This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hemschemeier, A.
Right arrow Articles by Happe, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hemschemeier, A.
Right arrow Articles by Happe, T.
Right arrowPubmed/NCBI databases
*Gene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*FORMIC ACID

 Previous Article  |  Next Article 

Eukaryotic Cell, March 2008, p. 518-526, Vol. 7, No. 3
1535-9778/08/$08.00+0     doi:10.1128/EC.00368-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Biochemical and Physiological Characterization of the Pyruvate Formate-Lyase Pfl1 of Chlamydomonas reinhardtii, a Typically Bacterial Enzyme in a Eukaryotic Alga{triangledown}

Anja Hemschemeier,* Jessica Jacobs, and Thomas Happe

Ruhr-Universität Bochum, Fakultät für Biologie und Biotechnologie, Lehrstuhl für Biochemie der Pflanzen, AG Photobiotechnologie, 44780 Bochum, Germany

Received 6 October 2007/ Accepted 13 January 2008


arrow
ABSTRACT
 
The unicellular green alga Chlamydomonas reinhardtii has a special type of anaerobic metabolism that is quite unusual for eukaryotes. It has two oxygen-sensitive [Fe-Fe] hydrogenases (EC 1.12.7.2) that are coupled to photosynthesis and, in addition, a formate- and ethanol-producing fermentative metabolism, which was proposed to be initiated by pyruvate formate-lyase (Pfl; EC 2.3.1.54 [EC] ). Pfl enzymes are commonly found in prokaryotes but only rarely in eukaryotes. Both the hydrogen- and the formate/ethanol-producing pathways are involved in a sustained anaerobic metabolism of the alga, which can be induced by sulfur depletion in illuminated cultures. Before now, the presence of a Pfl protein in C. reinhardtii was predicted from formate secretion and the homology of the deduced protein of the PFL1 gene model to known Pfl enzymes. In this study, we proved the formate-producing activity of the putative Pfl1 enzyme by heterologous expression of the C. reinhardtii PFL1 cDNA in Escherichia coli and subsequent in vitro activity tests of the purified protein. Furthermore, a Pfl-deficient E. coli strain secretes formate when expressing the PFL1 cDNA of C. reinhardtii. We also examined the Pfl1 fermentation pathway of C. reinhardtii under the physiological condition of sulfur depletion. Genetic and biochemical analyses show that sulfur-depleted algae express genes encoding enzymes acting downstream of Pfl1 and also potentially ethanol-producing enzymes, such as pyruvate decarboxylase (EC 4.1.1.1) or pyruvate ferredoxin oxidoreductase (EC 1.2.7.1 [EC] ). The latter enzymes might substitute for Pfl1 activity when Pfl1 is specifically inhibited by hypophosphite.


arrow
INTRODUCTION
 
The unicellular chlorophyte alga Chlamydomonas reinhardtii possesses features that are unusual for a eukaryotic photosynthetic organism. The alga produces molecular hydrogen (H2) under anaerobic conditions using electrons originating from the photosynthetic electron transport chain (reviewed in reference 30). H2 production in C. reinhardtii accompanies a complex fermentative metabolism, which is another exceptional characteristic of this green alga. During anaerobic starch breakdown in C. reinhardtii, formate, acetate, ethanol, carbon dioxide (CO2), and H2, as well as traces of glycerol and D-lactate, are produced (10) as end products of a prokaryotic-type mixed-acid fermentation (40).

Usually, coincident production of formate, ethanol, and acetate is associated with the activity of pyruvate formate-lyase (Pfl). Pfl systems are typically found in facultative anaerobic bacteria such as the Enterobacteriaceae or in strict anaerobes like clostridia (40), but usually not in eukaryotes. To date, the only two eukaryotic lineages for which a Pfl enzyme and formate production have been described are the chytridiomycetes Neocallimastix frontalis and Piromyces sp. strain E2 (1, 28) and some chlorophyte algae, such as Chlorogonium elongatum and C. reinhardtii (24).

Probably the best-studied Pfl system is that of Escherichia coli. Pfl is a radical enzyme whose active form harbors an {alpha}-carbon-centered glycyl radical in the polypeptide chain (22, 47) that is inserted posttranslationally into the Pfl polypeptide by the enzyme Pfl activase (Pfla) (8). Pfla requires S-adenosylmethionine and reduced one-electron donors as substrates for Pfl activation (5) and is a member of the group of radical S-adenosylmethionine proteins (9, 43).

The Pfl enzyme cleaves pyruvate into acetyl coenzyme A (acetyl-CoA) and formate. In E. coli, formate is usually further broken down into H2 and CO2 by the formate hydrogen lyase complex (41). Acetyl-CoA can be metabolized by two different metabolic pathways. A reaction catalyzed by phosphotransacetylase (Pat) and acetate kinase (Ack) converts acetyl-CoA into acetate. The second pathway allows the reoxidation of two molecules of NADH through sequential reduction of acetyl-CoA to ethanol via acetaldehyde. Genetic and biochemical analyses have shown that in E. coli, the acetaldehyde dehydrogenase and alcohol dehydrogenase (Adh) functions are localized on one homopolymeric enzyme complex called AdhE (11, 21).

In C. reinhardtii, a Pfl system was proposed when fermentative analyses of dark-adapted algae revealed a ratio of formate, ethanol, and acetate of 2:1:1 (10, 24). In a recent proteomic survey of C. reinhardtii mitochondria, putative Pfl1 peptides were discovered, which led to the isolation of a full-length PFL1 cDNA by expressed sequence tag assembly (2). The most recent analyses of gene expression profiles in anaerobically adapted C. reinhardtii cells showed the increased transcription of genes encoding enzymes of the Pfl system, which correlated with the accumulation of the respective metabolites (33).

