This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heiss, K.
Right arrow Articles by Matuschewski, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heiss, K.
Right arrow Articles by Matuschewski, K.

 Previous Article  |  Next Article 

Eukaryotic Cell, June 2008, p. 1062-1070, Vol. 7, No. 6
1535-9778/08/$08.00+0     doi:10.1128/EC.00089-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Functional Characterization of a Redundant Plasmodium TRAP Family Invasin, TRAP-Like Protein, by Aldolase Binding and a Genetic Complementation Test{triangledown}

Kirsten Heiss,1 Hui Nie,2 Sumit Kumar,2 Thomas M. Daly,2 Lawrence W. Bergman,2* and Kai Matuschewski1*

Department of Parasitology, Heidelberg University School of Medicine, 69120 Heidelberg, Germany,1 Center for Molecular Parasitology, Department of Microbiology and Immunology, Drexel University College of Medicine, Philadelphia, Pennsylvania 191292

Received 11 March 2008/ Accepted 14 April 2008


arrow
ABSTRACT
 
Efficient and specific host cell entry is of exquisite importance for intracellular pathogens. Parasites of the phylum Apicomplexa are highly motile and actively enter host cells. These functions are mediated by type I transmembrane invasins of the TRAP family that link an extracellular recognition event to the parasite actin-myosin motor machinery. We systematically tested potential parasite invasins for binding to the actin bridging molecule aldolase and complementation of the vital cytoplasmic domain of the sporozoite invasin TRAP. We show that the ookinete invasin CTRP and a novel, structurally related protein, termed TRAP-like protein (TLP), are functional members of the TRAP family. Although TLP is expressed in invasive stages, targeted gene disruption revealed a nonvital role during life cycle progression. This is the first genetic analysis of TLP, encoding a redundant TRAP family invasin, in the malaria parasite.


arrow
INTRODUCTION
 
The phylum Apicomplexa consists of unicellular eukaryotes, such as Plasmodium and Toxoplasma gondii, that are obligate intracellular parasites in a wide range of invertebrate and vertebrate hosts, including humans. Despite vast differences in host range and target cell specificity, these parasites share a unique mechanism of active actin-dependent motility and host cell entry (18, 27). Gliding locomotion and successful host cell entry through simultaneous formation of a parasitophorous vacuole are rapid processes and are thought to be mechanistically coupled (21). Both functions are mediated by the parasite's actin-myosin motor machinery (6, 22) and additional proteins, including type I transmembrane proteins of the TRAP/MIC2 family of invasins (12, 29, 30), the invasin bridging protein aldolase (4, 14), and the myosin tail interacting protein MTIP (3). According to the current model (1, 26), an extracellular recognition event results in connection of the transmembrane invasins to short actin polymers that in turn are rapidly pulled backwards by immobilized motor myosins.

So far, only TRAP-like invasins have been shown to act directly in parasite locomotion and invasion. In two invasive stages of the Plasmodium parasite, sporozoites and ookinetes, thrombospondin-related anonymous protein (TRAP) and circumsporozoite- and TRAP-related protein (CTRP), respectively, fulfill these functions (5, 29, 30). These proteins share a unifying primary structure, i.e., combinations of two adhesive modules, the von Willebrand factor A-domain (A domain) (37) and the thrombospondin type I repeat (TSR) (33), in their ectodomains, a transmembrane domain (25) and a cytoplasmic tail domain (CTD) (16). Importantly, the CTD of the sporozoite invasin TRAP is essential for gliding motility and cell entry of Plasmodium sporozoites, since a carboxy-terminal truncation of Plasmodium berghei TRAP resulted in noninvasive sporozoites. This finding also permitted a functional assay, and it was demonstrated that the CTD of the T. gondii tachyzoite invasin MIC2 could rescue the loss-of-function mutant (16). This complementation experiment was the first direct proof for a functional TRAP homolog in T. gondii tachyzoites. However, this reverse-genetics approach has not been extended to other potential members of the TRAP/MIC2 family yet.

Sporozoites cross various biological barriers and migrate over long distances at a relatively high speed (1 to 3 µm/s) (7, 21). Similarly, ookinetes traverse barriers, such as the peritrophic membrane and the mosquito midgut, albeit at a considerably lower speed (5 µm/min) (35). In contrast, merozoites, the invasive stage of the pathogenic red blood cell phase, do not display active locomotion on substrates but employ their motor machinery exclusively for entry into host erythrocytes. In these stages, two TSR-containing transmembrane proteins, termed Plasmodium thrombospondin-related apical merozoite protein (PTRAMP) (31) and merozoite-specific TRAP homolog (MTRAP) (2), have been detected recently. Both proteins are reportedly essential for parasite survival (2, 31). MTRAP contains a CTD and interacts with aldolase in vitro, whereas PTRAMP lacks the characteristics of the TRAP family CTD. A direct function during the merozoite invasion process has not been demonstrated for any protein yet. Additional invasion-related transmembrane proteins exist; they contain TSR domains only, namely, secreted protein with altered thrombospondin repeat (SPATR) (17) and thrombospondin-related sporozoite protein (TRSP/S21) (15, 19). Both proteins lack the CTD, and none of them have been linked to the parasite actin/myosin motor.

In this study, we established a systematic approach to functionally identify TRAP family invasins. Employing two complementary assays, in vitro binding to the actin-bridging molecule aldolase and genetic complementation of the TRAP CTD, we tested potential candidates for their capacity to interact with the actomyosin motor. We show that the ookinete invasin CTRP and one of the last uncharacterized TRAP-like proteins (TLP) (PFF0800w) are functional members of the TRAP family while EBA175 is not. TLP is expressed in multiple invasive stages but has a redundant role during Plasmodium life cycle progression.


arrow
MATERIALS AND METHODS
 
Plasmodium life cycle. P. berghei strain NK65 was maintained in NMRI mice and Sprague/Dawley rats. For mosquito transmission, mice were assayed for a high proportion of differentiated gametocytes and microgametocyte-stage parasites capable of exflagellation. Anopheles stephensi mosquitoes were allowed to blood feed for 15 min on anesthetized mice and maintained under a 14-h light/10-h dark cycle at 75% humidity and 20°C. Mosquitoes were dissected at days 10, 14, and 17 to determine infectivity, midgut sporozoite numbers, and salivary gland sporozoite numbers, respectively. To detect liver-stage parasites in hepatocytes, ~3 x 104 Huh7 cells were seeded in eight-well chamber slides and grown to semiconfluency. P. berghei sporozoites were added, incubated for 90 min at 37°C, and washed off. After 42 to 48 h, liver-stage parasites were visualized using a primary antibody against P. berghei heat shock protein 70 (32). For analysis of gliding motility, salivary gland sporozoites were deposited on bovine serum albumin-coated glass slides and incubated at 37°C. After fixation with 4% paraformaldehyde, sporozoites and deposited trails were visualized using an anti-P. berghei CSP antibody. To determine the prepatent period, 10,000 sporozoites were injected intravenously into Sprague/Dawley rats and parasitemia detected by daily examination of Giemsa-stained blood films. For natural transmission experiments, young Sprague/Dawley rats were infected by five mosquito bites and parasitemia was examined daily.

