotes (Fig. 8A). Elevated temperature and reducedpH induced the wild-type and AP-1 mutant promastigotes to roundup and form amastigote-like forms (Fig. 8B). While the wild-typeparasites clearly remained viable and continued to grow underthese conditions, the AP-1 mutant parasites became more granularand vacuolated and lost membrane integrity after 3 days (Fig.8B). The AP-1 mutants were also more sensitive than wild-typeparasites to a range of other stresses, including low concentrationsof ketoconazole (2 µg/ml) (Fig. 9A), elevated levels ofchloride ions (Fig. 9B), and starvation (Fig. 9C). The increasedsensitivities of the AP-1 mutants to environmental stresses,particularly elevated temperature, are likely to account forthe loss of the virulence phenotype of these mutants in susceptibleanimal models.

View larger version (50K):
[in this window]
[in a new window]

FIG. 8. L. m. mexicana AP-1 mutant promastigotes are sensitive to elevated temperature. (A) L. m. mexicana wild-type (WT), ${Delta}$ µ1, and ${Delta}$ ${sigma}$ 1 stationary-phase promastigotes were cultivated in RPMI medium, 20% iFBS that was adjusted to either pH 5.5 or pH 7.5, and the promastigotes were incubated at either 27°C or 33°C as indicated. Parasite growth was monitored by measuring increases in cellular protein levels. The results were verified on more than three separate occasions. (B) Differentiation of L. m. mexicana wild-type and AP-1 mutant parasites. Stationary-phase promastigotes were suspended in low-pH medium and incubated at 33°C, and differentiation to amastigotes was monitored by DIC microscopy.

View larger version (18K):
[in this window]
[in a new window]

FIG. 9. L. m. mexicana AP-1 mutant promastigotes are sensitive to agents that perturb membrane function and nutrient starvation. (A) Wild-type (WT), ${Delta}$ ${sigma}$ 1, and ${Delta}$ µ1 promastigotes were grown in the absence (open symbols) or presence (closed symbols) of ketoconazole (2 µg/ml) at 27°C, and cell growth was monitored. (B) Wild-type and AP-1 mutant promastigotes were cultivated in RPMI medium containing elevated chloride levels. Growth (measured as cell protein) is shown relative to that for promastigotes grown in the absence of added chloride ions. Triplicate samples were used to calculate the standard deviation (error bars). (C) Wild-type and AP-1 mutant promastigotes were suspended in PBS, pH 7.5, for 48 h at 27°C. Parasites were harvested by centrifugation and resuspended in full RPMI medium, 10% FCS, and recovery was monitored by following the increase in cell protein.

DISCUSSION

Top

DISCUSSION

Leishmania parasites are predicted to express three AP complexes,AP-1, AP-2, and AP-3 (13). Recent studies have shown that theAP-3 complex is required for the transport of some polytopicmembrane proteins to acidocalcisomes, specialized lysosome-likevacuoles rich in calcium and (poly)phosphates (7). In this study,we provide evidence that the AP-1 complex plays a role in lysosomebiogenesis and trafficking, intracellular sterol homeostasis,and flagellum biogenesis. The AP-1 subunit-deficient mutantsare also hypersensitive to a range of environmental stressesand membrane-perturbing agents. This study highlights the pleiotropicfunctions of AP-1 subunits in Leishmania membrane transportand provides an explanation for why the AP-1 mutants exhibita severe loss-of-virulence phenotype in the mammalian host.

