Previous Article | Next Article ![]()
Eukaryotic Cell, April 2008, p. 619-629, Vol. 7, No. 4
1535-9778/08/$08.00+0 doi:10.1128/EC.00048-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Paola Catanuto,1,
Flavia Fontanesi,2,3
Carmen Rios,1
Natalie Sanchez,1
Antoni Barrientos,2,3 and
Fulvia Verde1*
Department of Molecular and Cellular Pharmacology,1 Department of Neurology and Department of Biochemistry and Molecular Biology,2 The John T. MacDonald Center for Medical Genetics, University of Miami School of Medicine, P.O. Box 016129, Miami, Florida 33101-61293
Received 19 February 2007/ Accepted 12 December 2007
|
|
|---|
mutant cells expressing lower levels of Bot1p display altered cell size and cell morphology and a disrupted actin cytoskeleton. Bot1p localizes to the mitochondria in live cells and cofractionates with purified mitochondrial ribosomes. Reduced levels of Bot1p lead to mitochondrial fragmentation, decreased mitochondrial protein translation, and a corresponding decrease in cell respiration. Overexpression of Bot1p results in cell cycle delay, with increased cell size and cell length and enhanced cell respiration rate. Our results show that Bot1p has a novel function in the control of cell respiration by acting on the mitochondrial protein synthesis machinery. Our observations also indicate that in fission yeast, alterations of mitochondrial function are linked to changes in cell cycle and cell morphology control mechanisms. |
|
|---|
The fission yeast Schizosaccharomyces pombe has been extensively used as a powerful genetic model organism for studying the molecular mechanisms of morphology and cell cycle control. S. pombe is a rod-shaped cell that grows in a polarized fashion at its extremities and divides by medial fission. Polarized growth is cell cycle regulated (30). In early G2 phase, cells grow in a monopolar fashion at their old ends, and later in G2, they switch to bipolar growth (new-end takeoff) (30). When cells reach a critical size, growth ceases and cells enter mitosis (reviewed in references 25 and 45). The regular rod shape of S. pombe cells allows ready identification of morphological defects and has been used to isolate morphological and/or cell polarity mutants mainly by visual screening (38, 41). These mutants led to the identification of numerous cell functions involved in the regulation of cell morphology in fission yeast (5, 25).
Mitochondria host many intermediary metabolism reactions as well as the electron transport chain and oxidative phosphorylation system pathways required for the aerobic synthesis of ATP. Mitochondrial biogenesis requires the contribution of two genomes and of two compartmentalized protein synthesis systems (nuclear and mitochondrial). Only a small portion of the structural subunits (seven in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe) that form the respiratory complexes are encoded on the mitochondrial DNA (mtDNA). The mtDNA also encodes two rRNAs, for a set of 25 tRNAs and for some mitochondrial ribosome proteins, including Rps3 in the case of S. pombe (4). Mitochondria are semiautonomous organelles containing their own independent translational machinery. A large number of nuclear genes code for components of the mitochondrial protein synthetic system, including ribosomal proteins, aminoacyl-tRNA synthetases, and initiation, elongation, and termination factors (33, 40). Nuclear genes also code for proteins that function in biogenesis of the translational machinery rather than in translation itself (2, 9, 37). In S. pombe mitochondrial protein translation is regulated by the guanine nucleotide exchange factor EF-Ts, conserved in higher eukaryotes, which controls the translation elongation factor EF-Tu (7). S. pombe is a petite-negative yeast and, similarly to mammalian cells, cannot survive the loss of mtDNA and mitochondrial protein synthesis (36).
Mitochondria are not isolated organelles and form a dynamic reticulum that changes structure and localization in response to the metabolic state of the cell. In fission yeast mitochondrial movement and distribution are mediated by the microtubule cytoskeleton, as is also observed in mammalian cells (16, 43, 46, 47). Recent evidence has shown that mitochondria are an integral part of several signal transduction cascades involved in metabolism, cell cycle control, and differentiation (reviewed in references 6 and 29). In this respect, studies with S. cerevisiae and human cells have suggested that some of the mitochondrial ribosomal proteins may have additional functions in the control of cell metabolism and growth (13, 29).
In this paper we present the characterization of a novel protein that we named Bot1p. bot1 is a gene that is essential for cell viability. bot1
mutant cells expressing lower levels of Bot1p display an altered cell morphology and cell size and an alteration of the actin cytoskeleton. We demonstrate that Bot1p localizes to the mitochondrial ribosome and that decreased levels of Bot1p lead to mitochondrial network fragmentation, decreased cell respiration, and decreased mitochondrial protein translation, indicating that Bot1p function is essential for mitochondrial protein synthesis.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Genotypes and sources of yeast strains
|
![]() View larger version (87K): [in a new window] |
FIG. 1. Phenotype of a bot1 null mutant strain. A diploid strain (FV805) carrying a null mutation of bot1 was exposed to sporulation conditions. Tetrads were dissected on yeast extract plates, and spores were allowed to germinate at 32°C. Cells micromanipulated from a bot1+ colony (a) and whole bot1 mutant cell colonies (b and c) at the indicated times are shown. WT, wild type. Bar, 5 µm.