PbTRAP cytoplasmic tail swapping. The insertion plasmid used for the tail swap approach contains the 3' untranslated region of PbDHFR (pSE02) (7). For targeting of PbTRAP, a 5'- and 3'-truncated sequence of the P. berghei TRAP open reading frame generated by PCR using the primers TRAP{Delta}5'for (5' CGGAATTCCTTAATGGTCAGGAAATTCTTGACG 3'; EcoRI site is underlined) and TRAP{Delta}3'rev (5' TGCTCTAGATTAGGATCCTGCTATAAAATTATAACCAACACC 3'; XbaI and BamHI sites are underlined; the in-frame stop codon is in italics) was cloned into pSE02, resulting in the plasmid pKH01/{Delta}tail. This strategy introduces a BamHI cloning site prior to a stop codon for subsequent cloning of the swap fragments. The following cytoplasmic tail domains were amplified: P. falciparum TRAP, PfTRAPfor (5' CGGGATCCGCAGCAACACCCTATGCCGGAGAACC 3'; BamHI site is underlined) and PfTRAPrev (5' TGCTCTAGATTAATTCCACTCGTTTTCTTCAGG 3'; XbaI site is underlined); P. falciparum CTRP, PfCTRPfor (5' ACGGATCCGAGCCTCCTCATAGTTCTAATATGG 3'; BamHI site is underlined) and PfCTRPrev (5' AAGTCTAGAGAATCAGTTCCACATAGGGTCATCCGCG 3'; XbaI site is underlined); P. berghei TLP, PbTLPfor (5' CGGGATCCAAAAACAAACAAATAATTCCAACTAGC3'; BamHI site is underlined) and PbTLPrev (5' TGCTCTAGATCATTTCCATGGAGAATTGTCATTATAATC 3'; XbaI site is underlined), and PfEBA175for (5' TATGGATCCTCTGAAGGAGTTATGAATGAGAATAATG 3'; BamHI site is underlined) and PfEBA175rev (5' CTTCTAGAAAAAAATACATCATATCTTAAATTT 3'; XbaI site is underlined). The obtained PCR fragments were cloned via BamHI/XbaI into pKH01, resulting in the plasmids pKH02/PfTRAP, pKH03/PbTLP, pKH04/PfEBA175, and pNZ009/PfCTRP, respectively. Transfection was done as described previously (13) with SpeI-linearized plasmids. Pyrimethamine-resistant parasite populations were cloned by limiting dilution into 15 NMRI mice. Genotyping of the obtained clonal parasite populations was performed by specific PCRs using the following primer combinations: PbTRAPfor (5' CCCGGATCCATGAAGCTCTTAGGAAATAG3') and PbTRAPrev (5' CCCGGATCCGTTCCAGTCATTATCTTC3') for the PbTRAP wild-type (WT) signal, PbTRAPfor and T7rev (5' GTAATACGACTCACTATAGGGC3'), as well as Tgfor (5' CCCGCACGGACGAATCCAGATGG 3') and PbTRAPrev for the integration-specific PCRs. For Western blotting, extracts of 100,000 midgut sporozoites were separated on a 10% sodium dodecyl sulfate gel and transferred to a nitrocellulose membrane. TRAP and CSP were detected with polyclonal anti-PbTRAP antisera or a monoclonal anti-PbCSP antibody (29) and horseradish peroxidase-coupled secondary antibodies.

Recombinant protein expression. The carboxy-terminal domains of P. falciparum TLP, the PfTLP loss-of-function mutant lacking the penultimate tryptophan, PfCTRP, and PfEBA175 were expressed as His-tagged fusion proteins using the pET28a Escherichia coli expression vector (Novagen). After induction using isopropyl-β-D-thioagalactopyranoside, the protein was purified using nitrilotriacetic acid-agarose (Qiagen) under native conditions. The eluted protein was used for aldolase binding assays (see below). The carboxy-terminal 45 amino acids of WT P. berghei TRAP and two mutants were similarly expressed as His-tagged fusions in the vector pET28a and purified as described above. A glutathione S-transferase (GST) fusion to full-length Plasmodium yoelii aldolase was obtained from Carlos Buscaglia (New York University) and purified using glutathione agarose.

In vitro aldolase binding assay. Binding assays were performed as previously described (4). Briefly, wells of a 96-well microtiter plate (Maxisorp; Nunc) were coated with recombinant His-tagged fusion proteins that contain different TRAP tail domains at 4.0 µg/ml in 0.1 M NaHCO3, pH 9.6, overnight at 4°C. Following blocking with 5% bovine serum albumin in 10.0 mM imidazole-acetate, 50.0 mM KCl, 0.2% Tween 20, pH 7.6, biotinylated GST-P. yoelii aldolase was added to the wells in the buffer above at 1.0 µg/ml. NeutrAvidin-horseradish peroxidase (Pierce) was then added in the same buffer at a dilution of 1:2,000. Bound aldolase was quantified with the TMB Slow substrate (Pierce), read at 450 nm following the addition of 1 M H2SO4. Data are from two independent experiments done in duplicate.

RT-PCR. We isolated poly(A)+ RNA from P. falciparum (strains HB3 and 3D7) synchronized blood stages and P. berghei NK65 salivary gland sporozoites and gradient purified schizonts using oligo(dT) columns (Invitrogen). Reverse transcription (RT) was performed using the poly(A)+ RNA as a template for first-strand cDNA synthesis (Ambion). Control genomic DNA was isolated from mixed P. falciparum or P. berghei erythrocytic-stage parasites using silica-gel columns (Qiagen). cDNA or genomic DNA (1.0 µl) was used for the PCR amplifications using gene-specific primer sets.