Functionally active, epitope-tagged AP-1 µ1 and ${sigma}$ 1 subunitswere localized to endosome and the trans-Golgi membranes. Theseresults suggest that, as in other eukaryotes (17, 22, 31), theleishmanial AP-1 complex is involved in regulating membranetraffic between these compartments, most likely by recruitingprotein cargo and/or clathrin coats to either Golgi or endosomalmembranes (13, 56). However, loss of the AP-1 µ1 and ${sigma}$ 1subunits had no discernible effect on of the uptake of FM4-64or the exocytosis of a range of surface and secreted glycolipidsand proteins. The ultrastructure of the Golgi apparatus andthe localization of a trans-Golgi marker were also unchangedin the AP-1 mutants. These results suggest that the AP-1 complexis not required for endocytosis or post-Golgi exocytic pathwaysinvolving either Golgi-plasma membrane or Golgi-endosome-plasmamembrane itineraries (20). In contrast, transport from the endosomesto the lysosome appeared to be partially disrupted in both AP-1subunit mutants. Specifically, both mutants lacked the distinctivetubular lysosome of wild-type promastigotes and accumulateda population of MVBs that have the characteristics of fragmentedlysosomes. Transport of both membrane (FM4-64) and soluble (LME)markers from the endosome compartment to the MVBs/fragmentedlysosomes was reduced by nearly fourfold. However, proteinssuch as MIT-GFP and DPMS-GFP (39) that are delivered to theseMVBs were proteolytically degraded (data not shown), indicatingthat endogenous proteases are still trafficked to this compartmentdespite the slower transport kinetics. These results suggestthat endosome-lysosome transport dynamics are altered in theAP-1 mutant, possibly as a result of changes in the recyclingkinetics of one or more proteins in the endosomes and/or TGN.However, the proteolytic capacities of the fragmented vacuolesdo not appear to be altered, suggesting that the stress responsephenotypes of the AP-1 mutant are not due to gross changes inproteolytic lysosomal degradation.

Interestingly, genetic deletion or knockdown of AP-1 subunitsin other single-celled eukaryotes often leads to defects inlysosome trafficking. For example, a Schizosaccharomyces pombemutant lacking the AP-1 µ1 subunit has multiple defectsin membrane trafficking and accumulates fragmented vacuoles(28). Loss of the AP-1 µ1 subunit in Dictyostelium discoideumand Toxoplasma gondii also results in the accumulation of cytoplasmicvesicles and defective transport of a range of lysosomal hydrolases(31, 42). In contrast, knockdown of the AP-1 ${gamma}$ -subunit in therelated trypanosomatid parasite T. brucei had little effecton lysosomal morphology or transport of the major lysosome membraneprotein p67 (1). However, AP-1 was required for normal growthand architecture of the endosome system (1). All these studiesare consistent with AP-1 having a primary role in regulatingGolgi-endosome membrane dynamics, with potential secondary effectson lysosome structure and transport.

The fragmented lysosomes of the L. m. mexicana AP-1 mutantsappeared to contain high levels of sterols, as shown by filipinstaining. Interestingly, sublethal concentrations of ketoconazoleand myriocin induce similar fragmentation s of the MVT lysosome(J. Heng, D. L. Tull, and M. J. McConville, unpublished data),indicating that alterations in membrane lipids may contributedirectly to the altered morphology of this organelle in theAP-1 mutants. Sterols are required for vacuole transport inS. cerevisiae (21, 27, 30), and alterations in sterol levelsmay cause an imbalance in anterograde/retrograde membrane transportbetween the endosomes and the MVT lysosome, leading to fragmentation.Alternatively, alterations in sterol concentration may resultin the destabilization of the extended tubular structure ofthe MVT lysosome (49). Changes in lipid composition could alsoconceivably lead to a loss of membrane proteins that tetherthe MVT lysosome to a band of two to four microtubules thatextends from the anterior to the posterior end of Leishmaniapromastigotes (39), further contributing to the destabilizationand fragmentation of this organelle.

The presence of high sterol levels in the lysosomes of the L.m. mexicana ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1 mutants is reminiscent of the phenotypeobserved for some mammalian lysosomal storage diseases, suchas Niemann-Pick type C (NPC) (32). NPC disease is associatedwith the accumulation of cholesterol and sphingolipids in lateendosomes due to mutations in two proteins, NPC1 and NPC2, whichare thought to be involved in recycling cholesterol from thelysosome to the plasma membrane (32, 51). Intriguingly, recentstudies suggest that the localization and function of NPC proteinsin yeast and mammalian cells requires the AP-1, GGA, or AP-3complexes (4). Leishmania lacks obvious homologues of the NPCproteins but is likely to have retained some mechanism for sensingand sorting lipids in the endocytic pathway. Disruption of sterolsensing in the AP-1 mutants could thus underlie some of theobserved defects in both lysosomal transport and flagellum biogenesis.