|
Immunofluorescence microscopy. Cells in liquid cultures were grown exponentially for at least eight generations, at densities below 107 cells/ml, before the start of the experiment. Immunofluorescence was performed as described previously (31). For actin and microtubule staining, we used AlexaFluor 488 phalloidin (Molecular Probes), a monoclonal antiactin antibody (Amersham/GE Healthcare, Piscataway, NJ), and a monoclonal antitubulin antibody (TAT1; a kind gift of K. Gull from the Sir William Dunn School of Pathology at the University of Oxford, Oxford, United Kingdom). We used a CY3-conjugated anti-mouse antibody as a secondary antibody (Sigma, St. Louis, MO). Cells were immobilized on coverslips using phosphate-buffered saline containing antifade (Molecular Probes, Eugene, OR) as mounting medium and photographed using a Zeiss Axiophot microscope equipped with Openlab (Improvision, Lexington, MA) software. To visualize mitochondria, 10 µl of 5 µM MitoTracker Red CMXRos (Molecular Probes) was added to 1 ml of fission yeast cell culture. The cell culture was then incubated at 32°C for 20 to 25 min while shaking. Cells were then visualized as described above.
Cell wall digestion. Cell wall resistance to the β-glucanase Zymolyase was determined as follows. Cells were grown to mid-logarithmic phase in minimal medium at 30°C. At that point cells were harvested, washed in Tris-EDTA buffer, and resuspended at an optical density at 600 nm (OD600) of 1.0 (2 x 107 cells) in the same buffer containing 100 µg/ml β-glucanase (Zymolyase 20T; ICN). Cell suspensions were incubated at 30°C while shaking, and cell lysis was monitored by OD600 measurement (4).
Mitochondrial localization of Bot1p. Mitochondria with intact outer membranes were prepared from cells carrying a copy of bot1-13Myc under the control of the endogenous promoter integrated at the bot1 locus (FV806), following the method of Glick and Pon (15) except that Zymolyase 20T (ICN Biochemicals Inc., Aurora, OH) instead of Glusulase was used for the conversion of cells to spheroplasts. When required, mitochondria suspended at a protein concentration of 8 mg/ml in 0.6 M sorbitol-20 mM HEPES (pH 7.5) were disrupted by sonic irradiation using a VirSonic 100 sonicator at intensity 4 for 5 seconds. Proteinase K was added to 250 µl mitochondrial particle suspensions at a final concentration of 50 µg/ml and incubated for 60 min on ice. The reaction was stopped by addition of phenylmethylsulfonyl fluoride (PMSF) to a final concentration of 2 mM, and the mitochondria were recovered by centrifugation at 100,000 x g. The pellets were suspended in 1x Laemmli buffer (1% sodium dodecyl sulfate, 50 mM Tris-HCl [pH 6.8], 4% glycerol, 0.4% mercaptoethanol). The different protein fractions (40 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 12% polyacrylamide gel, transferred to nitrocellulose, and probed with antibodies against Myc (Abcam)), subunit β of the membrane-associated F1 portion of the F1-F0 ATPase (F1β), and Tom70 (a kind gift of Mike Yaffe, UCSD, San Diego).
Mitochondrial ribosome preparation. Mitochondria with intact outer membranes were prepared by the method of Glick and Pon (15) from strain FV806. Samples of 4 mg of mitochondria were extracted in 400 µl of extraction buffer (20 mM HEPES, 0.5 mM PMSF, 500 mM KCl, 10 mM MgCl2, 2% digitonin) for 30 min in ice. Following a clarifying spin at 21,000 rpm (Beckman TLA110 rotor) for 15 min at 4°C, the supernatant was loaded onto a linear 20 to 40% sucrose gradient (5 ml containing 20 mM HEPES, 0.5 mM PMSF, 500 mM KCl, 10 mM MgCl2, and 0.2% digitonin). The gradient was centrifuged at 28,000 rpm (Beckman SW55Ti rotor) for 8 h at 4°C, and 14 fractions were collected from the bottom. The ribosome profile was obtained by measuring absorbance at 260 nm, and Bot1p-Myc was detected by Western blot analysis using an anti-Myc antibody (Abcam).
Oxygen consumption measurements in whole cells. Endogenous cell respiration was assayed in whole cells in the presence of either 2% glucose or 2% galactose and 0.1% glucose using a Clark-type polarographic oxygen electrode from Hansatech Instruments (Norfolk, United Kingdom) at 25°C as described previously (3). Cell respiration was inhibited with 700 mM potassium cyanide (KCN), a specific inhibitor of cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain. The specific activities reported were corrected for KCN-insensitive respiration.