Formate and ethanol were also shown to be produced in H2-evolving sulfur-deprived cultures of C. reinhardtii (15, 23, 48), which establish anaerobic conditions without any further manipulation, even while the cells are illuminated (29). The accumulation of formate was accompanied by increased levels of a transcript, which was annotated as a putative Pfl-encoding cDNA (GenBank X66410) (48). The anaerobic metabolism in S-starved C. reinhardtii was therefore termed photofermentation because it develops upon full illumination in an organism performing oxygenic photosynthesis (15). S starvation is the only condition known so far under which C. reinhardtii produces relatively large amounts of H2 (30).

The occurrence of a Pfl system in a eukaryotic alga is of evolutionary interest (2), and the understanding of anaerobic pathways is important for biotechnological approaches to use C. reinhardtii as a H2 producer. We analyzed the Pfl1 protein of C. reinhardtii and produced evidence for the formate-generating catalytic activity of the algal enzyme by demonstrating its activity in a Pfl-deficient E. coli strain. Furthermore, we analyzed the fermentative metabolism of S-deprived C. reinhardtii cultures genetically and physiologically and observed a marked flexibility of fermentation in the cells. Although Pfl1 plays a central role in the anaerobic life of C. reinhardtii, the alga is able to use alternative fermentative pathways when Pfl1 is inactivated.


arrow
MATERIALS AND METHODS
 
Organisms and growth conditions. (i) Green algae. Wild-type strain C. reinhardtii CC-125 (mt+ 137c) and cell wall-less strain CC-277 were obtained from the Chlamydomonas Culture Collection at Duke University, Durham, NC. C. reinhardtii cultures were grown photoheterotrophically in Tris-acetate-phosphate (TAP) medium (14). Batch cultures were shaken at 20°C under continuous illumination (100 µmol photons m–2 s–1). For S deprivation of strain CC-125, cells were treated as described previously (16), except that the culture volume was 100 ml and the capacity of the headspace was 20 ml. For anaerobic adaptation of strain CC-277, cells were harvested by centrifugation (3 min, 2,500 g) in the mid-exponential stage of growth and resuspended in fresh TAP medium at a fivefold concentration to reach a chlorophyll concentration of 100 µg ml–1. The cell suspension was continuously flushed with pure argon in the dark to establish anaerobic conditions.

(ii) E. coli. The following E. coli strains were used in this study: DH5{alpha}, BL21(DE3)pLysS (Novagen, EMD Biosciences Inc., Madison, WI), BL21(DE3) (Novagen), and BL21(DE3){Delta}pfl [BL21(DE3) carrying a chloramphenicol resistance cassette in the pfl gene] (G. Sawers, personal communication). If not indicated otherwise, E. coli cells were grown in liquid LB medium (25 g liter–1 Luria broth base; Invitrogen/Gibco, Carlsbad, CA) or on LB agar plates (32 g liter–1 Luria agar; Invitrogen/Gibco) at 37°C.

RNA and protein analysis. Total RNA was isolated according to Johanningmeier and Howell (19) from C. reinhardtii cultures that had encountered S depletion for various periods of time. DNA was removed by LiCl precipitation. mRNA was isolated from 100 µg of total RNA with a NucleoTrap mRNA kit from Macherey-Nagel GmbH & Co. KG, Düren, Germany, according to the manufacturer's recommendations. Preparation of crude protein extracts of C. reinhardtii and E. coli, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Western blotting were conducted as described previously (16). Because C. reinhardtii cultures rapidly enter hypoxia during centrifugation and thus might already express anaerobically induced genes, cells for the control (0-h) samples were separated from the preculture before the transfer to S-free medium. These cells were directly transferred to cooled centrifugation flasks and centrifuged for 2 min at 4°C (2,500 g), and the pellet was immediately lysed in RNA or protein lysis buffer.

PCR techniques and cloning strategies. For the amplification of the PFL1 open reading frame (ORF) of C. reinhardtii, oligonucleotides were deduced from the annotated PFL1 transcript in JGI3.0 (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html; scaffold 1, 4386888 to 4392256; protein ID, 146801). Suitable restriction sites for cloning the PFL1 cDNA into the expression vectors pET9a (Novagen) (5', CATATGAGCCAGATGCTGCTGGAG and CATATGCTCCCGGTGGCACCCAG; 3', GGATCCTTACATGGTGTCGTGGAAGGTG) and pASK-IBA7 (IBA GmbH, Göttingen, Germany) (5', GAATTCATGAGCCAGATGCTGCTGGAG; 3', GAATTCCATGGTGTCGTGGAAGGTG) were added. For in vivo analysis of the algal Pfl1 in a pfl-deficient E. coli strain, both the whole PFL1 ORF and a truncated sequence lacking the first 210 bp were cloned into pET9a (Novagen). Reverse transcription-PCR (RT-PCR) was conducted with a Qiagen OneStep RT-PCR kit (Qiagen, Hilden, Germany) according to the supplier's instructions with mRNA from an S-deprived C. reinhardtii culture as the template. E. coli pfl (GenBank X08035) was amplified from genomic DNA using whole E. coli cells as the template (5', CATATGTCCGAGCTTAATGAAAAG; 3', GCTCAGCTTACATAGATTGAGTGAAGG). PCR fragments were precloned into pGEM-T Easy (Promega, Madison, WI). The insert DNA was sequenced by MWG Biotech AG, Ebersberg, Germany. All plasmids that resulted from the ligation of the Pfl-encoding sequences with pASK-IBA7 or pET9a are listed in Table 1.