Gradient purification of parasites and quantitative RT-PCR. After 3 days of infection, when the ascending parasitemia averaged between 15% and 25%, blood was drawn from P. yoelii-infected mice and fractionated on Percoll/RediGrad density gradients (Amersham Biosciences). Blood was layered on top of the gradient and centrifuged for 10 min at 10°C. The five gradient fractions were removed separately, washed with Hanks balanced salt solution, and treated with HEPES buffer solution, and parasitized cells were collected by centrifugation. After RNase inhibitor was added, cell pellets were frozen immediately at –80° C until further use. Total RNA was isolated using Trizol and a Qiagen RNAeasy kit. cDNAs were synthesized from 2 µg of total RNA isolated from each stage using the Omniscript cDNA synthesis reaction kit (Qiagen). A reference pool was made by adding equal amounts of total RNA from each fraction prior to cDNA synthesis. Primer pairs were generated for P. yoelii TLP and MSP1 using the Primer3 software (http://primer3.sourceforge.net; Whitehead Institute for Biomedical Research). All reactions were run in duplicate using an ABI Prism 7700 sequencing detection system, and data were analyzed using the Applied Biosystems Sequence Detector (v.1.7) program. Serial dilutions of input reference pool cDNA were used to generate a standard curve for each target gene. The relative expression levels of each target gene in the five different stages were normalized to the expression level of the reference pool for that particular gene. Bar graphs were plotted as log ratios of amounts of cDNA of each stage to the reference pool.

PbTLP gene targeting. For disruption of PbTLP, two fragments were amplified using primers TLPrepI_for (5' GGGGTACCACAAATTAAAGAACAAATCGAGGG 3'; KpnI site is underlined) and TLPrepI_rev (5' CCCAAGCTTGAATGGCTCTTAATTTGCCAGTCC 3'; HindIII site is underlined) for the 863-bp 5' fragment and TLPrepII_for (5' CGGAATTCGAGCCGCCTCTATTTAATATTGC 3'; EcoRI site is underlined) and TLPrepII_rev (5' TCCCCGCGGTGAACCTCCCAATAGACCCATTCC 3'; SacII site is underlined) for the 659-bp 3' fragment using P. berghei genomic DNA as a template. Both fragments were cloned into the P. berghei transfection vector b3D.DT^H.^D, resulting in the plasmid pKH20. After transfection, recombinant parasite populations were selected using pyrimethamine (13). Clonal parasite lines were obtained by limited dilution into 15 recipient NMRI mice. Genotyping of recombinant parasite populations was performed by PCR with the following primer combinations: TgPromrev (5' CGCATTATATGAGTTCATTTTACACAATCC 3') with PbTLPtestfor (5' TTTTGAGAAGGTATAACCCATATTCC 3') (test1) and Tgfor and PbTLPtestrev (5' TCCCCGCGGAACATCCATATTAAATAACATCG 3') (test2) for successful gene replacement and PbTLPfor_1 (5' CGGGATCCTAGGTGGTTCTACTAAGG 3') and PbTLPrev_1 (5'TGCACTGCAGTCAATTTTGATCTTTATAATTTTC 3') for the PbTLP WT signal.

For RT-PCR analysis, poly(A)+ RNA from gradient-purified schizonts of WT and knockout parasites was isolated and used for cDNA synthesis. For detection of TLP transcripts, two different primer sets were used: PbTLPfor_2 (5' CGCGGATCCCTATTTGATAATATCGATACAGACCC 3') and PbTLPrev_2 (5' TGCTCTAGAAATCTATATCCTTTTTGTCATCCAC 3') and PbTLPfor_2 and PbTLPrev_1. PbMyoA- and PbMSP1-specific primer sets were used as transcript controls.

Nucleotide sequence accession number. The nucleotide sequence reported in this paper has been submitted to the GenBank database with the accession number AY484471.


arrow
RESULTS
 
Preselection of parasite invasins by in vitro aldolase binding. We initiated our analysis by prescreening the cytoplasmic CTDs of candidate transmembrane proteins for in vitro binding to aldolase. We coated microtiter plates with recombinant His-tagged polypeptides that correspond to the CTDs of the sporozoite invasin PbTRAP (29), the ookinete-specific protein PfCTRP (5, 30), the candidate merozoite invasin PfEBA-175 (10), and a previously uncharacterized potential PfTRAP-like protein (PFF0800w), termed TRAP-like protein (PfTLP).

Immobilized proteins were tested for binding of a P. yoelii aldolase GST fusion protein (Fig. 1). As negative controls, we included TRAP mutants that lack the penultimate tryptophan or the carboxy-terminal acidic cluster, resulting in nonproductive motility in vivo (16). In good agreement with published data (4, 14), we detected binding of the PbTRAP CTD to aldolase, which was strictly dependent on the presence of the key residues (Fig. 1). Importantly, the CTDs of PfCTRP and PfTLP interacted with aldolase to a similar extent, suggesting that both proteins may function in TRAP-mediated processes. In contrast, the PfEBA175 CTD, which is acidic in nature but lacks the key tryptophan residue (10), failed to bind aldolase. Failure of PfEBA175 to bind to aldolase further substantiates that the observed in vitro interactions are specific and reflect a shared property of TRAP proteins.


Figure 1
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 1. In vitro aldolase binding assay to identify TRAP family invasins. Enzyme-linked immunosorbent assay plates coated with His-tagged fusion proteins of either PbTRAP, two PbTRAP loss-of-function mutants lacking the charged residues (trap-acid) or the penultimate tryptophan (trap-w/a), PfCTRP, PfTLP, a PfTLP loss-of-function mutant lacking the penultimate tryptophan (tlp-w/a), or PfEBA175 were incubated with a biotinylated GST-P. yoelii aldolase fusion protein. Bound aldolase was quantified in an avidin-substrate assay.

To confirm the relevance of the PfTLP/aldolase interaction, we tested a mutant form of TLP that contained an alanine in place of the penultimate tryptophan (Fig. 1). As expected, aldolase binding was reduced to background levels. Together, these findings suggest that CTRP and TLP might interact with the parasite actomyosin motor machinery.