Mitochondrial protein synthesis in vivo. Mitochondrial protein synthesis was followed in vivo using a method previously established for radiolabeling of mitochondrial products in S. cerevisiae (3), with a few modifications. Briefly, cells were grown to an absorbance of 0.5 at 595 nm (107 cells/ml) in 50 ml of medium containing yeast nitrogen base without amino acids, 2% galactose, and 0.1% glucose. Cells (3 x 107) were harvested, pelleted by centrifugation, washed with 1 ml of 40 mM potassium phosphate (pH 6.0) containing 2% galactose and 0.1% glucose, and resuspended in 500 ml of the same buffer supplemented with 10 mg/ml cycloheximide to inhibit cytoplasmic protein synthesis. The cells were incubated with 6 µl of [35S]methionine at 30°C for 15 min (10 Ci/ml; Amersham/GE Healthcare, Piscataway, NJ). After pulses ranging from 15 min to 2 h, the reactions were terminated by addition of 75 µl of a solution containing 1.8 M NaOH, 1 M β-mercaptoethanol, and 0.01 M PMSF and diluted with 500 µl of H2O. Proteins were precipitated by addition of an equal volume of 50% trichloroacetic acid. The mixture was centrifuged, and the pellet was washed once with 0.5 M Tris base and once with water and resuspended in 30 µl of sample buffer (26). The radiolabeled proteins were separated on a 17.5% polyacrylamide gel, transferred to nitrocellulose, and visualized by overnight exposure on KodaK X-Omat film.
mtDNA visualization.
Cells were fixed with ice-cold methanol, washed and diluted in phosphate-buffered saline, stained with the fluorescent dye 4',6'-diamidino-2-phenylindole (DAPI), and visualized under a fluorescence microscope after excitation with UV light. To detect loss of mtDNA, total DNA was purified from wild-type and bot1
cells and digested overnight with the restriction enzyme HindIII. The DNA was separated on an agarose gel and transferred to a nitrocellulose membrane. The membrane was hybridized sequentially with two different probes, which spanned the N-terminal 1,000-bp fragment of the mitochondrial cox1 gene (forward primer, ATGAACTCTTGGTGGACTTATGTTAATAGA; reverse primer, ATTTTTTAGTTAAAAGAGGGAATTGATCAA) and the complete ORF of the nuclear rga4 gene (forward primer, AATTGTCGACATGAATTCGGGTACGACACT; reverse primer, TAACCCGGGGATCCGGGCAAAGACTTCATGTACATG).
Pharmacological inhibition of the mitochondrial respiratory chain. To test whether the cell morphology defect observed in bot1 mutants was the result of the respiratory defect presented by the mutant cells, we created a pharmacological model of a respiratory-deficient strain. To create the model, wild-type cells were treated with 160 µM KCN, an inhibitor of cytochrome c oxidase, for 8, 24, and 48 h; stained with Calcofluor; and then observed under the microscope.
Miscellaneous procedures. Standard procedures were used for the preparation and ligation of DNA fragments and for transformation and recovery of plasmid DNA from Escherichia coli (28). Proteins were separated by polyacrylamide gel electrophoresis in the buffer system of Laemmli (26), and Western blots were treated with antibodies against the appropriate proteins followed by a second reaction with anti-rabbit immunoglobulin G conjugated to horseradish peroxidase (Sigma, St. Louis, MO). The SuperSignal chemiluminescent substrate kit (Pierce, Rockford, IL) was used for the final detection. Protein concentrations were estimated by the procedure of Lowry et al. (27).
|
|
|---|
cells stop dividing and display a rounded or bottle-shaped form 48 h after germination (Fig. 1c), while the wild-type cells form a colony of normal size (cells micromanipulated away from the colony are shown in Fig. 1a). These findings indicate that Bot1p is essential and that loss of Bot1p leads to an abnormal and characteristic cell shape.
To analyze the effects of loss of Bot1p, we integrated one copy of bot1+ under the control of the thiamine-repressible nmt1 promoter in the bot1
strain (FV808). Addition of thiamine to the growth medium represses the activity of the nmt1 promoter (12, 31). When the promoter is active in medium lacking thiamine, bot1
cells are viable (Fig. 2A, panel b) and are similar in shape and growth rate to the control 972 cells (Fig. 2A, panel a). The shape of bot1
cells begins to change 24 h after thiamine addition at 32°C, as cells become shorter, growing mostly from one end (Fig. 2A, panel c). After 44 h of culture in medium containing thiamine, 70% of all cells display some form of morphological abnormality, generally appearing longer than normal (2.1-fold the average length of wild-type cells; n = 60) and swollen at one end or in the middle. bot1
cells are rounded or bottle shaped and generally grow with one tip only (Fig. 2A, panel d) (the old end, as deduced by observing pairs of daughter cells [not shown]). When Calcofluor is used to assess cell wall deposition, 78% of the cells are found to grow with one tip and 13% with two tips, while 4% are still dividing. Thus, most cells still grow in a polarized fashion, while 5% of the cells are completely round at this point (n = 200). These cells display a phenotype very similar to the one observed following germination of the bot1
strain (Fig. 1b and c).
