Previous Article | Next Article ![]()
Eukaryotic Cell, July 2008, p. 1098-1108, Vol. 7, No. 7
1535-9778/08/$08.00+0 doi:10.1128/EC.00109-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Department of Plant Sciences, Tel Aviv University, Tel Aviv 69978, Israel,1 Department of Microbiology and Biotechnology, Tel Aviv University, Tel Aviv 69978, Israel,2 Department of Botany and Plant Pathology, Purdue University, West Lafayette, Indiana 479073
Received 5 April 2007/ Accepted 10 April 2008
|
|
|---|
mutants, and a CgCTR2-cyan fluorescent protein (CFP) fusion protein accumulated in vacuole membranes, confirming the function of the protein as a vacuolar copper transporter. Expression analysis indicated that CgCTR2 transcript is abundant in resting conidia and during germination in rich medium and downregulated during "pathogenic" germination and the early stages of plant infection. CgCTR2 overexpression and silencing mutants were generated and characterized. The Cgctr2 mutants had markedly reduced Cu superoxide dismutase (SOD) activity, suggesting that CgCTR2 is important in providing copper to copper-dependent cytosolic activities. The Cgctr2-silenced mutants had increased sensitivity to H2O2 and reduced germination rates. The mutants were also less virulent to plants, but they did not display any defects in appressorium formation and penetration efficiency. An external copper supply compensated for the hypersensitivity to H2O2 but not for the germination and pathogenicity defects of the mutants. Similarly, overexpression of CgCTR2 enhanced resistance to H2O2 but had no effect on germination or pathogenicity. Our results show that copper is necessary for optimal germination and pathogenicity and that CgCTR2 is involved in regulating cellular copper balance during these processes. |
|
|---|
Spore germination is regulated by different signaling cascades. In most species heterotrimeric G proteins, cyclic AMP (cAMP), and mitogen-activated protein (MAP) kinase cascades are involved in the activation of germination as well as in the regulation of specific developmental stages during germination. In Colletotrichum lagenarium germination is controlled by at least two signaling cascades, a cAMP-dependent pathway and the CMK1 MAP kinase (homolog of M. grisea PMK1) pathway (29). Additional signaling elements might be involved, e.g., primarily calcium-dependent signals and other MAP kinase pathways (11, 13, 27). Germination in the gray mold fungus B. cinerea is regulated by at least three signaling pathways, which include a G
protein BCG3, a cAMP pathway, and the FUS3/PMK1 MAP kinase homolog BMP1 (8). Each of these pathways mediates germination in response to different signals including carbon source, surface hardness and hydrophobicity, or specific nutrients. Spore germination in M. grisea does not require the PMK1 or G
/cAMP pathways; however, these pathways regulate the following formation of appressoria, which are specialized organs that differentiate at the end of germ tubes and are used for plant penetration (31, 33). Moreover, 19 out of 67 genes that were highly expressed in appressoria compared to mycelium also showed high levels in dormant spores (30). Thus, in plant-pathogenic fungi, spore germination and early pathogenic development are tightly linked and are regulated by common signaling pathways.
Colletotrichum gloeosporioides f. sp. aeschynomene is a hemibiotrophic plant pathogen that specifically attacks the weed Aeschynomene virginica. The fungus produces large numbers of asexual spores that, following a contact with plant organs, germinate, form appressoria, and penetrate the plant. We previously showed that C. gloeosporioides can germinate in two distinct ways: "pathogenic" and "saprophytic" (3). Pathogenic germination takes place on plants or on a hydrophobic surface and is characterized by fast mitosis followed by development of a single germ tube. The process is initiated immediately following induction and terminates within 4 h with the formation of appressoria. Saprophytic germination occurs in rich medium; it takes a much longer period of time and is characterized by development of two germ tubes that emerge from opposite sides of the spore. These germ tubes do not form appressoria, and therefore spores that germinate in this way do not infect plants. The two germination styles in C. gloeosporioides are regulated by different signaling cascades; saprophytic germination is enhanced by cAMP while pathogenic germination is cAMP independent, but, similar to M. grisea, cAMP is required later for appressorium formation (3). The association between germination style and the subsequent pathogenic development suggests that genes that are necessary for pathogenic spore germination may also affect fungal pathogenicity.