TRAP-like protein. TLP is a type I transmembrane protein (Fig. 2A) that contains in its ectodomain one TSR (Fig. 2B) and an A domain (Fig. 2C) in the reverse order compared to TRAP. Of note, the key residues of A domains are also present in the amino-terminal portion between the signal sequence and the TSR, indicating a potential additional binding motif (data not shown). In its transmembrane domain, TLP contains the signature for a potential rhomboid cleavage site (2, 34), indicating that TLP may be processed similarly to TRAP and MIC2. The carboxy-terminal domain of TLP contains the penultimate tryptophan and scattered negatively charged residues (Fig. 2D). In the case of TRAP, both signatures were previously shown to drive sporozoite motility (16). Similarity of the domain architecture and the in vitro aldolase binding suggested that TLP belongs to the TRAP family of parasite invasins.


Figure 2
View larger version (36K):
[in this window]
[in a new window]

 
FIG. 2. Schematic diagram of the Plasmodium TLP. (A) Representation of the primary structure of P. falciparum TLP (PFF0800w) and P. berghei TLP (AY484471 [GenBank] ). Displayed are the extracellular TSR, followed by an A domain, the transmembrane span (TM), and the CTD. (B) Comparison of the TSRs in selected TSR-containing proteins. Shown are the conserved tryptophans, the central dicysteine motif, and the cluster of positive residues. In addition to the TRAP family members TLP and TRAP, TSRs of P. berghei circumsporozoite protein (PbCSP), T. gondii micronemal protein 2 (MIC2), and human thrombospondin (thrombosp.) are shown. (C) Comparison of MIDAS motifs in the A-domain-containing proteins TLP, TRAP, and the integrin CD11b. Invariant residues of the MIDAS are highlighted in bold. (D) TLP has a TRAP family-like cytoplasmic domain (CTD). An amino acid alignment of the putative CTDs of P. falciparum and P. berghei TLP, P. berghei TRAP, P. falciparum CTRP, and T. gondii MIC2 are shown. The strictly conserved juxtamembrane tyrosine and penultimate tryptophan residues are shown in black, the carboxy-terminal acidic residues in gray.

Genetic complementation of the TRAP tail. We next employed a reverse-genetics approach with the rodent malaria model parasite P. berghei in order to test whether the candidate proteins can be functionally grouped into the class of TRAP family invasins, as has been shown previously for MIC2 (16). Similar to this strategy, we designed a set of TRAP CTD swap mutants based on the corresponding regions that we tested in the aldolase assay (Fig. 3A). We included the CTDs of PfTRAP, PfCTRP, PbTLP, and PfEBA175. In addition, we generated a potential gain-of-function mutant of PfEBA175 that contains a penultimate tryptophan in order to test whether the acidic carboxy-terminal residues of EBA175 can at least partially interact with the motor machinery.


Figure 3
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 3. Functional identification of TRAP family members in Plasmodium. (A) Schematic representation of the TRAP tail swap experiments. Shown are the cytoplasmic tails of P. berghei TRAP, a negative control with a large deletion of the major portion of the tail ({Delta}tail), a positive control containing the tail of the P. falciparum TRAP ortholog (TRAP-tail), and the replacement of the TRAP tail with the corresponding region of PbTLP (TLP-tail), PfCTRP (CTRP-tail), PfEBA 175 (EBA175-tail), or a mutant version of PfEBA175 that contains an additional penultimate tryptophan (EBA175L/W-tail). Carboxy-terminal negatively charged residues are shown in bold, and the penultimate tryptophan is boxed. (B) Generation of the TRAP tail mutations by insertional replacement. The WT TRAP genomic locus is targeted with a SpeI-linearized insertion plasmid containing a 5' truncation of the TRAP open reading frame, the corresponding tail swaps, the 3' untranslated region of DHFR/TS, and the dhfr/ts positive selectable marker. Upon a single-crossover event, the region of homology is duplicated, resulting in a 5' copy with the functional TRAP swap mutant and a nonfunctional 3' mutant that lacks the promoter and the start codon. Integration-specific test primer combinations are indicated by arrows, and expected fragments are shown as lines. (C) The successful integration event in the resistant parasite population is confirmed by insertion-specific primer combinations.

The TRAP tail fusion genes were introduced into WT parasites by insertional replacement (Fig. 3B). The targeting plasmids are predicted to insert by a single-crossover event, resulting in a 5' functional copy that contains the desired TRAP fusion protein under the control of the endogenous TRAP promoter and a 3' copy that lacks the promoter and start codon and hence is not expressed. The successful integration events were confirmed in the clonal parasite populations by insertion-specific PCR amplification (Fig. 3C). The clonal-swap parasite populations were transmitted to Anopheles stephensi mosquitoes and assessed for their capacity to form oocysts and viable midgut sporozoites (Table 1). As expected, no differences were observed between the swap parasites. Functional production of midgut sporozoites permitted testing for proper expression of the PbTRAP fusion proteins in Western blot analysis (Fig. 4). All parasites produced comparable amounts of the PbTRAP protein.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Phenotypes of TRAP tail swap parasites


Figure 4
View larger version (55K):
[in this window]
[in a new window]

 
FIG. 4. Western blot analysis of TRAP tail swap parasites. Midgut sporozoite extracts from 100,000 WT or mutant sporozoites were separated on a 10% SDS gel and probed with polyclonal anti-PbTRAP-repeat serum ({alpha}-TRAP) and monoclonal anti-PbCSP antibodies.

Phenotypic analysis of the TRAP swap sporozoites enabled us to identify TRAP family members based on functional criteria (Table 1). As expected, the mutant that contained a CTD truncation lacks the capacities to invade mosquito salivary glands and to induce a patent blood-stage infection in rats (16). Replacement of the P. berghei TRAP CTD with the corresponding P. falciparum TRAP region resulted in viable sporozoites that invade salivary glands comparably to the WT. When tested for infectivity of the mammalian host in vitro or in vivo, PfTRAP sporozoites are as infectious as the WT.

As predicted, the PfCTRP parasites were infectious in the mammalian host in numbers comparable to those of the PfTRAP parasites. Although infectivity of mosquito salivary glands was reduced in PfCTRP parasites, they were evidently capable of invasion (Table 1). Similarly, PbTLP parasites showed a reduced rate of invasion of salivary glands. While liver-stage development in vitro was intermediate between WT parasites and a negative control with a large deletion of the major portion of the tail ({Delta}tail parasites), inoculation with PbTLP swap mutants consistently resulted in substantial numbers of mature liver-stage parasites and patent animals when injected in vivo (Table 1).