![]() View larger version (48K): [in a new window] |
FIG. 2. bot1+ gene dosage effects on cell morphology. (A) bot1 cells containing integrated bot1+ under the control of the nmt1 promoter (FV808) were grown exponentially for at least eight generations at 32°C, prior to addition of thiamine to the culture. Cells were fixed at the appropriate times and stained with Calcofluor to visualize the cell wall (a to d), stained with DAPI to visualize the cell nucleus (e to h), or treated with antitubulin (panels i to l) and antiactin (m to p) antibodies. Panels a, e, i, and m, 972 wild-type (WT) control cells. Panels b, f, j, and n, bot1 pJKnmt1-bot1+ cells grown in the absence of thiamine. Panels c, g, k, and o, bot1 pJKnmt1-bot1+ cells, 26 h after addition of 5 µg/ml thiamine. Panels d, h, l, and p, bot1 pJKnmt1-bot1+ cells, 44 h after thiamine addition. Bars, 5 µm. (B) Decreased Bot1p levels lead to an alteration of cell wall structure. Control wild-type cells and bot1 cells expressing Bot1p, grown in the absence of thiamine or in the presence of thiamine for 48 h at 32°C, were digested with Zymolyase for the indicated times. Cell lysis was quantified by OD600 and expressed as a ratio to the initial value at the beginning of the experiment. Error bars indicate standard deviation values obtained from three independent experiments.
|
Finally, since loss of Bot1p leads to an abnormal cell shape and an alteration of the actin cytoskeleton, we asked whether other morphological parameters are altered in bot1
mutants. We found that bot1
mutant cells expressing low levels of Bot1p (44 h after thiamine addition) are substantially more resistant to digestion by Zymolyase, a 1,3-β-D-glucan hydrolase, than wild-type cells or bot1
cells expressing Bot1p in the absence of thiamine (Fig. 2B). Resistance to Zymolyase digestion suggests an alteration of the β-glucan composition in the walls of cells expressing low levels of Bot1p protein.
Bot1 protein localizes to the mitochondria. The bot1 gene (GenBank accession number AF352796 [GenBank] ; locus SPBC14C8.16c) encodes a novel 315-amino-acid protein. A BLAST search (NCBI) identified homologues in other systems but restricted to fungi (Fig. 3). Among them were one in Saccharomyces cerevisiae (ORF YGR165w; 23% identity and 43% similarity over 270 amino acids of alignment) and one in Candida albicans (Gen Bank accession number XP_714982 [GenBank] .1, locus CaO19.11043 joined to CaP19.11044; 24% identity and 43% similarity over 201 amino acids). The C. albicans and S. cerevisiae homologues are closer in similarity to each other (39% identity and 54% similarity over the whole length) than to S. pombe Bot1p (Fig. 3A). Homologues of Bot1p are also found in other fungi, such as Yarrovia lipolytica, Kluyveromyces lactis, Candida glabrata, Ustilago maidis, and Neurospora crassa. A phylogenetic tree is presented in Fig. 3B. Although the function(s) of these genes is unknown at present, the S. cerevisiae putative homologue, YGR165w, has been identified as a putative component of the small mitochondrial ribosomal subunit by Tag-based affinity purification (TAP)-mediated isolation of yeast mitochondrial ribosomes followed by mass spectrometric analysis and has been named MrpS35p (14).
![]() View larger version (68K): [in a new window] |
FIG. 3. Bot1p is a protein that is conserved in fungi. (A) Sequence comparison of Bot1p and homologous proteins. A Blast homology search using the EMBL and GenBank databases (NCBI) identified the Saccharomyces cerevisiae MRPS35 (YGR165w) product and a Candida albicans protein (XP_714982.1) as two of the homologous to S. pombe Bot1p (AF352796), a protein apparently restricted to fungi. (B) The phylogenetic tree of Bot1p. The phylogram was produced using the ClustalW program at EMBL-EBI.