To identify genes that are associated with pathogenic germination, we generated a C. gloeosporioides promoter-trapping mutant collection by restriction enzyme-mediated transformation (REMI), using the green fluorescent protein (GFP) as a reporter for gene expression. We screened this collection for transformants that had specific GFP expression patterns under saprophytic and pathogenic germination conditions. Here, we report on the characterization of a REMI mutant in which GFP expression was enhanced in spores and suppressed during pathogenic germination. The tagged locus was isolated and found to encode a putative vacuolar copper transporter that has not been previously characterized in filamentous fungi. Functional analysis of this gene revealed that it is involved in resistance to oxidative stress, but it does not affect sensitivity to copper. We also found that this gene is necessary for pathogenic germination as well as for full virulence but not for saprophytic germination. These results suggest that copper is necessary for proper germination and pathogenesis in this fungus.
|
|
|---|
Generation of REMI collection. Plasmid pAS1 (provided by W. Schäfer) was digested with NcoI and SphI and the EGFP (where EGFP is enhanced green fluorescent protein) coding sequence was cloned between NcoI and SphI sites in place of the luciferase gene to produce the plasmid pAS-GFP. C. gloeosporioides was transformed by electroporation of spores (26) with 1 µg of NcoI-linearized pAS-GFP.
Isolation and sequencing of C. gloeosporioides CTR2 (CgCTR2). Genomic regions flanking the inserted pAS-GFP cassette were isolated by inverse PCR (Expand Long Template PCR System; Boehringer) using GFP-specific primers. Additional sequences were isolated by genome walking (Universal Genome Walker Kit; Clontech) using the primers (5' to 3') 159pbcl-for (TGTCGTGATCACTTGAGTCGCGGACC) and 159end-new (GGGGGAGCTCTTTCAATGGCAGGCG). Full-length cDNA sequences were obtained by reverse transcription-PCR ([RT-PCR] Reverse-iT 1st Strand Synthesis Kit; ABgene) with primers 159end-new and 159-start (GAAATTTCCGCGTCATAATGGACCACG) and by rapid amplification of cDNA ends ([RACE] 5'/3' RACE kit; Roche) using primers 5race159-rev (ATTACTTGCGCTTGTTCGGGGGG) and 5race159-nr (AAACTGTTGGCAACAGCTCCCCGCC).
Construction of plasmid vectors. (i) Ksh-CgCTRi: CgCTR2 silencing vector. Fragments from bp 1 to 700 and 1 to 1024 of the CgCTR2 genomic sequence were amplified by PCR using the primer pair Dw-1Bmfor (CCACAGGATCCATGGGCGGCCACGGCGGTA) and Up-716sp (GTCTCAGTACTAGTGCCAGCGATGCC) and the pair Up-1Ncfor (CCACAAGCACCATGGGCGGCCACGG) and Dw-1024sp (CCCAGCACTAGTAAGTCATAAAGATAAGC). The 1,024-bp fragment was cloned into NcoI/SpeI sites of pGEMT (Promega). The 700-bp fragment was cloned into SacI and SpeI sites of the resulting plasmid. The two fragments in opposite orientations were released by digestion with NcoI and BamHI and cloned between the GPDA promoter and TRPC terminator in pKsh52-1 (4).
(ii) Ksh-CgCTR: CgCTR2 overexpression vector. The full-length CgCTR2 genomic clone (1.2 kb; accession number EF434817 [GenBank] ) was amplified by PCR with the primers 159oe-Bsph (GAAATTTCCGCGTCATCATGAACCACG) and 159oe-Bgl (GAATGGGGGAGATCTTTCAATGGCAGGCGTTG) and cloned into BspHI and BglII between the GPDA promoter and TRPC terminator in pKsh52-1.
(iii) p57-fcgCTR: CgCTR2 complementation vector. A 3-kb genomic fragment including the CgCTR2 promoter (1.8 kb) and open reading frame (ORF; 1.2 kb) was amplified by PCR using the primers 159oe-Bgl (see Ksh-CgCTR) and 159pbcl-for (TGTCGTGATCACTTGAGTCGCGGACC). The fragment was cloned into pTZ57R/T (Ferments).
(iv) pGMT10-CgCTR2l/s: CgCTR2 yeast expression vector. The two CgCTR2 transcripts (549-bp fragment, accession number EF468351 [GenBank] ; and 504-bp fragment, accession number EF468352 [GenBank] ) were amplified by RT-PCR using the primers 159Bm-for (CCGGATCCTAATGGACCACGCACAC) and 159Kpn-rev (CGATTGGGTACCTCTTTCAATGGCAGGC). The resulting cDNAs were cloned into BamHI and KpnI sites under the GAL promoter in pGMT-10.
(v) CgCTR2-CFP. CgCTR2 cDNA was amplified with primers 159oe-Bsph I (see Ksh-CgCTR) and CTRfusion-Bsph I (GGGGGTCATGATTGAATGGCAGGC) and cloned into an NcoI site on KshCFP (where CFP is cyan fluorescent protein), in frame with the coding sequence of the CFP gene, resulting in a fusion protein of CgCTR-2-CFP.
(vi) pHZ107: MgCTR2 complementation vector. The full-length M. grisea CTR2 (MgCTR2; BROAD accession no. MG00548) gene was amplified with primers CTRPF (AATAGCGGCCGCAGGACCAGGTATTTGAGTGAATA) and CTRPR (ATAAAAGCTTCATACCTAGATGCTTTGTCATGAT) and cloned into the NotI and HindIII sites on pYK11, which has a bleomycin resistance cassette (33).