View this table:
[in this window]
[in a new window]

 
TABLE 1. PFL-containing plasmids constructed in this study and E. coli strainsa

Heterologous expression of C. reinhardtii PFL1 in pfl-deficient E. coli for in vivo activity studies. To analyze the activity of the putative Pfl1 enzyme of C. reinhardtii, the algal PFL1 sequence was introduced into a pfl-deficient E. coli strain [BL21(DE3){Delta}pfl] by transforming the bacteria with the plasmids pAH28, pAH32, and, as a control, pAH36 (Table 1). Precultures were grown aerobically in 3 ml LB medium supplemented with 1% (wt/vol) glucose at room temperature overnight and then transferred to 130-ml squared glass bottles containing 120 ml of cooled (6°C) LB medium. The bottles were closed with a gas-tight septum (red rubber Suba seals, no. 37; Sigma-Aldrich, St. Louis, MO), flushed with argon for 10 min, and then incubated at 6°C for 2 h before being transferred to room temperature. Overproduction of the algal Pfl1 proteins was undesired; thus, no isopropyl-β-D-thiogalactopyranoside was added. Samples of the cell suspensions were taken at several time points with a gas-tight syringe by piercing the septum. The gas composition in the headspace of the cultures was analyzed by gas chromatography (see below) in the same time intervals. Growth of the cells was recorded by measuring the optical density at 600 nm (OD600). Formate was quantified with a test kit (catalog no. 10 979 732 035) from Boehringer Mannheim/r-Biopharm, Darmstadt, Germany, following the instructions of the supplier.

Heterologous expression of C. reinhardtii PFL1 in E. coli and subsequent purification by Strep-Tag II chromatography. For heterologous Pfl1 production, we used E. coli strain BL21(DE3){Delta}pfl to avoid background Pfl activity in subsequent in vitro enzyme assays. Precultures of BL21(DE3){Delta}pfl transformed with pAH21 (Table 1) were inoculated in 200 ml LB medium plus 0.2% (wt/vol) glucose in squared glass bottles that were sealed with Suba seals and flushed with argon for 10 min. The E. coli culture was incubated at 37°C until it reached an OD600 of 0.4. Then, anhydrotetracycline was added to a final concentration of 0.1 µg ml–1 to induce PFL1 expression. The cells were transferred to 6°C and incubated for 3 h. For isolation of heterologously produced Pfl1, the incubation flask was placed in an anaerobic tent (Toepfer LabSystems, Göppingen, Germany) before it was opened. The Strep-Tag II-Pfl1 fusion proteins were isolated from the E. coli host and purified according to the instructions given in the Strep-Tag system manual from IBA GmbH, except that 1 mM sodium dithionite was added to buffer W for washing steps. After elution of the Strep-Tag II-Pfl1 fusion proteins, the eluates were combined for subsequent in vitro activity assays according to Kreuzberg (25).

qPCR. For quantitative real-time PCR (qPCR), first-strand cDNA synthesis was performed with SuperScript II reverse transcriptase (Invitrogen) and primed from 8 µl of mRNA template using a mixture of 1 µl oligo(dT)18 (0.5 µg µl–1, Fermentas, Burlington, Canada) and 1 µl random hexamers (1 µg µl–1; Roche, Basel, Switzerland). The reverse transcription reaction was accomplished according to the manufacturer's recommendations. Subsequent qPCR was performed in a DNA Engine Opticon 2 (MJ Research, Inc., Waltham, MA) using SYBR Green JumpStart Taq ReadyMix for quantitative PCR (Sigma Aldrich) in a volume of 20 µl according to the manual. Each reaction was performed in triplicate. Oligonucleotides used for qPCR were designed with the software SECentral (Sci Ed Central for Windows; Scientific and Educational Software) to obtain melting temperatures of 61 to 62°C and amplicons of ~200 bp (Table 2). Whenever possible, the oligonucleotide pairs were chosen to encompass introns to be able to verify the absence of DNA in the samples. The qPCR program comprised 94°C for 2 min, 40 cycles of 95°C for 15 s, 60°C for 30 s, 72°C for 1 min, and 10 min at 72°C. The PCR program was always followed by a melting curve analysis. Mean threshold cycle values were calculated from the triplicate values and used for calculations of expression ratios according to Pfaffl (34) with primer-specific efficiencies. The efficiency of each primer pair was calculated from standard curves using LinRegPCR version 7.2 (J. M. Ruijter, based on the work of Ramakers et al. [38]). The threshold cycle values for an amplicon derived from RPL10a mRNA, encoding the cytosolic 60S large ribosomal subunit protein L10a (GenBank no. XP_001699807; protein ID on JGI3.0, 195585), were used as a reference for normalization. For statistical analyses, qPCR experiments were repeated using mRNA samples of three independent S-deprived C. reinhardtii cultures. Technical reproducibility was proved by conducting the qPCR on each mRNA set twice.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Oligonucleotides used for quantification of transcript levels of genes by qPCR

Detection of H2 and CO2. H2 that had accumulated in the headspace of C. reinhardtii or E. coli cultures was quantified with a gas chromatograph (GC-2010 [Shimadzu, Kyoto, Japan] equipped with a PLOT fused silica coating molsieve column [5Å, 10 m by 0.32 mm] from Varian, Palo Alto, CA). CO2 was detected by a mass spectrometric setup that was provided by Gilles Peltier and Laurent Cournac in CEA Cadarache, Saint-Paul-lez-Durance, France (Prisma QMS 2000, 1 to 100 atomic mass units, quadrupole mass spectrometer from Pfeiffer Vacuum, Asslar, Germany; mounted on a turbo-molecular pumping station and equipped with an inlet made from a UDV 146 metal valve).