Notably, both versions of the PfEBA175 CTDs failed to complement the PbTRAP deletion. This finding excludes a potential role of EBA175 in a TRAP-related step during invasion by providing a direct link to the parasite motor. Most importantly, the failure of the PfEBA175L/W mutant (containing an additional penultimate tryptophan) to complement the PbTRAP CTD indicates that presence of a penultimate tryptophan and a carboxy-terminal acidic cluster, while necessary, is not sufficient for a direct function in parasite motility. We conclude that the CTDs of CTRP and TLP complement TRAP functions, albeit not as well as TRAP. Therefore, both proteins are functional members of the TRAP family in addition to their overall structural relationship.

TLP is expressed in blood-stage parasites and sporozoites. The functional characterization of TLP as a third TRAP family member in Plasmodium prompted us to determine its expression in the Plasmodium life cycle. We first tested expression of P. berghei TLP in sporozoites and late-blood-stage parasites by RT-PCR (Fig. 5A). In contrast to PbTRAP (29) and PbCTRP (5, 30), PbTLP is expressed in multiple stages, indicating a shared function between sporozoites and merozoites. We next examined the expression profiling of the P. yoelii ortholog during erythrocytic schizogony by quantitative real-time RT-PCR (Fig. 5B). PyTLP is apparently under stage-specific expression control and highly upregulated in schizonts, the stage preceding infectious merozoites.


Figure 5
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 5. Expression of TLP in invasive stages. (A) RT-PCR from poly(A)+ RNA of gradient-purified schizonts and salivary gland sporozoites of P. berghei using primers specific for PbTLP and, as a positive control, P. berghei merozoite capping protein 1 (PbMCP1). RT, reverse transcriptase; SPZ., sporozoites; BS, blood stages. (B) Quantitative real-time RT-PCR of P. yoelii MSP1 (white boxes) and PyTLP (gray boxes) using RNA from synchronized ring stages (Rings), early trophozoites (8 h) (Early T.), midstage trophozoites (12 h) (Mid T.), late trophozoites (16 h) (Late T.), and schizont (Schiz.) as a template. Change in gene expression levels is shown as mean values (± standard deviations) of stage-specific signal divided by the mean signal of the pooled RNA samples (pool). (C) RT-PCR from poly(A)+ RNA of synchronized P. falciparum blood stages (ring stages, trophozoites, and schizonts) with two pairs of gene-specific primers for PfTLP and primers for PfAMA1 (apical membrane antigen 1), PfMSP7 (merozoite surface protein 7), and PfACT1 (actin 1) as controls.

To exclude potential minor contamination with sexual blood-stage parasites, we extended our expression analysis to P. falciparum strains (strains HB3 and 3D7) that both lost their ability to form gametocytes in vitro. We synchronized P. falciparum parasites and generated total cDNA of highly purified ring, trophozoite, and schizont stages (Fig. 5C). Similar to that of transcripts that function in merozoite invasion (PfAMA1 and PfMSP7 [23]), PfTLP expression commences in schizonts, corroborating our expression data from the rodent parasites. Together our data demonstrate expression of TLP in multiple invasive stages of rodent and human Plasmodium parasites and specific upregulation prior to merozoite invasion.

TLP is dispensable for Plasmodium life cycle progression. To test whether TLP is important for asexual replication of P. berghei, we first targeted the PbTLP gene with an integration vector that disrupts the gene locus via a single-crossover event (data not shown). Several attempts to disrupt the gene were not successful, while an integration control that recovered the WT TLP copy yielded recombinant parasites (data not shown). To distinguish between an essential function and difficulties in targeting the gene, we constructed a replacement vector containing the PbTLP 5' and 3' untranslated regions that flank the positive selection marker cassette (Fig. 6A). Upon a double-crossover event, this vector is predicted to delete the entire PbTLP locus. After transfection and continuous selection with the antifolate pyrimethamine, we obtained a parental population that was used for single parasite cloning. Genotyping of two independent clonal parasite lines verified the correct gene replacement event (Fig. 6B). To further confirm the absence of TLP transcripts in the tlp parasites, we performed RT-PCR of cDNAs generated from blood-stage mutant and WT parasite poly(A)+ RNA (Fig. 6C). As predicted, no TLP transcripts were detected in the knockout parasites, while it was readily detectable in WT parasites. The successful generation of TLP-deficient parasites demonstrates that this gene is not essential during the pathogenic blood-stage cycle in vivo.


Figure 6
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 6. Targeted disruption of PbTLP. (A) Replacement strategy to generate tlp parasites. The WT TLP genomic locus is targeted with a KpnI/SacII-linearized replacement plasmid (pREP) containing 5' and 3' untranslated regions adjacent to the TLP open reading frame and the dhfr/ts positive selectable marker. Upon a double-crossover event, the open reading frame is replaced by the selectable marker. Replacement-specific test and WT primer combinations are indicated by arrows and expected fragments as lines. (B) Replacement-specific PCR analysis. The successful replacement event is verified by primer combination (test 1 and test 2) that can amplify only a signal from the REP locus. Absence of the WT signal from tlp parasites confirms the purity of the clonal population. (C) Absence of TLP transcripts in tlp parasites. cDNA from WT or tlp late-blood-stage parasites was amplified in the presence (+) or absence (–) of reverse transcriptase (RT) with two TLP-specific primer combinations (WT1 and WT2). As loading controls, RT-PCRs with myosin A (MyoA)- and merozoite surface protein 1 (MSP1)-specific primers were added. gDNA, wild-type genomic DNA.

We extended our in vivo analysis to the entire parasite life cycle and tested sporozoite formation and maturation in the Anopheles vector and transmission to the mammalian host (Table 2). Natural transmission experiments by blood-feeding of tlp-parasite-infected Anopheles mosquitoes on malaria-naive rats revealed normal completion of the life cycle, indistiguishable from that of WT parasites. Quantification of sporozoite numbers in midgut-associated oocysts and salivary glands, the final target organ in the mosquito, yielded similar numbers for tlp and WT parasites. Mature, salivary gland-associated sporozoites displayed continuous gliding locomotion, albeit at a lower frequency, and full in vitro and in vivo infectivity in cultured hepatoma cells and when injected intravenously into rats, respectively. Together, these findings show that TLP does not play an essential role at any stage of the malaria parasite life cycle.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Phenotypes of tlp parasites


arrow
DISCUSSION
 
The most important physiological function of TRAP family invasins is to drive parasite motility and host cell entry (16). The identification of the merozoite invasin that links the actomyosin motor machinery to the merozoite surface ligands would set the stage for novel intervention strategies that specifically target merozoite entry into host erythrocytes. Toward the identification of this missing link in the Plasmodium life cycle, we combined two approaches, in vitro binding to aldolase (14) and genetic complementation of the PbTRAP tail (16), which together permit the systematic identification of candidate proteins that link an extracellular recognition event to the intracellular parasite motor complex.