Unexpectedly, deletion of the AP-1 subunits had a profound effecton flagellum length in stationary-phase promastigotes. Thisphenotype was evident in both mutants but was most dramaticin the ${Delta}$ ${sigma}$ 1 null mutant. There is increasing evidence that flagellarmembrane proteins and lipids are transported from the Golgiapparatus to the base of the flagellum prior to incorporationinto the flagellum membrane. In some vertebrate cell types,specialized AP-1 complexes are involved in either the selectionof protein cargo or the movement of these transport vesiclesto the flagellum base (2, 15). The difference in the severitiesof the flagellum phenotypes of the L. m. mexicana ${Delta}$ ${sigma}$ 1 and ${Delta}$ µ1mutants is consistent with the Leishmania AP-1 complex havinga role in targeting flagellum proteins to post-Golgi vesicles,as each of these subunits bind different targeting motifs invesicle cargo (26, 38). Intriguingly, treatment of stationary-phasepromastigotes with ketoconazole or myriocin (55) or geneticdisruption of sphingolipid biosynthesis (12, 60) also inducesflagellum shortening, and the flagellar phenotype of the twoAP-1 mutants was exacerbated when either sterol or sphingolipidbiosynthesis was inhibited. These observations raise the possibilitythat disruption of AP-1-mediated vesicle transport has a directeffect on flagellum membrane lipid composition. Alternatively,changes in sterol levels in the endocytic pathway of AP-1 mutantsmay lead indirectly to changes in the lipid composition of theflagellum membrane. Global changes in endocytic traffickingalso affect flagellum biogenesis in the related trypanosomatid,Trypanosoma brucei. Loss of the ADP ribosylation factor orthologueARF1 in T. brucei bloodstream forms results in the enlargementof the flagellar pocket and the formation of intracellular flagella(43). The latter phenotype may reflect defects in the deliveryof membrane proteins/lipids to the flagellar pocket (50). Targeteddisruption of Leishmania genes encoding mitogen-activated proteinkinases as well as thymidine kinase can also affect the lengthof promastigote flagellum (53, 57). Whether these cytoplasmicproteins directly or indirectly modulate lipid biosynthesisand/or Golgi-flagellum trafficking pathways has not been investigated.

During infection in the mammalian host, Leishmania parasitesmust be able to adapt to elevated temperatures (33°C to37°C), which together with the decrease in pH, stimulatetheir differentiation into the amastigote life stage. The L.m. mexicana AP-1 mutants grow normally when cultured as promastigotesat 27°C but are unable to grow or survive at 33°C. Thethermosensitivity of these mutants provides an explanation fortheir loss of virulence in the murine models (19). However,exposure to other stresses in the animal host may also contributeto the loss of virulence. For example, the growth of both AP-1mutants was profoundly affected by nutrient starvation and agentsthat perturbed membrane function (ketoconazole and chlorideions). AP-1 function may therefore be required, either directlyor indirectly, for Leishmania responses to general environmentalstresses encountered in the mammalian host. Interestingly, lossof AP-1 µ1 expression is also associated with increasedtemperature sensitivity in the fission yeast S. pombe (28).As seen for Leishmania, the S. pombe AP-1 µ1 subunit isnot required for growth at 27°C but is essential for growthat 36°C. Loss of the S. pombe AP-1 µ1 subunit leadsto hypersensitivity to inhibitors of the calcineurin stressresponse pathway, while loss of both AP-1 µ1 and calcineurinis synthetically lethal (28, 52). We have found that the L.m. mexicana AP-1 mutants also display increased sensitivityto inhibitors of the calcineurin pathway when cultivated at27°C (D. L. Tull, J. E. Vince, and M. J. McConville, unpublisheddata), raising the possibility that perturbations induced byloss of AP-1 are sensed by an equivalent stress response pathwayin Leishmania. Whether this pathway is also required for theheat shock responses of Leishmania and infectivity in the mammalianhost remains to be determined.

ACKNOWLEDGMENTS

We thank Keith Gull (University of Oxford) for providing theanti-PRF antibodies.

This work was funded by an Australian National Health and MedicalResearch Council program grant. J.E.V. was supported by an Australianpostgraduate award, M.J.M. is an NHMRC principal research fellow,and G.I.M. is an Australian Research Council Federation fellow.

FOOTNOTES

* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, University of Melbourne, Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Rd, Parkville, Victoria 3010, Australia. Phone: (61) 38344 2343. Fax: (61) 39348 1421. E-mail: malcolmm{at}unimelb.edu.au

Published ahead of print on 30 May 2008.

Supplemental material for this article may be found at http://ec.asm.org/.

Present address: Department of Biochemistry, La Trobe University,Bundoora, Victoria, Australia.

REFERENCES

Top