Analysis of HP-treated, S-deprived C. reinhardtii cultures. A 10 mM concentration of a fresh 2 M stock solution of sodium hypophosphite (Na-HP) in water was added to S-starved and gas-proof C. reinhardtii cultures that had just reached anaerobic conditions. At certain intervals, a sample of the algal suspension was taken with a gas-tight syringe, the cells were harvested by centrifugation (1 min, 5,000 g) and the supernatant was analyzed for the presence of formate (see above) and ethanol (catalog no. 10 176 290 035; Boehringer Mannheim/r-Biopharm). To ensure that HP reached the Pfl1 protein inside the cells and did not only block formate transporters, we tested the intracellular accumulation of formate in control and HP-treated C. reinhardtii CC-277 cells during anaerobic adaptation as described by Gfeller and Gibbs (10).

Chemicals. If not indicated otherwise, all chemicals were obtained in highest purity (per analysis quality) from Sigma Aldrich.


arrow
RESULTS
 
The algal Pfl1 protein is actively produced in E. coli. A Pfl-deficient E. coli strain in the BL21(DE3) background (G. Sawers, personal communication; the strain is referred to as BL21{Delta}pfl here) was transformed with plasmids including C. reinhardtii PFL1 cDNA sequences. PFL1 cDNA was present in vector pET9a, either as the complete ORF (pAH28) or as a truncated sequence lacking the first 210 bp, which might encode a transit peptide (2) (pAH32). As a control for the experimental system, strain BL21{Delta}pfl was also transformed with the E. coli pfl sequence (GenBank X08035) (pAH36).

Usually, Pfl fermentation in E. coli produces formate, which is secreted from the cells but is reimported when a certain threshold pH in the medium is reached (31, 41). Inside the cells, formate triggers the induction of the formate hydrogen lyase complex, which cleaves formate into CO2 and H2. This behavior was not observed in the E. coli BL21 strains that were used in this study. These strains did not produce H2 but accumulated formate in the medium and did not reimport it (Fig. 1b). This indicates that an important factor for formate degradation is missing in E. coli BL21 derivatives. Hence, the presence of active Pfl proteins in BL21 derivatives was assessed in this study based on the accumulation of formate.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 1. Anaerobic growth (a) and formate accumulation (b) of several E. coli strains. BL21wt [BL21(DE3)pLysS] was used as the control. Cultures that had been made anaerobic were incubated at 6°C for 2 h before the measurements at room temperature were started (0 h).

It was shown in parallel studies that the heterologous synthesis of C. reinhardtii Pfl1 in E. coli did not yield soluble protein when the cultures were incubated at 37°C (see below). Therefore, precultures were maintained at room temperature (23°C), and the anaerobically induced E. coli cultures were preincubated at 6°C for 2 h before they were transferred to room temperature and the measurements were started.

The behavior of strain BL21{Delta}pfl complemented with E. coli Pfl (termed BL21.36) showed that the chosen expression system was functional. Growth of BL21.36 was restored to wild-type levels (Fig. 1a), and the cells produced formate (Fig. 1b).

Cultures of BL21{Delta}pfl strains expressing the algal PFL1 cDNAs excreted formate (Fig. 1b), demonstrating that C. reinhardtii Pfl1 was functionally synthesized in E. coli. No significant difference was observable if BL21{Delta}pfl was transformed with the complete C. reinhardtii PFL1 sequence (BL21.28) or with the truncated sequence lacking the first 210 bp (BL21.32) (Fig. 1b). BL21.28 and BL21.32 produced less formate than BL21(DE3)pLysS (designated the wild type here) or strain BL21.36 (Fig. 1b). Growth of strains BL21.28 and BL21.32 was not restored by the activity of the algal Pfl1 protein (Fig. 1a). Strains BL21(DE3)pLysS and BL21.36 grew to ODs of 0.6, but strains BL21.28 and BL21.32 showed maximal ODs of 0.35. This was only a bit higher than the maximal OD reached by strain BL21{Delta}pfl (0.26) (Fig. 1a). Furthermore, the slightly enhanced growth of strains BL21.28 and BL21.32 was observed only when the test cultures had been preincubated at 6°C.

To detect Pfl proteins in the examined strains, Western blot analyses were performed with anti-E. coli TdcE antibodies. TdcE is a 2-ketobutyrate formate-lyase that exhibits Pfl activity and high amino acid sequence identity with Pfl (17, 39). Anti-E. coli TdcE antibodies cross-react with E. coli Pfl (G. Sawers, personal communication). Proteins of ~80 kDa were detected in BL21(DE3)pLysS and BL21.36 but not BL21{Delta}pfl extracts (Fig. 2). In BL21.28 (expressing the complete C. reinhardtii PFL1 cDNA), an ~89-kDa protein could be detected, which corresponds to the complete Pfl1 protein with a calculated mass of 91 kDa. This protein was also purified via Strep-Tag II chromatography (see below) and served as a control for the Western blot analysis (Fig. 2). In BL21.32 (furnished with the truncated C. reinhardtii PFL1 cDNA), an ~80-kDa protein reacts with anti-TdcE antibody (Fig. 2). The calculated mass of the protein without the putative signal peptide is 84 kDa. In the extracts of BL21(DE3)pLysS and BL21.28, the specific two-band pattern of Pfl from aerobically prepared protein extracts is visible. The lower band derives from the full-length Pfl polypeptide and arises through oxygenolytic scission of activated, radical-bearing Pfl at the position of the glycyl residue (17). Consequently, the appearance of this characteristic double band is a signature for activated Pfl. In the extracts of BL21.36 and BL21.32, the double-band pattern is not clearly recognizable.