Examination of the P. falciparum genome database (9) revealed the presence of a previously unidentified TRAP-like protein in addition to the sporozoite and ookinete invasins TRAP and CTRP, respectively. While the Plasmodium genomes harbors numerous proteins that contain thrombospondin repeats, such as SPATR (17), TRSP (15, 19), PTRAMP (31), and MTRAP (2), only TLP shares all unifying structural features of TRAP family invasins, i.e., the combined presence of A domains and TSRs in their ectodomain and a conserved cytoplasmic tail domain (Fig. 2A). The TSR contains the typical amino-terminal WSxW tetrapeptide and carboxy-terminal basic residues that are separated by two invariant cysteines (Fig. 2B). A domains contain metal ion-dependent adhesion sites (MIDAS) that are implicated in ligand binding (20, 24). Of the invariant residues that coordinate the central divalent cation, the two flanking aspartates and the central threonine are conserved (Fig. 2C). Notably, only one of generally two serines is present in the amino-terminal DxSxS sequence. We also noticed the presence of a second region between amino acids 48 and 267 of PfTLP that might constitute an unconventional A domain. Biochemical approaches are required to test the adhesive properties of this region in comparison to the conventional A domain. In addition to the two well-characterized adhesion modules, TLP contains a sizeable portion, termed "charged region," between the A domain and the type I transmembrane span that displays an unusually high content of lysine, arginine, glutamic acid, and aspartic acid residues. The carboxy-terminal domain of TLP contains the penultimate tryptophan and a cluster of negatively charged residues (Fig. 2D), which, in the case of TRAP, drive parasite motility (16).

By two independent assays, in vitro aldolase binding of the recombinant CTD and a reverse-genetics strategy, we functionally identified TLP as a third Plasmodium member of this protein family. The CTD of TLP carries key residues that are shared by members of the TRAP family. This region can partially complement TRAP functions during sporozoite invasion of mosquito salivary glands and hepatocytes. Similarly, the CTD of the ookinete invasin CTRP can functionally replace the TRAP tail. Functional assignment of CTRP to the TRAP family was predicted, since ctrp ookinetes no longer traverse the mosquito midgut and do not display productive motility (5, 30). It will be interesting to test whether MTRAP, which was previously shown to likely exert a vital function during in vitro growth of P. falciparum blood stages (2), can complement the TRAP tail. To date, the bridging protein of the motor machinery used by the malaria merozoite to propel itself into the host erythrocyte remains unknown, although biochemical evidence suggests a potential, specific role for MTRAP in this process (2).

In this study, we provide evidence from independent approaches that TLP is a member of the growing family of TRAP invasins. Although the precise role of aldolase in bridging the CTDs of invasins to microfilaments remains to be determined, in vitro binding to aldolase is a hallmark of members of the TRAP family and a valuable predictor for a role in motility and invasion (4, 14). That efficient interaction of the CTD of TLP with aldolase is relevant in vivo is corroborated by our finding that this region can partially complement TRAP functions in sporozoites. Previously it was shown that the TRAP CTD substitutes for the unrelated cytoplasmic domain of EBA-175, one of several members of the erythrocyte binding ligand family (10). Using the TRAP tail swap approach, we establish that EBA-175 does not complement TRAP functions. This finding contrasts with the reverse experiment, i.e., complementation of the EBA175 carboxy-terminal domain by TRAP (10), and raises the interesting possibility that TLP and/or MTRAP and EBA-175 act in concert, probably through TLP/MTRAP-dependent recruitment of EBA-175 to the invasion machinery. We can now test this hypothesis by studying biochemical interactions between the proteins and by genetic replacement of the cytoplasmic tail encoded by EBA-175 with the corresponding regions of TLP and/or MTRAP. Similarly, another merozoite ligand, termed PTRAMP, may play a yet-undefined role during invasion (31). This protein contains neither an A domain nor the CTD of the TRAP family of invasins, and it presumably plays a vital role in blood stages (31).

Based on our data, we propose that TLP interacts with the actin-bridging molecule aldolase in invading-parasite stages and plays a redundant role in linking target cells and parasite ligands to the actin-myosin motor machinery. In analogy to TRAP, the prototype of this family of proteins, TLP secretion may be precisely regulated and may occur only after initial target cell contact (8). The presence of TLP in all stages tested suggests a conserved, albeit not essential, function that is shared in all life cycle stages. Our expression data are further supported by the presence of PyTLP in a sporozoite expressed-sequence-tag library (17) and a cDNA library generated from axenic liver stages (36). Indeed, abundant expression of known merozoite ligands in sporozoites has been described for AMA1 and EBA175 (11, 28), suggesting that merozoites and sporozoites, which both invade via simultaneous formation of a parasitophorous vacuole, share multiple surface ligands.

Our finding that a previously unrecognized TRAP family member performs a redundant role in parasite life cycle progression suggests that parasite motility and host cell entry are driven by a more complex and partially redundant group of transmembrane and surface proteins than previously anticipated.


arrow
ACKNOWLEDGMENTS
 
We particularly acknowledge Victor Nussenzweig (NYU) and Louis Miller (NIH) for continuous critical discussions. We thank Na Zhou, Andreas Kunze, Ann-Kristin Müller, and Markus Ganter for expert assistance.