Yeast complementation assay.
ctr1
, ctr2
, and ctr3
yeast cells were transformed with the plasmids pRS416, pRS416-yCTR2, pGMT10-CgCTR2S, and pGMT10-CgCTR2L. Two transformants from each transformation were selected and grown to exponential phase in medium without uracil. Cells were collected by centrifugation, washed with sterile distilled water, and diluted with water to an optical density at 600 nm of 1. Serial dilutions were spotted on selective medium (yeast extract and peptone with 2% ethanol and 3% glycerol [YEPG]) and on YPEG medium with 10, 15, 20, 25, 50, and 100 µM CuCl2. Plates were incubated at 30°C for 3 to 7 days.
CgCTR2 localization. Transgenic isolates expressing the CgCTR2-CFP fusion cassette were examined using a laser scanning confocal microscope (Zeiss CLSM 510). Staining with FM4-64 and DMY-64 (Molecular Probes) was performed according to the manufacturer's instructions.
Superoxide dismutase (SOD) activity assay. Fungi were cultured in CD medium for 48 h, and then the mycelium was harvested. Dry lyophilized mycelia were crushed to powder and suspended in lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA). The samples were centrifuged at 4°C at maximum speed for 10 min. The supernatant was then transferred into new tubes, and the protein concentration was determined. Protein samples (10 µg) were separated on a 12.5% nondenaturing polyacrylamide gel. Gels were incubated for 30 min in the dark in 40 ml of reaction mixture containing 0.1 M potassium phosphate buffer, pH 7.8, 1 mM EDTA, 33 µM riboflavin (Sigma-Aldrich), 245 µM nitroblue tetrazolium (Sigma-Aldrich), and 17 mM TEMED (N,N,N',N"-tetramethylethylenediamine). The gels were then incubated in 0.1 M potassium phosphate buffer, pH 7.8, and 1 mM EDTA and exposed to light for 15 min.
MgCTR2 gene replacement mutants. Fragments (0.6 kb) upstream and downstream of the MgCTR2 coding sequence were amplified with the primer pair CTR1F (CTTGTACGAATACCTACCCAGCAAGTCAT) and CTR2R (AATAGGCCGGCCGTCGTGATCAGGTTCGTGT) and the pair CTR3F (ATAAGGCGCGCCCTACCTGACCGATCAGGT) and CTR4R (GAGGAGCCCGAGTTTGAGCACAATGAGGATTAT), respectively. The resulting PCR products were digested with FseI and AscI and ligated with the HPH (hygromycin B phosphotransferase) cassette. The MgCTR2 gene replacement construct was amplified with primers CTR1F and CTR4R using the ligation product as the template and directly transformed into M. grisea strain 70-15. Hygromycin-resistant colonies were screened by PCR with primers CTRNF (CCAGAGGAGCTGAGCTGT) and CTRNR (ACAGCAAGCATAACCCAA), and strains containing the deletion were confirmed by Southern blot analysis.
Microscopy. Fluorescent and light microscopy were performed with a Zeiss Axioskp 2 epifluorescent microscope or with an Olympus SZX 12 fluorescent stereoscope equipped with an EGFP filter. Confocal microscopy was performed with a Zeiss CLSM 510 laser scanning confocal microscope.
Germination and plant infection assays. Spores harvested from 5-day-old EMS plates were used to inoculate PE liquid medium. Germination assays were performed in shake cultures or on glass slides (3). Infection assays of A. virginica plants and detached pea leaves were performed as previously described (3).
Mycelium growth. Radial growth was measured after 5 days of growth on CD or REG agar plates. Media were amended with CuCl2 and or H2O2.
Gene expression. Total RNA was extracted from ground mycelium or germinated spores using a GenElute Mammalian Total RNA Miniprep kit (Sigma) and analyzed by Northern blot hybridization. For semiquantitative RT-PCR, cDNA was generated from 1 µg of RNA using a Reverse-iT 1st Strand Synthesis Kit (ABgene). PCR with CgCTR2-specific primers (159-start and 159end-new) was performed using 4 µl of cDNA as a template. CgCDC42-specific primers (ATGGTCGTCGCTACTATCAAGTGC and TCAGAGGACGAGGCACTTGTGCG) were used as internal controls. The reaction was terminated after 15, 20, 25, 30, 35, and 40 cycles, and amplification products were analyzed by agarose gels. For in planta expression, total RNA was extracted from inoculated pea leaves with an SV Total RNA isolation system (Promega). cDNA was produced with SuperScript II reverse transcriptase (Invitrogen) and the anchored oligo(dT)12-18 (Amersham) using 2 µg of RNA as a template. Semiquantitative PCR was performed with 2 µl of cDNA as a template.