|
![]() View larger version (40K): [in a new window] |
FIG. 4. Bot1p-GFP localizes to the mitochondria. (A) Subcellular localization of Bot1p-GFP. Strain FV811, which expresses Bot1p fused to GFP at the endogenous levels, was visualized under a fluorescence microscope (Zeiss Axiophot) (a). Prior to observation, the cells were stained with the mitochondrial dye Mitotracker Red CMXRos (Molecular Probes, Eugene, OR) for visualization of mitochondria (b) and with Calcofluor for visualization of the cell wall (c). Bar, 5 µm. (B) Bot1p is localized in a proteinase K-protected mitochondrial compartment. Mitochondria with intact outer membranes were incubated in the presence or absence of proteinase K. The indicated samples were previously sonicated. Bot1-Myc, the subunit β of the membrane-associated F1 portion of the F1-F0 ATPase (F1β), and the mitochondrial outer membrane import receptor Tom70 (19) are visualized. Under these conditions, Tom70, which is anchored to the mitochondrial outer membrane, is digested. Conversely, Bot1p is protected from digestion with proteinase K, similarly to the beta subunit of F1-ATPase, which is located on the mitochondrial inner membrane. Consistent with an internal localization in mitochondria, both Bot1p and F1-β proteins are more sensitive to proteinase K digestion when the mitochondrial external membrane is damaged by sonication. (C) Bot1p comigrates with the small ribosomal subunit. Purified mitochondria were disrupted with 2% digitonin in the presence of 500 mM KCl and 10 mM MgCl, and the soluble contents were separated on a 20 to 40% sucrose gradient. The ribosome profile was obtained by measuring absorbance at 260 nm (bottom panel), and Bot1p-Myc was detected by Western blot analysis with an anti-Myc antibody (top panel). M, mitochondrial fraction; PMS, postmitochondrial supernatant; E, total extract. (D) In vivo labeling of mitochondrial gene products. Left panel, wild-type (wt), FV806, and FV811 cells were labeled with [35S]methionine at 30°C for 20 min in the presence of cycloheximide as described in Materials and Methods. Right panel, quantification of band intensity, expressed as a percentage of the value observed in wild-type cells.
|
The association of Bot1p with the mitochondrial ribosomes suggested that this protein could be involved in mitochondrial protein synthesis. Thus, to test mitochondrial protein translation rates, we followed the incorporation of radioactively labeled [35S]methionine into newly synthesized mitochondrial proteins in the presence of cycloheximide, an inhibitor of cytoplasmic protein synthesis, in cells grown in the presence of 2% galactose and 0.1% glucose. The assay, commonly used in studies on S. cerevisiae (2), has been specifically adapted to S. pombe cells and is described in Materials and Methods. We found that cells expressing Bot1p-Myc incorporate labeled methionine into mitochondrial proteins to 70% of the levels found in wild-type cells, while cells expressing Bot1p-GFP incorporate methionine to 50% of the levels in wild-type cells (Fig. 4D). Our findings indicate that the GFP and Myc fusion proteins are able to fully complement the loss of morphology and viability observed in cells lacking Bot1p. Conversely, we found that mutants exclusively expressing GFP- or Myc-tagged versions of the Bot1 protein display, to different degrees, a reduced rate of mitochondrial translation. These observations and the fact that Bot1p localizes to the small subunit of the mitochondrial ribosome prompted us to test the effect of Bot1p loss on mitochondrial morphology and mitochondrial protein translation (Fig. 5).
![]() View larger version (60K): [in a new window] |
FIG. 5. Decreased levels of Bot1p disrupt mitochondrial structure and function. (A) Mitochondrial morphology and distribution. A bot1 strain expressing Bot1p-GFP under the control of the nmt1 promoter (FV809) was grown in the absence of thiamine (a and d) or in the presence of thiamine for 26 h (b and e) or 48 h (c and f) at 32°C. Mitochondria were visualized using Mitotracker Red. The cell wall was visualized with Calcofluor. Bar, 5 µm. (B) Endogenous cell respiration. Oxygen consumption was measured in wild-type (WT) and bot1 mutant cells grown in the absence of thiamine or treated with thiamine for 24 and 48 h using a Clark-type polarographic oxygen electrode from Hansatech at 25°C as described previously (2). Cells were grown in minimal medium containing either 2% galactose and 0.1% glucose or 2% glucose, and the respiratory assays were performed in the same media. The specific activities reported were corrected for KCN-insensitive respiration. The bars indicate the means ± standard deviations from at least three independent sets of measurements. In the inset is shown a Western blot analysis of the Bot1p-GFP levels in the corresponding strains. Lanes 1 and 5, wild-type 972; lanes 2 and 6, bot1 pJK bot1-GFP (without thiamine); lanes 3 and 7, bot1 pJK bot1-GFP (with thiamine, 24 h); lanes 4 and 8, bot1 pJK bot1-GFP (with thiamine, 48 h). Lanes 1, 2, 3, and 4, minimal medium with 2% galactose and 0.1% glucose; lanes 5, 6, 7, and 8, minimal medium with 2% glucose. (C) In vivo labeling of mitochondrial gene products. Wild-type and bot1 mutant cells grown in the absence of thiamine or treated with thiamine for 26 and 48 h were labeled with [35S]methionine at 30°C for the indicated amount of time in the presence of cycloheximide as described in Materials and Methods. The S. cerevisiae W303-1A wild-type strain was labeled and run in parallel to facilitate the identification of the translation products. The mitochondrial translation products are identified in the margin. The S. cerevisiae Var1p ribosomal protein and the S. pombe Rps3p ribosomal protein have different sizes and consequently exhibit different electrophoretic mobilities. (D) mtDNA stability. (a) bot1 cells grown in the absence of thiamine, expressing Bot1p-GFP under the control of the nmt81 promoter (FV809). (b) FV809 bot1 cells grown in the presence of thiamine for 48 h. To detect mtDNA in vivo, cells were labeled with DAPI as explained in Materials and Methods and observed under a fluorescence microscope. (c) Southern blot detecting the mitochondrial gene cox1 and the nuclear gene rga4. (d) Quantification of band intensity, expressed as signal ratio of cox1 to rga4, in the Southern blot shown in panel c.