Figure 2
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 2. Western blot analysis of Pfl protein synthesis in anaerobically grown E. coli strains using anti-E. coli TdcE antibodies. C. reinhardtii Pfl1 purified by Strep-Tag II chromatography served as a control (C). The calculated sizes for the Pfl proteins are 85 kDa (E. coli), 84 kDa (C. reinhardtii Pfl1 without putative signal peptide), and 91 kDa (C. reinhardtii, complete Pfl1).

A second strategy to demonstrate the activity of the algal Pfl1 protein was to study formate production in in vitro assays. For this purpose, the complete C. reinhardtii PFL1 cDNA was cloned into the vector pASK-IBA7, yielding the vector pAH21. This allowed tightly controlled expression in E. coli and subsequent purification of the enzyme by an N-terminal Strep-Tag II. To circumvent background activity of E. coli Pfl, we chose E. coli BL21{Delta}pfl for heterologous expression of C. reinhardtii PFL1. It turned out that the algal Pfl1 protein was produced in an insoluble form when the E. coli host (termed E. coli AH21) was incubated at 37°C or at 30°C and as mostly insoluble protein when the host was incubated at room temperature. Only at an incubation temperature of 6°C did the expression of the algal PFL1 cDNA yield significant amounts of soluble protein (data not shown). On the basis of these preliminary tests, subsequent heterologous expression of PFL1 cDNA in E. coli AH21 was carried out at 6°C. Purification of C. reinhardtii Pfl1 by Strep-Tag II chromatography yielded pure protein which cross-reacted with anti-E. coli TdcE antibodies (data not shown). Heterologously synthesized and anaerobically purified C. reinhardtii Pfl1 was tested for in vitro formate-producing activity in a test system based on the work of Kreuzberg (25). In a reaction mixture containing pyruvate, CoA and the anaerobically isolated algal Pfl1 protein, 7.5 µg of formate was produced per ml of isolated Pfl1. No formate was detected in control reactions containing aerobically incubated Pfl1 eluates or just elution buffer (data not shown).

Key genes of fermentation are expressed in sulfur-starved algae. S-deprived algae produce mainly H2, ethanol, and formate (48). The latter products indicate the activity of a Pfl pathway, which in E. coli involves three further enzymes acting downstream of Pfl: AdhE (a multifunctional enzyme with acetaldehyde dehydrogenase and Adh activity), Pat, and Ack (40). Genes that encode the enzymes of this pathway can also be found in the genome of C. reinhardtii (2, 15, 33). Enhanced transcription of these genes has been shown in anaerobic C. reinhardtii cultures by qPCR experiments (33). Furthermore, the induced synthesis of the putative Pfl1 protein upon anaerobic incubation of C. reinhardtii in darkness was demonstrated (2). We decided to analyze the expression of key genes whose products are involved in fermentation upon S deprivation, since this is a special condition of fermentation. First, we carried out RT-PCR experiments to verify the transcription of genes encoding central fermentative proteins in S-deprived C. reinhardtii cells. A semiquantitative analysis of the expression of these genes was performed using a low cycle number for the PCR following RT. Using mRNA that had been isolated daily from S-deprived C. reinhardtii wild-type cultures, one-step RT-PCRs were conducted with oligonucleotides specific for HYDA1 ([Fe-Fe] hydrogenase HydA1), PFL1 (Pfl1), PFLA1 (Pfl activase), PAT1 (phosphotransacetylase 1), and ADH1 (Adh1/AdhE). For all these genes, the respective transcript could be detected, and the RT-PCR results indicated an enhanced transcription of all of the analyzed genes (data not shown).

The expression of HYDA1, PFL1, PFLA1, and ADH1 was then examined by qPCR. After 9 h of S deprivation, the transcript levels of all of the analyzed genes had already increased 1.5- to 3-fold (Fig. 3). In the RNA samples taken from C. reinhardtii cells that had undergone S depletion for 24 h and that had already become anaerobic, the relative amounts of HYDA1 and PFL1 transcripts had increased 11.8-fold and 4.9-fold, respectively. Transcript levels of both genes started to decrease in the 48-h sample. Transcription of the genes encoding PflA1 and Adh1 (PFLA1 and ADH1) increased only 2.8-fold during the time course of S starvation. PFLA1 was maximally transcribed after 9 h of S depletion, and ADH1 showed the strongest transcription in the 48-h sample (Fig. 3).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

 
FIG. 3. Relative quantification of transcript levels of the genes encoding HydA1, Pfl1, Pfla1, and Adh1 (AdhE). RNA was isolated from S-deprived C. reinhardtii cultures at the indicated time points, and mRNA was isolated from total RNA. After first-strand synthesis, qPCR experiments were performed, and the results were normalized to the transcript level of RPL10a, encoding the 60S ribosomal protein L10a. The values are abundance of the respective transcript relative to the amount in the control sample (0 h of S depletion).