Nucleotide sequence accession numbers. The three CgCTR2 sequences were submitted to GenBank under accession numbers EF434817 [GenBank] , EF468351 [GenBank] , and EF468352.
|
|
|---|
![]() View larger version (105K): [in a new window] |
FIG. 1. GFP expression in REMI mutant N159. (A) Strain N159 (bottom) was grown in different media, and GFP signal was compared with a strain expressing GFP from the constitutive GPDA promoter (top). The following media were used: REG medium (frames a and d), EMS medium (frames b and e), and PE medium (frames c and f). Scale bar, 5 µm. (B) The GFP signal in strain N159 is reduced in PE medium and recovered in REG medium. The addition of copper and EGTA (a copper chelator) did not affect GFP levels. Contrast and brightness of the lower part of the left picture (PE medium) were intensified to allow visualization of the very low level of GFP expression under these conditions. Scale bar, 30 µm.
|
|
View this table: [in a new window] |
TABLE 1. Spore germination in CgCTR2 transgenic strains
|
![]() View larger version (9K): [in a new window] |
FIG. 2. Schematic diagram of the genomic sequence at the insertion site in strain N159. The insertion site of the transforming vector pAS1-GFP is 70 bp upstream from the start codon of a putative reading frame. Two transcripts are encoded with alternative splicing at 741 bp and 786 bp, corresponding to putative peptides of 183 aa and 168 aa, respectively. Both transcripts have the same reading frame at the 3' end. Black bars are exons; lines are introns. Positions of the protein transmembrane domains are predicted to be between aa 32 to 54 and 146 to 169 in the larger peptide and between aa 32 to 54, 109 to 132, and 136 to 159 in the smaller peptide. GUS, glucuronidase; HPH, hygromycin B phosphotransferase.
|
ctr2
ctr3
triple mutant, which lacks the high affinity (CTR1 and CTR3) and vacuole (CTR2) copper transporter genes. The triple ctr yeast mutant is unable to grow on ethanol-glycerol (YPEG) medium unless supplemented with >15 µM copper, unlike the ctr1
ctr3
double mutant, which can grow normally on YPEG medium with 15 µM copper (23). Expression of CgCTR2 in the S. cerevisiae ctr1
ctr2
ctr3
mutant strain fully restored growth on YPEG medium with 15 µM CuCl2 (Fig. 3), further suggesting that CgCTR2 is a functional homologue of the S. cerevisiae Ctr2 vacuolar copper transporter.
![]() View larger version (53K): [in a new window] |
FIG. 3. Complementation of S. cerevisiae ctr mutants with CgCTR2. An S. cerevisiae ctr1 ctr2 ctr3 triple mutant was transformed with the S. cerevisiae CTR2 gene or with CgCTR2. Strains were grown on ethanol-glycerol medium (YPEG) with various concentrations of copper. The triple mutant lacking all three copper transporters requires at least 20 µM CuCl2 for growth on this medium (vector). Transformation of the triple ctr mutant with S. cerevisiae CTR2 (Sc CTR2) restores the ability of the strains to grow on YPEG medium with only 15 µM CuCl2. Transformation of the yeast mutant strain with either the long or short CgCTR2 gene fully restored the ability of the complemented strains to grow on medium with 15 µM CuCl2 (CgCTR2). Both transcripts had an identical effect (the result with the long transcript is presented). Growth of the various mutants on synthetic medium (Sc-ura) was unaffected.
|
![]() View larger version (73K): [in a new window] |
FIG. 4. CgCTR2 is localized in the vacuole membrane. Transformants expressing a CgCTR2-CFP fusion protein were visualized using confocal and fluorescent microscopes. (A) Confocal images of CFP and DMY-64 signals. Different samples are shown due to the overlap of the spectra between CFP and DMY-64. Frames a and b, CFP and DIC images; frames c and d, DMY-64 and DIC images. (B) Fluorescent microscopy of Hoechst-stained nuclei and DIC images. Frame e, Hoechst staining; frame f, DIC image (white arrow, vacuole; black arrow, nucleus); frame g, merge. (C) Fluorescent microscope images of CFP and Hoechst staining. Hyphae containing large (left) or small (right) vacuoles are shown. Frames a and b, DIC images; frames c and d, CFP (white arrows show large vacuoles; yellow arrows show small vacuoles); frames e and f, Hoechst staining; frames g and h, merged images of CFP and Hoechst staining. (D) Confocal images of FM4-64 and CFP signals. Frames a and b show the results of a short incubation with FM4-64. The FM4-64 signal (a) is detected on the outer cell membrane; CFP signal (b) is inside the cell; Frames c, d, and e show results of longer incubations with FM4-64: frame c, CFP; frame d, FM4-64; frame e, merged image. Membranes of large vacuoles are stained with FM4-64; CFP signal is localized inside these vacuoles as well as around nuclei. Scale bar, is 5 µm.
|
Copper. Response to copper was determined by exposing mycelia to 0, 10, 20, 100, and 250 µM concentrations of CuCl2. Expression of CgCTR2 was highest on a medium without copper and slightly reduced by 10 and 20 µM CuCl2. No further changes were observed at higher copper concentrations (Fig. 5A).