|
strain stably expressing GFP-tagged Bot1p under the control of the nmt1(81) promoter using the cell-permeant dye Mitotracker Red, which specifically accumulates into mitochondria in a membrane potential-dependent manner. In the absence of thiamine, cells and mitochondria have a phenotypically normal appearance (Fig. 5A, panels a and d), with 79% of the cells displaying a continuous, unfragmented mitochondrial network, similarly to wild-type cells (n = 50). After 26 h of exponential growth in medium containing thiamine, we found that the mitochondrial network becomes less continuous and more fragmented in a large percentage (50%) of cells (Fig. 5A, panel b). After 48 h the mitochondrial network appears completely fragmented in 100% of cells (n = 50) (Fig. 5A, panel c) and cells display a characteristic loss of normal morphology (Fig. 5A, panel f). Furthermore, we observed that Mitotracker Red incorporation was diminished in the 48-h sample (Fig. 5A, panel c). Since incorporation of Mitotracker Red is dependent on mitochondrial membrane potential, these observations suggest a decline in membrane potential in the 48-h sample.
Abnormal mitochondrial morphology/distribution and membrane potential decline are usually accompanied by lesions in the mitochondrial respiratory chain, affecting the ability of the cells to respire. We analyzed the oxygen consumption capacity of bot1
cells (Fig. 5B). Cells were grown exponentially in two different growth media, one containing 2% galactose and 0.1% glucose and one containing 2% glucose (Fig. 5B). We found that even in the absence of thiamine, cell respiration is substantially decreased (approximately to 25% of wild-type values) in bot1
mutants expressing Bot1p-GFP, again suggesting that the addition of the large GFP tag to Bot1p significantly impairs its role in regulating mitochondrial respiration. GFP-tagged Bot1p is stable and readily accumulates in the absence of thiamine (Fig. 5B, inset, lanes 2 and 6). Although we did not obtained data concerning the turnover of Bot1p-GFP, our results showed that after 24 h of thiamine supplementation to the medium, the detected residual levels of the protein are below 10% of the levels at time zero (Fig. 5B, inset, lanes 3 and 7), and further decrease to virtually undetectable levels after 48 h of incubation in the presence of thiamine (Fig. 5B, inset, lanes 4 and 8). Following thiamine addition, cell respiration further diminishes, particularly in the 2% glucose culture (Fig. 5B, 26- and 48-h samples).
To establish whether Bot1 plays a role in mitochondrial protein synthesis, we followed the incorporation of radioactively labeled [35S]methionine into newly synthesized mitochondrial proteins in vivo in bot1
pJK nmt81 bot1GFP cells grown in the presence of 2% galactose and 0.1% glucose (Fig. 5C). We found that already in the absence of thiamine, which allows expression of Bot1p-GFP from the attenuated nmt81 promoter, the bot1
strain shows low levels of incorporation of [35S]methionine into mitochondrial gene products (one-seventh of wild-type levels for Cox1/Cytb and one-ninth for Atp8/9), demonstrating that mitochondrial protein translation is substantially less efficient in this strain than in the wild-type control. Following thiamine addition, mitochondrial protein translation progressively decreases further, as shown in the 26-h and 48-h samples (Fig. 5C). We found that in bot1
cells expressing Bot1-GFP under the control of the nmt81 promoter, Cox2/Cytb protein levels further decrease 3.5-fold and Atp8/9 protein levels further decrease 2.8-fold, compared to initial levels, at 48 h after thiamine addition. These observations indicate that decreasing Bot1p levels negatively impact mitochondrial protein translation.
Mitochondrial translational mutants of S. cerevisiae (2) have a tendency to loose their mtDNA and survive by fermentation, but this not the case for S. pombe, which does not tolerate the absence either of mtDNA or of respiratory function. Furthermore, for the yeast S. cerevisiae it has been recently shown that some mitochondrial proteins are essential for mtDNA stability by interacting with mitochondrial nucleoids (11, 20). Reduced mtDNA levels in bot1
mutants could also explain the defective mitochondrial translation phenotype observed in this strain. To explore the mtDNA content in bot1
mutants, we stained wild-type and mutant cells with DAPI and visualized the mitochondrial nucleoids under a fluorescence microscope. After observing more than 300 cells, we concluded that the nucleoids are still present in bot1
cells grown in the presence of thiamine for 48 h (Fig. 5D). We confirmed these findings by observing that the ratio of the mitochondrial genome to the nuclear genome does not decrease in bot1
cells during culture in the presence of thiamine, as shown by detecting the mitochondrial gene cox1 and the nuclear gene rga4 by Southern blotting.