This work was supported by grants from the NIH (AI48226) to L.W.B. and the research focus "Tropical Medicine Heidelberg," a junior grant (no. 190/2002) from the Medical Faculty of Heidelberg University, the European Commission (BioMalPar, no. 23), the Joachim Siebeneicher Foundation, and the Chica and Heinz Schaller Foundation to K.M.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address for L. W. Bergman: Drexel University College of Medicine, Center for Molecular Parasitology, Department of Microbiology and Immunology, Philadelphia, PA 19129. Phone: (215) 991-8376. Fax: (215) 848-2271. E-mail: Lawrence.Bergman{at}DrexelMed.edu. Mailing address for K. Matuschewski: Heidelberg University School of Medicine, Department of Parasitology, Im Neuenheimer Feld 324, 69120 Heidelberg, Germany. Phone: 49-6221-568284. Fax: 49-6221-564643. E-mail: Kai.Matuschewski{at}med.uni-heidelberg.de Back

{triangledown} Published ahead of print on 25 April 2008. Back


arrow
REFERENCES
 
    1
  1. Baum, J., A. T. Papenfuss, B. Baum, T. P. Speed, and A. F. Cowman. 2006. Regulation of apicomplexan actin-based motility. Nat. Rev. Microbiol. 4:621-628.[CrossRef][Medline]
  2. 2
  3. Baum, J., D. Richard, J. Healer, M. Rug, Z. Krnajski, T.-W. Gilberger, J. L. Green, A. A. Holder, and A. F. Cowman. 2006. A conserved molecular motor drives cell invasion and gliding motility across malaria life cycle stages and other apicomplexan parasites. J. Biol. Chem. 281:5197-5208.[Abstract/Free Full Text]
  4. 3
  5. Bergman, L. W., K. Kaiser, H. Fujioka, I. Coppens, T. M. Daly, S. Fox, K. Matuschewski, V. Nussenzweig, and S. H. I. Kappe. 2003. Myosin A tail domain interacting protein (MTIP) localizes to the inner membrane complex of Plasmodium sporozoites. J. Cell Sci. 116:39-49.[Abstract/Free Full Text]
  6. 4
  7. Buscaglia, C. A., I. Coppens, W. G. Hol, and V. Nussenzweig. 2003. Sites of interaction between aldolase and thrombospondin-related anonymous protein in Plasmodium. Mol. Biol. Cell 14:4947-4957.[Abstract/Free Full Text]
  8. 5
  9. Dessens, J. T., A. L. Beetsma, G. Dimopoulos, K. Wengelnik, A. Crisanti, F. C. Kafatos, and R. E. Sinden. 1999. CTRP is essential for mosquito infection by malaria ookinetes. EMBO J. 18:6221-6227.[CrossRef][Medline]
  10. 6
  11. Dobrowolski, J. M., and L. D. Sibley. 1996. Toxoplasma invasion of mammalian cells is powered by the actin cytoskeleton of the parasite. Cell 84:933-939.[CrossRef][Medline]
  12. 7
  13. Frevert, U., S. Engelmann, S. Zougbédé, J. Stange, B. Ng, K. Matuschewski, L. Liebes, and H. Yee. 2005. Intravital observation of Plasmodium berghei sporozoite infection of the liver. PLoS Biol. 3:e192.[CrossRef][Medline]
  14. 8
  15. Gantt, S., C. Persson, K. Rose, A. J. Birkett, R. Abagayan, and V. Nussenzweig. 2000. Antibodies against TRAP do not inhibit Plasmodium sporozoite infectivity in vivo. Infect. Immun. 68:3667-3673.[Abstract/Free Full Text]
  16. 9
  17. Gardner, M. J., N. Hall, E. Fung, O. White, M. Berriman, R. W. Hyman, J. M. Carlton, A. Pain, K. E. Nelson, S. Bowman, I. T. Paulsen, K. James, J. A. Eisen, K. Rutherford, S. L. Salzberg, A. Craig, S. Kyes, M. S. Chan, V. Nene, S. J. Shallom, B. Suh, J. Peterson, S. Anguoli, M. Pertea, J. Allen, J. Selengut, D. Haft, M. W. Mather, A. B. Vaidya, D. M. Martin, A. H. Fairlamb, M. J. Fraunholz, D. S. Roos, S. A. Ralph, G. I. McFadden, L. M. Cummings, G. M. Subramanian, C. Mungall, J. C. Venter, D. Carucci, S. L. Hoffman, C. Newbold, R. W. Davis, C. M. Fraser, and B. Barrell. 2002. Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419:498-511.[CrossRef][Medline]
  18. 10
  19. Gilberger, T.-W., J. K. Thompson, M. B. Reed, R. T. Good, and A. F. Cowman. 2003. The cytoplasmic domain of the Plasmodium falciparum ligand EBA-175 is essential for invasion but not protein trafficking. J. Cell Biol. 162:317-327.[Abstract/Free Full Text]
  20. 11
  21. Grüner, A. C., K. Brahimi, F. Letourneur, L. Renia, W. Eling, G. Snounou, and P. Druilhe. 2001. Expression of erythrocyte-binding antigen 175 in sporozoites and liver stages of Plasmodium falciparum. J. Infect. Dis. 184:892-897.[CrossRef][Medline]
  22. 12
  23. Huynh, M. H., and V. B. Carruthers. 2006. Toxoplasma MIC2 is a major determinant of invasion and virulence. PLoS Pathog. 2:e84.[CrossRef][Medline]
  24. 13
  25. Janse, C. J., B. Franke-Fayard, G. R. Mair, J. Ramesar, C. Thiel, S. Engelmann, K. Matuschewski, G. J. van Gemert, R. W. Sauerwein, and A. P. Waters. 2006. High efficiency transfection of Plasmodium berghei facilitates novel selection procedures. Mol. Biochem. Parasitol. 145:60-70.[CrossRef][Medline]
  26. 14
  27. Jewett, T. J., and L. D. Sibley. 2003. Aldolase forms a bridge between cell surface adhesins and the actin cytoskeleton in apicomplexan parasites. Mol. Cell 11:885-894.[CrossRef][Medline]
  28. 15
  29. Kaiser, K., K. Matuschewski, N. Camargo, J. Ross, and S. H. Kappe. 2004. Differential transcriptome profiling identifies Plasmodium genes encoding pre-erythrocytic stage-specific proteins. Mol. Microbiol. 51:1221-1232.[CrossRef][Medline]
  30. 16
  31. Kappe, S., T. Bruderer, S. Gantt, H. Fujioka, V. Nussenzweig, and R. Ménard. 1999. Conservation of a gliding motility and cell invasion machinery in apicomplexan parasites. J. Cell Biol. 147:937-943.[Abstract/Free Full Text]