![]() View larger version (64K): [in a new window] |
FIG. 5. Analysis of CgCTR2 gene expression. (A) Copper effect. Mycelium was collected after growth in REG medium for 44 h and incubated in medium containing various amounts of copper. After 4 h RNA was extracted, and cDNA was produced. RT-PCR was performed on the cDNA with CgCTR2-specific primers, and samples were removed every 5 cycles starting at 15 cycles and up to 40 cycles. Picture shows samples collected after 35 cycles. Top, CgCTR2; bottom, CgCDC42. (B) Expression of CgCTR2 in different media and during pathogenic germination. Mycelium was grown for 48 h in different media, and then RNA was extracted, and transcript was detected by Northern blot analysis (left). Spores were collected from EMS plates and incubated in PE medium, which induces pathogenic germination (right). RNA was extracted at several time points starting at 2 h, which represents the onset of germ tube formation. Top, CgCTR2; bottom, rRNA. (C) Expression during early stages of pathogenic and saprophytic germination. Spores were collected from plates and incubated in PE or EMS shake cultures. (D) In planta CgCTR2 gene expression. Pea leaves were inoculated with fresh spores, and tissue samples were collected at time intervals beginning at 4 h and up to 72 h postinoculation. Quantitative PCR was performed as described in panel A. Shown are results after 40 cycles. Top, CgCTR2, bottom, CgCDC42. Lanes M, molecular weight ladders.
|
Germination. CgCTR2 gene expression was followed in spores germinated in PE or EMS medium. In resting spores, expression of CgCTR2 was strong, similar to the GFP signal observed in spores produced by N159 on EMS plates. In EMS medium expression was stable throughout the entire germination process, whereas in PE medium CgCTR2 was downregulated already after 0.5 h, and no transcript could be detected thereafter (Fig. 5C).
In planta. Pea leaves were inoculated with spores, and tissue samples were collected from the infected area at several time points following inoculation. RNA was extracted from the infected plant tissues, and the relative expression of CgCTR2 was determined by quantitative RT-PCR. Expression of CgCTR2 was most intense in spores at time zero and was reduced to below detection levels immediately following plant inoculation, with no transcript detectable until 48 h postinoculation (Fig. 5D). A moderate level of CgCTR2 gene expression was recovered 72 h postinoculation.
The apparent expression pattern of CgCTR2 indicates that it is highly expressed in resting spores and strongly repressed at the onset of pathogenic development.
Generation of CgCTR2 transgenic strains. Insertion of the transformation cassette in strain N159 was at the 5' untranslated region, close to the ATG, leaving the reading frame intact. RT-PCR analysis showed that CgCTR2 transcript levels were significantly reduced in strain N159 but not completely abolished (Fig. 6A). We used RNA interference (RNAi) to cause silencing of CgCTR2. Complete silencing of CgCTR2 was obtained in RNAi strains 9 and 49 (Fig. 6A). CgCTR2-overexpressing isolates were produced by expression of the gene from the Aspergillus nidulans GPDA promoter. CgCTR2 expression in these isolates was high under all conditions, including in PE medium, in which the CgCTR2 transcript is normally undetected (Fig. 6B). The N159 mutant strain was also transformed with a CgCTR2 complementation vector containing the CgCTR2 promoter and ORF. Analyses were carried out with complementation strains C10 and C37, which expressed normal levels of CgCTR2 (data not shown).
![]() View larger version (107K): [in a new window] |
FIG. 6. Analysis of CgCTR2-silenced and overexpression transgenic strains. (A) N159 and transgenic strains transformed with the CgCTR2 RNAi cassette (49 or 9). Strains were grown for 48 h in REG medium, conditions under which CgCTR2 gene expression is relatively strong. (B) CgCTR2-overexpressing isolates. Strains were grown for 48 h in PE medium, conditions under which CgCTR2 gene expression is low. RNA was extracted, and RT-PCR was performed with primers specific for CgCTR2 (upper panel) and CgCDC42 (lower panel). Lanes M, molecular weight ladders; wt, wild type.
|
|
View this table: [in a new window] |
TABLE 2. Sensitivity of CgCTR2 transgenic strains to H2O2
|
|
View this table: [in a new window] |
TABLE 3. Copper compensation for hypersensitivity of the Cgctr2 mutant to H2O2
|
![]() View larger version (65K): [in a new window] |
FIG. 7. Activity assay of Cu/Zn SOD in wild-type and Cgctr2 mutant strains. Strains were grown in CD medium without copper for 48 h. Mycelium was harvested, and SOD activity was determined with or without the addition of 5 µM copper. Without copper the wild type showed an additional band (arrow) that could not be detected in the RNAi and N159 mutant strains. This band was intensified and was present in all strains following the addition of 5 µM copper. The other two bands were unchanged under all conditions and might represent the activity of Mn SOD. WT, wild type.