Thus, our findings collectively showed that loss of Bot1p leads to mitochondrial fragmentation, decreased mitochondrial protein synthesis, and decreased cell respiration and demonstrated that Bot1p plays a direct role in the assembly and/or function of the mitochondrial translational apparatus.
Overexpression of Bot1p leads to increased cell size and increased cell respiration.
Since loss of Bot1p leads to changes in cell length and cell size (Fig. 2A, panel d), to mitochondrial fragmentation, and to decreased cell respiration, we asked whether Bot1p overexpression would also affect these parameters. Indeed, we found that bot1+ cells containing a multicopy plasmid expressing Bot1p from the full-strength nmt1 promoter are substantially longer (Fig. 6A, panel c) than control cells carrying an empty plasmid (Fig. 6A, panel a). Cells overexpressing Bot1p are on average 160% longer than control cells (n = 100), and cell elongation is consistent with a delay in G2, as observed by fluorescence-activated cell sorter analysis (not shown). In cells overexpressing Bot1p, the appearance of the mitochondrial network is not significantly altered (Fig. 6A, panel d) compared to control cells (Fig. 6A, panel b) suggesting that Bot1p overexpression does not negatively affect mitochondrial structure. The actin cytoskeleton structure also is unaffected (not shown). Cell respiration is slightly increased in cells overexpressing Bot1p, by a small (
8 to 10%) but significant amount in cells grown in the presence of 2% glucose (P < 0.05) (Fig. 6B). The efficiency of mitochondrial protein synthesis and the pattern of the mitochondrial translation products are mostly unaffected by Bot1p overexpression (Fig. 6C). The only exception is the appearance of an extra band corresponding to a protein of electrophoretic mobility between those of Atp6 and Rps3, which does not correspond to an identified mitochondrially encoded protein sequence (Fig. 6C). To analyze Bot1 localization when overexpressed, we expressed Bot1-GFP from the same plasmid. In these conditions, Bot1-GFP is expressed at a fourfold-higher level than in a strain expressing Bot1-GFP under the control of the endogenous promoter (strain FV811) (not shown). We found that overexpressed Bot1-GFP is still localized to the mitochondria (Fig. 6D, panel b). Thus, our findings indicate that Bot1p overexpression leads to an increase in cell size.
![]() View larger version (64K): [in a new window] |
FIG. 6. Overexpression of Bot1p induces cell elongation and increased cell respiration. (A) Cellular and mitochondrial morphologies of cells overexpressing Bot1p. Control cells carrying a multicopy empty pRep3X plasmid (FV814) or cells carrying pRep3xbot1-HA (FV813) were grown in the absence of thiamine for 16 h at 32°C. The cell wall was visualized with Calcofluor. Mitochondria were visualized with Mitotracker Red. Bar, 5 µm (B) Oxygen consumption was measured in control cells or cells overexpressing Bot1p, grown in minimal medium containing either 2% galactose and 0.1% glucose or 2% glucose, as explained in the legend to Fig. 5. The asterisk indicates a significant increase in cell respiration. (C) In vivo mitochondrial protein synthesis in cells overexpressing Bot1p. Control cells carrying a multicopy empty pRep3X plasmid or cells carrying pRep3xbot1-HA were grown in the absence of thiamine for 16 h at 32°C and then labeled with [35S]methionine at 30°C for 2 h in the presence of cycloheximide. The asterisk indicates an extra band which does not correspond to an identified mitochondrially encoded protein sequence. (D) Mitochondrial localization of overexpressed Bot1p-GFP in live cells (strain FV812). Bar, 5 µm.
|
|
|
|---|
We show that S. pombe Bot1p is localized exclusively to mitochondria as shown both by in vivo localization of a GFP-tagged version of the protein under a fluorescence microscope and by Western blot analysis of a Myc-tagged version of the protein, both expressed at the endogenous level. Furthermore, we found that it associates with the small subunit of the mitochondrial ribosome and it is required for mitochondrial protein synthesis. Consistent with a role in mitochondria protein translation, decreased levels of Bot1p lead to loss of mitochondrial network continuity and integrity. This is not an effect of a disrupted microtubular network, which has a role in the localization of mitochondria, as previously described (1, 46), since the microtubule pattern in bot1
mutants appears to be normal. Furthermore, we show that decreased levels of Bot1p lead to decreased respiration and decreased uptake of Mitotracker Red in the mitochondria, suggesting a reduced mitochondrial membrane potential. The cell respiration defect results from a defect in the mitochondrial ability to translate proteins as demonstrated by our in vivo protein synthesis experiments. Our results represent the first characterization of the mitochondrial protein translation function of Bot1/MrpS35.
At this point, we have not established whether Bot1p is a structural component of the ribosomal small subunit or a ribosome assembly factor. In the yeast Saccharomyces cerevisiae, at least 34 small-subunit and 49 large-subunit mitochondrial ribosomal proteins (Mrps) have been described (14). While not all have been fully characterized, some also have other cellular functions: for example, in yeast, MrpL31 and Ygl068 may be involved in cell cycle control (39). Additionally, factors have been found which do not associate tightly with the ribosomes but are involved in ribosome biogenesis (2). Others proteins are also involved in the complex processing steps that modify rRNAs and that are required for the assembly of a functional ribosome (9, 37). Thus, future experiments will address the role of Bot1p in ribosomal structure, biogenesis, and translation control.