Western blot analyses confirmed the synthesis of HydA1, Pfl1, and Adh1 in S-deprived C. reinhardtii cells (Fig. 4). Analysis of algal crude protein extracts with anti-TdcE antibodies to detect Pfl1 protein revealed one significant band of the expected size (~80 kDa) and some further signals (Fig. 4 and data not shown). The characteristic double band of a radical-bearing and thus activated Pfl protein is detectable in the crude protein extracts of C. reinhardtii. HydA1 could not be detected in the control cell sample (0 h of S starvation), whereas Pfl1 was already present at this time point. In the cell samples taken thereafter (24 to 96 h of S depletion), both HydA1 and Pfl1 showed a gradual accumulation. The Adh1 protein of C. reinhardtii was detected with anti-E. coli AdhE antibodies, which showed excellent cross-reaction with an algal protein of the expected size (~100 kDa) (Fig. 4) The amount of the Adh1 protein increased in cells that had encountered S starvation for 24 h, but significant amounts of Adh1 protein were already detected in control cells (0 h) (Fig. 4).


Figure 4
View larger version (54K):
[in this window]
[in a new window]

 
FIG. 4. Western blot analysis of the synthesis of several proteins involved in anaerobic pathways. Crude protein extracts were produced from C. reinhardtii cultures at the depicted time points of S depletion. HydA1, Pfl1, Adh1 (AdhE), and Pdc proteins were detected in these protein extracts with antibodies raised against C. reinhardtii HydA1, E. coli TdcE, E. coli AdhE, and pea Pdc.

C. reinhardtii has alternative ethanol-producing pathways. The formate analogue HP (PH2O2) inhibits the E. coli Pfl enzyme irreversibly (22, 36). We treated S-deprived C. reinhardtii cultures with this inhibitor to determine whether the Pfl1 fermentation pathway was essential for C. reinhardtii under these conditions. To ensure that HP not only blocked formate transport (45) but also inhibited the Pfl1 protein, we measured formate secretion by and formate accumulation inside anaerobically adapted C. reinhardtii CC-277 cells in the absence (Fig. 5a) and the presence (Fig. 5b) of HP. The addition of HP prevented formate accumulation both in the medium and inside the algal cells (Fig. 5b), demonstrating that HP inhibits formate production by Pfl1.


Figure 5
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 5. Formate accumulation in the medium and inside anaerobically adapted C. reinhardtii CC-277 cells. A cell culture in the mid-exponential growth phase (20 µg Chl ml–1) was split into two aliquots. One of these was preincubated in the presence of 10 mM HP. After 30 min of incubation in the light, both aliquots were harvested and concentrated fivefold in fresh TAP medium. Fresh HP (50 mM) was added to the HP-pretreated culture (b). The untreated aliquot served as a control (a). Anoxic conditions were established by flushing the shaded cultures with argon. Samples of the cell suspensions were taken at the depicted time points, and formate was measured as described in Materials and Methods in the respective supernatant fractions (filled circles) and within the cells (open circles).

Next, we added 10 mM of the inhibitor to S-deprived C. reinhardtii cultures just as they had reached anaerobic conditions. Indeed, formate accumulation stopped in HP-treated cells (Fig. 6a). However, ethanol production was not inhibited by HP (Fig. 6b). This suggests an alternative route by which ethanol is produced in C. reinhardtii.


Figure 6
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 6. Formate (a), ethanol (b), CO2 (c), and H2 (d) accumulation in S-deprived C. reinhardtii cells with (black bars) or without (gray bars) HP (10 mM). (a and b) Samples were taken after the indicated time of S starvation. Formate and ethanol were measured in the supernatant fractions. (c and d) Total amounts of CO2 and H2 which had accumulated in the headspace of the cultures were quantified with a mass-spectrometric setup. Each value is the mean of five measurements from cultures with similar chlorophyll contents (17 to 20 µg Chl ml–1). The error bars indicate standard deviations.

The typical enzyme responsible for ethanol production in plants is pyruvate decarboxylase (Pdc) (for examples, see references 27 and 32). This enzyme decarboxylates pyruvate to acetaldehyde, which is subsequently reduced to ethanol by Adh. C. reinhardtii possesses a gene encoding a Pdc (protein ID 135197 in JGI3.0; GenBank no. E15259). In many cyanobacteria and other bacterial species, pyruvate can be oxidized by pyruvate ferredoxin/flavodoxin-oxidoreductase (Prf) (for examples, see references 5, 35, and 44). Prf decarboxylates pyruvate to acetyl-CoA and reduces ferredoxin or flavodoxin at the same time. Acetyl-CoA can be either reduced to ethanol or converted into acetate. A sequence with homology to known Prf proteins is present in the genomic sequence of C. reinhardtii (Prf1; protein ID 122198 in JGI3.0).

We detected the transcripts of the putative PDC and PRF1 genes by semiquantitative RT-PCR as described above. PDC transcript was present in all samples (0 to 96 h of S deprivation), whereas PRF1 transcript was not amplified in the 0-h sample but showed significant accumulation in the following samples (24 to 96 h of S starvation) (data not shown).

In Western blot analyses, a putative Pdc protein cross-reacted with antibodies raised against Pisum sativum Pdc (32) (Fig. 4). The algal Pdc protein deduced from the transcript annotated in JGI3.0 shares 54% identical amino acids with Pdc1 from P. sativum. In crude protein extracts of S-depleted C. reinhardtii cells, we detected two bands around 65 kDa and one around 42 kDa (only the ~65-kDa signals are shown in Fig. 4, since they correspond to the calculated mass of ~63 kDa of the Pdc protein). This protein pattern was also detected in pea (32). The Pdc protein is constantly present in the analyzed period (Fig. 4).