|
![]() View larger version (15K): [in a new window] |
FIG. 8. Effect of spore density on germination rate. Spores of the wild-type ( ) and N159 ( ) strains were collected from EMS plates, diluted, and germinated in PE medium. After 2.5 h the number of germinated spores was counted, and the percentage of germination was calculated. Germination in the mutant strains was markedly reduced compared to the wild type at spore densities of 106/ml or higher but was similar to the wild type at or below 105 spores/ml.
|
![]() View larger version (55K): [in a new window] |
FIG. 9. Pathogenicity of Cgctr2 mutant strains. (A) Comparison of infection by the CgCTR2-silenced and overexpression transgenic strains. A. virginica plants were inoculated with spore suspensions (5 x 104 spores/ml) of wild type, N159, RNAi strains 9 and 49 (only strain 9 is shown), overexpression (OX) strains 29 and 35 (only strain OX29 is shown), and the N159 complemented strain C10. The picture shows plants at 6 days postinoculation. Numbers indicate the average fresh weight of six plants ± standard error. (B) Pea leaves were inoculated with spores of strain N159 (frames a to c) or with a GFP-expressing strain (frames d to f). After 24 h there is almost no external growth by the GFP-expressing strain (frame d), while N159 develops a significant amount of mycelium on the leaf surface (frame a). Leaves infected by strain N159 (frames b and c) develop necroses after 48 h, which are similar in size and number to the necroses that develop in leaves infected by the GFP-expressing strain (frames e and f). Images in frames a and d are from a light microscope; images in frames b to f are from a fluorescent stereoscope. (C) A. virginica plants were inoculated with optimal (5 x 104), suboptimal (2 x 104), and supraoptimal (8 x 104) spore densities. Disease was recorded after 6 days. Full symptoms were developed by the inoculation of plants with 8 x 104 spores/ml of strain N159. All the experiments were repeated several times with similar results. wt, wild type.
|
Usually, the fungus will penetrate the plant several hours after appressorium formation, and further development will occur inside the plant tissues (3, 4). Extensive hyphal growth on the plant surface was not observed in the wild-type strain 24 h postinoculation. In contrast, spores of strain N159 produced abundant hyphae on the leaf surface (Fig. 9B). The development of hyphae on the leaf surface has been previously correlated with saprophytic germination, in which germ tubes develop into long hyphae that do not differentiate appressoria (3).
Infection of A. virginica plants by C. gloeosporioides increases with increasing numbers of spores and reaches saturation at or near 5 x 104 spores/ml. Higher numbers of spores do not cause a significant increase in disease symptoms or plant mortality. The Cgctr2 mutants developed fully functional appressoria but had lower rates of pathogenic germination, which might affect the number of spores that can initiate infection. To determine whether low rates of pathogenic germination might cause the reduced virulence of Cgctr2 mutants, we compared disease levels at high (8 x 104) or low (2 x 104) numbers of spores with disease levels caused by 5 x 104 spores/ml. When plants were inoculated with 8 x 104 spores/ml, the symptoms caused by the Cgctr2 mutant strains were enhanced compared to infection with 5 x 104 spores/ml and were similar to symptoms caused by the 3.1.3 wild-type strain (Fig. 9C). When the number of spores was reduced to 2 x 104/ml, infection rates of both the wild type and N159 were reduced in comparison to infection with 5 x 104 spores/ml. The symptoms caused by 2 x 104 spores/ml of the wild-type strain were similar to the symptoms that were caused by 5 x 104 spores/ml of strain N159. That the reduced virulence of the Cgctr2 mutants could be compensated for by increasing the number of spores suggests that the low rates of spore germination among the mutants might contribute to their reduced virulence.
The MgCTR2 gene in M. grisea is a functional homolog of CgCTR2. A single homolog of CgCTR2, MGF00548, was identified in the M. grisea genome (named MgCTR2). Three transformants of strain N159 carrying the MgCTR2 gene (entire ORF plus its native promoter) were generated and confirmed by Southern analysis (data not shown). Germination in N159::MgCTR2 strains was between 70% and 75%, significantly higher than 47% germination in N159 but somewhat lower than the 83% germination in the C. gloeosporioides wild-type strain 3.1.3 (Table 4). The hypersensitivity of Cgctr2 mutants to H2O2 was fully rescued by MgCTR2 (Table 4), indicating that MgCTR2 functionally complemented the C. gloeosporioides Cgctr2 mutant. Partial restoration of the germination defects in N159::MgCTR2 transformants might be related to the expression level of the MgCTR2 promoter in C. gloeosporioides.