  32. 17
  33. Kappe, S. H. I., M. J. Gardner, S. M. Brown, J. Ross, K. Matuschewski, J. M. Ribeiro, J. H. Adams, J. Quakenbusch, J. Cho, D. J. Carucci, S. L. Hoffman, and V. Nussenzweig. 2001. Exploring the transcriptome of the malaria sporozoite stage. Proc. Natl. Acad. Sci. USA 98:9895-9900.[Abstract/Free Full Text]
  34. 18
  35. Kappe, S. H. I., C. A. Buscaglia, L. W. Bergman, I. Coppens, and V. Nussenzweig. 2004. Apicomplexan gliding motility and host cell invasion: overhauling the motor model. Trends Parasitol. 20:13-16.[CrossRef][Medline]
  36. 19
  37. Labaied, M., N. Camargo, and S. H. Kappe. 2007. Depletion of Plasmodium berghei thrombospondin-related sporozoite protein reveals a role in host cell entry by sporozoites. Mol. Biochem. Parasitol. 153:158-166.[CrossRef][Medline]
  38. 20
  39. Lee, J.-O., P. Rieu, M. A. Arnout, and R. Liddington. 1995. Crystal structure of the A domain from the alpha subunit of integrin CR3 (CD11b/CD18). Cell 80:631-638.[CrossRef][Medline]
  40. 21
  41. Matuschewski, K., and H. Schüler. 2008. Actin/myosin-based gliding motility in apicomplexan parasites, p. 110-120. In B. Burleigh and D. Soldati-Favre (ed.), Molecular mechanisms of parasite invasion. Springer, Heidelberg, Germany.
  42. 22
  43. Meissner, M., D. Schlüter, and D. Soldati. 2002. Role of Toxoplasma gondii myosin A in powering parasite gliding and host cell invasion. Science 298:837-840.[Abstract/Free Full Text]
  44. 23
  45. Mello, K., T. M. Daly, C. A. Long, J. M. Burns, and L. W. Bergman. 2004. Members of the merozoite surface protein 7 family with similar expression patterns differ in ability to protect against Plasmodium yoelii malaria. Infect. Immun. 72:1010-1018.[Abstract/Free Full Text]
  46. 24
  47. Michishita, M., V. Videm, and M. A. Arnaout. 1993. A novel divalent cation-binding site in the A domain of the b2 integrin CR3 (CD11b/CD18) is essential for ligand binding. Cell 72:857-867.[CrossRef][Medline]
  48. 25
  49. Opitz, C., M. Di Christina, M. Reiss, T. Ruppert, A. Crisanti, and D. Soldati. 2002. Intramembrane cleavage of microneme proteins at the surface of the apicomplexan parasite Toxoplasma gondii. EMBO J. 21:1577-1585.[CrossRef][Medline]
  50. 26
  51. Schüler, H., and K. Matuschewski. 2006. Plasmodium motility: actin not actin' like actin. Trends Parasitol. 22:146-147.[CrossRef][Medline]
  52. 27
  53. Sibley, L. D. 2004. Intracellular parasite invasion strategies. Science 304:248-253.[Abstract/Free Full Text]
  54. 28
  55. Silvie, O., J.-F. Franetich, S. Charrin, M. S. Mueller, A. Siau, M. Bodescot, E. Rubinstein, L. Hannoun, Y. Charoenvit, C. H. Kocken, A. W. Thomas, G. J. van Gemert, R. W. Sauerwein, M. J. Blackman, R. F. Anders, G. Pluschke, and D. Mazier. 2004. A role for apical membrane antigen 1 during invasion of hepatocytes by Plasmodium falciparum sporozoites. J. Biol. Chem. 279:9490-9496.[Abstract/Free Full Text]
  56. 29
  57. Sultan, A. A., V. Thathy, U. Frevert, K. J. Robson, A. Crisanti, V. Nussenzweig, R. S. Nussenzweig, and R. Ménard. 1997. TRAP is necessary for gliding motility and infectivity of Plasmodium sporozoites. Cell 90:511-522.[CrossRef][Medline]
  58. 30
  59. Templeton, T. J., D. C. Kaslow, and D. A. Fidock. 2000. Developmental arrest of the human malaria parasite Plasmodium falciparum within the mosquito midgut via CTRP gene disruption. Mol. Microbiol. 36:1-9.[CrossRef][Medline]
  60. 31
  61. Thompson, J., R. E. Cooke, S. Moore, L. F. Anderson, C. J. Janse, and A. P. Waters. 2004. PTRAMP; a conserved Plasmodium thrombospondin-related apical merozoite protein. Mol. Biochem. Parasitol. 134:225-232.[CrossRef][Medline]
  62. 32
  63. Tsuji, M., D. Mattei, R. S. Nussenzweig, D. Eichinger, and F. Zavala. 1994. Demonstration of heat-shock protein 70 in the sporozoite stage of malaria parasites. Parasitol. Res. 80:16-21.[CrossRef][Medline]
  64. 33
  65. Tucker, R. P. 2004. The thrombospondin type 1 repeat superfamily. Int. J. Biochem. Cell. Biol. 36:969-974.[CrossRef][Medline]
  66. 34
  67. Urban, S., and M. Freeman. 2003. Substrate specificity of rhomboid intramembrane proteases is governed by helix-breaking residues in the substrate transmembrane domain. Mol. Cell 11:1425-1434.[CrossRef][Medline]
  68. 35
  69. Vlachou, D., T. Zimmermann, R. Cantera, C. J. Janse, A. P. Waters, and F. Kafatos. 2004. Real-time, in vivo analysis of malaria ookinete locomotion and mosquito midgut invasion. Cell. Microbiol. 6:671-685.[CrossRef][Medline]
  70. 36
  71. Wang, Q., S. Brown, D. S. Roos, V. Nussenzweig, and P. Bhanot. 2004. Transcriptome of axenic liver stages of Plasmodium yoelii. Mol. Biochem. Parasitol. 137:161-168.[CrossRef][Medline]
  72. 37
  73. Whittaker, C. A., and R. O. Hynes. 2002. Distribution and evolution of von Willebrand/integrin A domains: widely dispersed domains with roles in cell adhesion and elsewhere. Mol. Biol. Cell 13:3369-3387.[Abstract/Free Full Text]


Eukaryotic Cell, June 2008, p. 1062-1070, Vol. 7, No. 6
1535-9778/08/$08.00+0     doi:10.1128/EC.00089-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Heiss, K.
Right arrow Articles by Matuschewski, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Heiss, K.
Right arrow Articles by Matuschewski, K.