Assuming that the presence of transcripts (PDC, PRF1) and a putative Pdc protein, respectively, means the presence and activity of Pdc and Prf1 enzymes, ethanol production in HP-treated algae could be due to Pdc or Prf1 (Fig. 7). Pyruvate decarboxylation catalyzed by Pdc or Prf1 should result in higher CO2 production in the respective C. reinhardtii cultures. In fact, when the gas phases of S-deprived C. reinhardtii cultures were analyzed by mass spectrometry, it turned out that cultures supplemented with HP produced significantly larger amounts of CO2 (Fig. 6c). H2 production of the algal cultures was not significantly affected by the addition of HP. In most experiments, the H2 concentration in the headspace of S-depleted algae was slightly lower in the presence than in the absence of HP (Fig. 6d).


Figure 7
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 7. Schematic overview of the potentially ethanol-producing pathways in C. reinhardtii. Glucose is glycolytically converted to pyruvate. Pdc decarboxylates pyruvate to acetaldehyde. The latter is reduced to ethanol by an Adh. Pfl1 is activated by Pfl activase (Pfla1), which introduces a radical into the inactive (Pfl1i) polypeptide to yield the active radical harboring Pfl1 (Pfl1·). Pfl1· cleaves pyruvate into formate, which is secreted, and acetyl-CoA. The latter can be reduced to ethanol by Adh1, combining acetaldehyde dehydrogenase and Adh, or converted to acetate by the sequential actions of Pat and Ack. This reaction yields one ATP per molecule of acetyl-CoA. Prf1 decarboxylates pyruvate to acetyl-CoA and reduces ferredoxin (Fdx) at the same time. Acetyl-CoA could be converted in the same way as described for the Pfl1 pathway (indicated by a dotted line and a question mark). Hypothetically, reduced ferredoxin could serve Pfla1 as the reductant for the Pfl1-activating reaction (indicated by a question mark and a dotted line).


arrow
DISCUSSION
 
In this study it was demonstrated that the putative Pfl1 protein of C. reinhardtii is indeed a formate-producing Pfl enzyme. After heterologous expression of the algal PFL1 cDNA in the Pfl-deficient E. coli strain BL21{Delta}pfl, this strain regained the capacity for formate excretion under anaerobic conditions. Furthermore, C. reinhardtii Pfl1 that was Strep-Tag purified from E. coli BL21{Delta}pfl (E. coli AH21) was active in formate production.

Notably, the 70-amino-acid N-terminal extension sequence of the algal Pfl1 neither interferes with nor is necessary for its catalytic activity. The latter observation argues for the assumption that this N-terminal peptide has a targeting function in the alga (2).

Both in vivo and in vitro experiments clearly demonstrated that C. reinhardtii Pfl1 was synthesized in an active form in E. coli. The results also showed that Pfl activase of E. coli recognized and activated the algal Pfl1. This was further supported by the observation in Western blots of the double band characteristic of radical-bearing Pfl enzymes.

E. coli Pfl and C. reinhardtii Pfl1 have 56% sequence identity (2), and the conserved regions around the catalytic cysteine residues (IACCVS) (4) and the glycyl radical (RVSGYAV) (8) are the same in both enzymes. We have also completed the C. reinhardtii PFLA1 cDNA by PCR with rapid amplification of 5' and 3' cDNA ends (GenBank cDNA/protein no. AY831434/AAW32935; data not shown) based on a small fragment of 559 bp designated a putative Pfla-encoding sequence in GenBank (BE025007), and E. coli Pfla and C. reinhardtii Pfla1 exhibit only 36% amino acid identity. However, it has been shown that E. coli Pfla recognizes the heptapeptide sequence RVSGYAV, which surrounds the radical-harboring glycine residue (8). These sequences are identical in the Pfl proteins of E. coli and C. reinhardtii, which might be the reason for the ability of E. coli PflA to activate C. reinhardtii Pfl1.

Though E. coli pfl mutants transformed with algal PFL1 cDNAs produced formate, they were obviously not physiologically complemented by the algal Pfl1 proteins, since they did not reach the same ODs as the control strains. In fact, BL21.28 and BL21.32 behaved like BL21{Delta}pfl, whose growth was significantly impaired, as has been shown before (20). The inability of the algal Pfl1 to complement E. coli BL21{Delta}pfl might be due to its low solubility in BL21{Delta}pfl at room temperature or to the codon usage of the algal PFL1 cDNA, which differs strongly from E. coli codon usage.

We also examined the genetics and the physiology of the C. reinhardtii Pfl1 pathway in S-deprived cultures. The endogenously established anaerobiosis in S-depleted and illuminated C. reinhardtii cells is a physiological condition that might be frequently encountered by the cells in their natural habitats. In anaerobically adapted C. reinhardtii cells, the expression of the genes whose protein products are known to be involved in the Pfl pathway is transcriptionally up-regulated (2, 33). Our genetic studies showed that key genes of fermentation are similarly expressed in S-depleted C. reinhardtii cultures, indicating that the anaerobiosis established upon S starvation initiates the same regulatory events as does artificially established anaerobiosis. Furthermore, Western blot analyses of crude protein extracts from S-depleted algae not only confirm the synthesis of Pfl1 and AdhE on the protein level but also are a further indication for the similarity between the algal enzymes and their bacterial counterparts.