|
View this table: [in a new window] |
TABLE 4. Germination rate and H2O2 sensitivity of N159::MgCTR2 strains
|
|
View this table: [in a new window] |
TABLE 5. H2O2 sensitivity of Mgctr2 mutantsa
|
|
|
|---|
In strain N159, the GFP signal was intense in resting spores and was specifically repressed during pathogenic germination. The tagged locus was isolated, and the CgCTR2 gene, which is located 70 bp downstream of the insertion site in strain N159, was characterized. The predicted CgCTR2 protein shares high identity with S. cerevisiae Ctr2p, a copper transporter of the vacuolar membrane. The S. cerevisiae Ctr2p is a member of the CTR family of integral membrane proteins that function in copper uptake (1). The high-affinity copper transport protein members Ctr1p and Ctr3p are localized in the plasma membrane and import copper into the cell. These proteins have been studied in various organisms and are the primary transporters of external copper into the cell. A third member of the CTR family of proteins (Ctr2p) was studied in only a few species. It was initially identified by homology to the plant copper transporter Copt1 and was suggested to be a low-affinity copper transporter due to lack of a clear phenotype in yeast and Podospora anserine ctr2
mutants (6, 10). However, more recent studies showed that Ctr2p is localized to the vacuole membrane and that it is involved in regulation of the intracellular copper concentration by exporting copper from the vacuole into the cytosol (23). Localization of the Arabidopsis and P. anserine homologs is unknown, but they might well represent vacuolar transporters.
The redox sensitivity of copper makes it an essential cofactor in critical biological processes such as respiration, iron transport, oxidative stress protection, and pigmentation. S. cerevisiae ctr1
ctr3
ctr2
triple mutants are unable to grow on ethanol-glycerol medium (YPEG) due to insufficient delivery of copper to cytochrome c oxidase. The strain can grow only on YPEG medium containing relatively high levels of copper. This defect is partially compensated for by complementation of the triple ctr
mutant with the wild-type CTR2 gene (23). S. cerevisiae ctr1
ctr3
ctr2
expressing CgCTR2 (either the long or short transcript) was unable to grow on YPEG medium without copper but exhibited improved growth on YPEG medium with a low copper concentration, which was even better than the growth of the same strain complemented with S. cerevisiae CTR2 (Fig. 3). Further, a CgCTR2-CFP fusion protein was localized in vacuoles (Fig. 4), similar to yeast Ctr2p (23). In large vacuoles the signal was detected inside the vacuoles, whereas in small vacuoles it was detected on the vacuole membrane. The localization inside large vacuoles could be the result of the overexpression or be due to the internalization of the protein following inactivation of these vacuoles. Importantly, CgCTR2 could not be detected in the cell plasma membrane, thus ruling out the possibility that this protein is similar to CTR1 or CTR3 and involved in copper uptake. Together, the sequence homology, functional analysis, and localization data strongly suggest that CgCTR2 is a vacuole copper transporter.
Yeast CTR2 encodes a single peptide, whereas the CgCTR2 produces two transcripts, which result from an alternative splicing of the coding sequence. CTR proteins contain three putative transmembrane regions and an amino-terminal region that is rich in methionine motifs (22). Two or three transmembrane domains were found in the long and short polypeptides of CgCTR2, respectively, which are situated in the middle and at the carboxy terminus of the protein. This configuration is highly similar to the transmembrane domains found in C. albicans Ctr1p (16). The shorter transcript was more abundant in RNA samples obtained from fungal cultures and from fungus-infected plants (Fig. 5A and 6A and D), which could suggest different roles of the two peptides. However, both transcripts were fully functional in yeast (Fig. 3), and when overexpressed in C. gloeosporioides, the large transcript was predominant (Fig. 6B). Therefore, the functional significance of the alternative splicing of CgCTR2 remains unclear.
Complementation of strain N159 with an intact copy of CgCTR2 fully restored the wild-type phenotype, confirming that the observed phenotypes of the N159 and RNAi strains resulted from reduced CgCTR2 expression. The M. grisea CTR2 homolog MgCTR2 also complemented strain N159 although germination was not fully restored, possibly because the MgCTR2 gene was expressed from its own promoter. Exchanging the tightly regulated promoters between these fungi resulted in different expression patterns (14) and therefore might not be as efficient as expressing the gene from the native promoter.
Dormant spores contain various transcripts, some of which disappear soon after spore germination. These genes might be needed for activation of growth in dormant spores upon receiving the right signals (17). CgCTR2 was highly expressed in resting spores, and the transcript and protein quickly disappeared during pathogenic germination, suggesting that CgCTR2 may be required for the activation of pathogenic germination, which represents the onset of pathogenic development. One explanation for the specific effect of the CgCTR2 silencing on only pathogenic germination would be that copper-requiring enzymes that are involved in activation of the initial stages of pathogenic germination depend on an intracellular copper supply. The high-level expression of CgCTR2 in resting spores indicates that supplying copper to cytoplasmic enzymes does not depend on de novo synthesis of proteins and can take place without any delay at the onset of germination by transport of copper from the vacuole. Indeed, addition of copper to the medium did not overcome the germination defects of Cgctr2 mutants, but it caused a 15% increase in germination of the wild type as well as mutant spores, further demonstrating that copper is necessary for the early stages of germination.