We found that strains carrying null alleles of bot1 show progressive alterations in cell shape. Forty-eight hours following spore germination, cells are longer, enlarged, and assume a characteristic bottle-shape form. This phenotype was recapitulated in mutants expressing reduced levels of Bot1p, where changes in cell shape correlate with an alteration of the actin cytoskeleton and increased resistance to glucanase digestion, indicating an alteration of cell wall structure (10, 17). Thus, our observations are consistent with the notion that loss of Bot1p and mitochondrial function, by inhibiting cell respiration, affects cellular processes that require a high energetic level, such as cytoskeleton dynamics and cell wall formation. The particular shape of these mutant cells likely reflects cellular processes that are very sensitive to energy deprivation, particularly in an organism like S. pombe, which is compulsorily aerobic. It is also possible that loss of respiration may not be the only cause of shape alteration. Indeed, pharmacological inhibition of the mitochondrial respiratory chain with the cytochrome c oxidase inhibitor KCN did not induce a similar alteration of the cell shape and instead produced uniformly small cells (F. Verde, unpublished data). Respiratory mutants were not previously reported as presenting a cell morphology alteration (7, 13). In mutants of msp1, which encode a dynamin-related protein involved in mtDNA maintenance, an alteration of cell morphology is clearly not observed (18). Thus, it is possible that the morphological phenotype of bot1
cells reflects the disruption of other mitochondrial functions, for example, their important role in the biosynthesis of fatty acids (29).
An interesting observation is the fact that bot1
mutant cells also appear to be not only wider but also longer, suggesting a delay in cell cycle progression. Indeed, we found that such an increase in cell volume did not occur in a mutant with a mutation of the cell cycle regulatory kinase Wee1p (see Fig. S1 in the supplemental material). Thus, these findings suggest that in fission yeast low energy levels trigger a cell cycle arrest that is regulated by cell cycle control factors. It is interesting to note that a p53-dependent cell cycle checkpoint monitoring the metabolic activity of mitochondria has been described in mammalian cells and Drosophila, where it is thought to promote cell survival by blocking the commitment to another round of cell division (reviewed in reference 29). It will be interesting to establish in the future which mechanism is involved in such a cell cycle delay in Schizosaccharomyces pombe.
Interestingly, Bot1p overexpression also leads to cell elongation, slower growth, and a cell cycle delay in G2. This effect is likely not due to an effect either on the microtubular and actin network or on mitochondrial function, since the mitochondrial web appears to be intact and mitochondrial protein synthesis is not affected. Actually, in Bot1p-overexpressing cells, cell respiration is increased by a small but significant amount in cells grown in the presence of 2% glucose, which are aerobically repressed by 50%. This increase is interesting since it suggests that Bot1p, which is necessary for mitochondrial protein translation, may also positively regulate cell respiration when its levels are increased or, alternatively, decrease cell sensitivity to glucose-dependent repression of respiration. Also, it is possible that the effects of overexpression may reflect a function of Bot1p in mitochondrial signaling. Recent evidence suggests that mitochondria interact in several way with other cellular functions and that they are part of multiple cell signaling cascades (reviewed in reference 29). Furthermore, several mitochondrial factors, generally when overexpressed, have been found to interact with cell cycle, cell growth, or checkpoint control functions (6, 24, 34, 35, 39, 48). For example, in mammalian cells, the mitochondrial ribosomal protein MrpL41 has a role in stabilizing p53, p27KIP1, and p21WAF1/CIP1 (24, 48), and mitochondrial ribosomal protein MRPS36 overexpression delays cell cycle progression by inducing p21WAF1/CIP1 expression and regulating the expression and phosphorylation of p53 (6). Future experiments, addressing which cell size/cell cycle control pathway(s) is affected by Bot1 under- and overexpression, may shed light on the signaling mechanisms that govern cell growth in response to metabolic changes in fission yeast.
In conclusion, we presented the characterization of a novel factor, Bot1, which associates with mitochondrial ribosomes and is essential for mitochondrial protein translation in fission yeast and whose loss affects mitochondrial integrity, cell respiration, and cell morphology. Future analysis of the function of Bot1 and other proteins involved in mitochondrial protein translation will help decipher the interdependence between mitochondrial protein synthesis, cell respiration, and the overall control of cell growth.
F.V. is supported by a National Science Foundation grant (0344798) and by the University of Miami Comprehensive Sylvester Cancer Center. A.B. is supported by National Institutes of Health research grant GM071775A. F.F. is supported by Telethon-Italy fellowship GFP05008.
Published ahead of print on 1 February 2008. ![]()
Supplemental material for this article may be found at http://ec.asm.org/. ![]()
These authors contributed equally. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»