The role of copper in the early stages of fungal pathogenesis is supported by microarray data derived from in planta experiments, in which a number of copper-related genes are found among fungal transcripts that are differentially upregulated (9, 20, 28). We also found a high frequency of expressed sequence tags of several copper-related genes in a cDNA library prepared from pathogenic, germinated spores, including the Ctr3p and Ctr2p copper transporters, the copper chaperone TahA, Cu-transporting P1-type ATPase Crd1p, and a multicopper oxidase (S. Barhoom and A. Sharon, unpublished data). Deletion of a Colletotrichum lindemuthianum copper-transporting ATPase CLAP1, which is involved in intracellular delivery of copper to copper-requiring enzymes, resulted in mutants that were unable to induce disease symptoms, further demonstrating the importance of proper intracellular copper transport in fungal pathogenesis (18).
C. gloeosporioides and M. grisea ctr2 mutant strains showed increased sensitivity to hydrogen peroxide, whereas overexpression of CgCTR2 increased resistance to oxidative stress. Due to its ability to adopt both oxidized and reduced states, copper is an important redox cofactor in many copper-dependent enzymes such as polyphenol oxidase, cytochrome c oxidase, and copper/zinc SOD (34). C. albicans, yeast, and human ctr1-null mutants also display increased sensitivity to hydrogen peroxide, which was explained by copper/zinc SOD defects (16, 22). In agreement with this possibility, we showed that low levels of copper (but not iron) reduced sensitivity of CgCTR2 mutants to hydrogen peroxide and reversed it to wild-type levels, whereas the same copper concentrations had no effect on the wild-type sensitivity to hydrogen peroxide (Table 3). These results demonstrate the importance of copper in oxidative stress resistance and the involvement of Cgctr2 in maintaining optimal levels of free copper in the cytoplasm.
Differences were found in the sensitivity of C. gloeosporioides and M. greisea ctr2 mutants to oxidative stress at different stages of development, with appressorium formation being the most sensitive. The C. lindemuthianum clap1 (copper-transporting ATPase) mutant is characterized by beige mycelium and appressoria instead of the normal black pigmentation of these organs (18). Addition of CuSo4 restored the black pigmentation in clp1 mycelium but not in the appressoria of the mutant, indicating that appressorium melanization might depend on internal copper translocation, which directs copper to the correct cellular compartments (18). In other organisms such as plants or yeasts, many genes are involved in copper uptake, distribution, and sequestration through copper-responsive transcription factors. Once the copper is inside the cell, Cu+2 chaperones mediate intracellular copper delivery to specific targets such as the mitochondria, vacuole, chloroplast, and the secretory pathway (22, 24). The mechanism of communication between intracellular compartments and cupro-proteins in the cytosol and the plasma membrane is still unknown, but CTR2 is probably an important player in this intracellular copper-distributing apparatus.
The Cgctr2 mutant strains had reduced pathogenicity. The difference from wild type was quantitative and could be compensated for by increasing the number of spores used for plant inoculation. No defects were found in appressorium formation or penetration in pea leaves and onion epidermis assays, and disease symptoms developed on the same time scale as in wild-type-infected leaves. These results suggest that the reduced pathogenicity of the Cgctr2 mutants might be a consequence of reduced levels of pathogenic germination rather than a direct defect in pathogenicity. However, other factors that have not yet been determined could be responsible for this phenotype.
Free sugars are sufficient to activate germination in many fungi. In a classical scenario, dormant spores are activated by, e.g., glucose and then undergo isotropic growth, which can last for several hours, before polarized growth and cell cycle are initiated. Spores of plant-pathogenic fungi germinate in a nutrient-depleted environment and therefore must respond to stimuli that come from their host plant. Because of the lack of an external nutritional source, spores of plant pathogens must rely on internal resources to quickly complete the developmental stages that are necessary for host penetration. Here, we showed that a vacuolar copper transporter that is highly expressed in resting spores (CgCTR2) is necessary for optimal germination. Previous works showed that many fungal copper metabolic genes are induced during pathogenesis, and proper copper translocation by the copper-transporting ATPase CLAP1 is essential for pathogenesis in C. lindemuthianum (18). Our results show that copper is needed at the initial stages of pathogenesis in C. gloeosporioides and that the putative vacuole copper transporter CgCTR2 is probably involved in this process.
strains and plasmids. This work was supported by grant US-3491-03 from BARD to A.S. and J.-R.X.
Published ahead of print on 2 May 2008. ![]()
Supplemental material for this article may be found at http://ec.asm.org/. ![]()
|
|
|---|
protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia. Mol. Microbiol. 59:821-835.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»