During S depletion, formate and ethanol are produced in significant amounts. This suggests an important role of the Pfl1 pathway during this special type of anaerobiosis (48). When S-depleted C. reinhardtii cultures were treated with HP, a formate analogue and a mechanism-based, irreversible inhibitor of E. coli Pfl (22, 24, 36), formate accumulation was abolished, demonstrating that Pfl1 was indeed responsible for formate production and could be inhibited by HP. Interestingly, ethanol accumulation was not significantly influenced by the addition of HP, showing that another pathway which produces acetaldehyde or acetyl-CoA under these conditions must be present. The fact that HP-treated, S-deprived algal cultures produced significantly more CO2 than untreated cells suggests that they produced ethanol via a pyruvate-decarboxylating pathway. Fermenting higher plants usually decarboxylate pyruvate to acetaldehyde by Pdc (for examples, see references 32 and 27). CO2 is released, while acetaldehyde is further reduced to ethanol by Adh (for examples, see reference 7). Another pathway, which is common to H2-producing prokaryotes (35, 44), involves pyruvate ferredoxin oxidoreductase (Prf)-dependent cleavage of pyruvate into CO2 and acetyl-CoA. The electrons generated during this reaction are transferred to ferredoxin or flavodoxin. Reduced ferredoxin can act as an electron donor for several hydrogenases (reference 46 and references therein). It is also noteworthy that a Prf is proposed to be involved in providing reduced flavodoxin for Pfl activation in E. coli (5).

C. reinhardtii possesses a gene encoding a Pdc and a sequence that codes for a protein with high similarity to Prf enzymes. Transcripts of both genes are detected in anaerobically adapted (33) and S-depleted (this study) algae. The deduced Pdc protein shows high similarity to plant Pdc enzymes, as analyzed by homology searches (data not shown). The fact that crude protein extracts of C. reinhardtii cross-react with pea anti-Pdc antibody and show the band pattern observed in P. sativum (32) further confirms the presence, though not the activity, of a plant-type Pdc in the alga.

At present, we cannot distinguish between the Pdc or Prf1 pathway of ethanol production in S-depleted, HP-treated cells. However, the complexity of potential ethanol-producing pathways in C. reinhardtii (Fig. 7) raises the question of the physiological role of all these capacities for NADH reoxidation. Especially in illuminated S-deprived algal cultures, H2 production by the plastidic HydA1 protein (12) is an efficient electron sink for both residual PSII activity and starch degradation (16). Thus, the additional fermentative pathways could be specialized for pyruvate degradation and disposing excess reductive equivalents, respectively, in the mitochondria and/or the cytosol. The Pfl1 pathway was shown to be located in the mitochondria and maybe also in the chloroplast (2, 26), and Pdc activity was detected almost exclusively in the cytosol of C. reinhardtii cells (26). The localization of C. reinhardtii Prf1 is unclear. If it is located in the same compartment(s) as Pfl1, Prf1 could be involved in the activation reaction of the Pfl1 polypeptide, as shown for E. coli Prf (5). On the other hand, ferredoxin reduction by Prf1 could be an electron source for H2 production, as has been shown for other organisms (reference 46 and references therein). This hypothesis, however, has never been supported with experimental data. It has been shown that the amount of the PRF1 transcript is enhanced 1,600-fold after 2 h of anaerobic incubation (33), a condition which is also characterized by strong in vitro hydrogenase activity (12, 13), albeit a low level of H2 evolution (3, 10). In our experiments, HP treatment of S-starved C. reinhardtii did not result in a higher H2 yield. H2 accumulation in the absence and presence of HP was nearly the same, and occasionally, even a decrease in H2 yield was observed in HP-treated cultures. Of course, S-deprived C. reinhardtii cells produce large amounts of H2, and changes in H2 production resulting from ferredoxin reduction by Prf1 could easily be masked.

Summarizing the available data (2, 10, 15, 24, 33, 48; this study), it becomes clear that C. reinhardtii has a Pfl system which not only is highly similar to that of E. coli but also can be biochemically integrated in the bacterial fermentative metabolism. There are only two eukaryotic lineages described to date that carry out Pfl fermentation: some chlorophyte algae, such as C. reinhardtii, and some obligate anaerobic chytrid fungi (1, 6). In the chytridiomycetes N. frontalis and Piromyces sp. strain E2, the Pfl pathway is involved in anaerobic energy production in hydrogenosomes. Interestingly, hydrogenosome-containing protists are, in addition to some species of chlorophyte algae, the only known eukaryotes in which an [Fe-Fe] hydrogenase has been characterized (18).

In C. reinhardtii, the generation of formate under all anaerobic conditions analyzed so far indicates that Pfl1 plays a central role in the anaerobic metabolism of the alga (10, 24; this study). However, this photosynthetic organism obviously has more than one means of dealing with anaerobic or microaerobic conditions, both in the dark and in the light.

C. reinhardtii can easily switch to alternative ethanol-producing (Fig. 7) and even to lactate- and glycerol-producing (10, 24; this study) pathways. This is probably an adaptation to the multiple habitats in which this acetate-consuming flagellate (37) can be found, particularly in air-saturated, illuminated freshwater lakes and ponds, less aerated and shaded puddles, and even dark, nutrient- and CO2-rich soil (42). Not least, the occurrence of multiple pathways that are typical of members of different prokaryotic and eukaryotic kingdoms makes C. reinhardtii an interesting organism for use in reconstructing early events in eukaryotic (including plant) evolution.


arrow
ACKNOWLEDGMENTS
 
This work was supported by the Studienstiftung des Deutschen Volkes, which funded A. Hemschemeier, the Deutsche Forschungsgemeinschaft (SFB 480), the European Commission (6th FP, NEST STRF Solar-H contract 516510), and the BMBF (Bio-H2).

We thank Gary Sawers (University of Halle-Wittenberg, Halle (Saale), Germany) for the gift of E. coli strain BL21{Delta}pfl and E. coli anti-TdcE antibody as well as for fruitful suggestions and comments that supported this work. P. sativum anti-Pdc antibody was a gift from Stephan König (University of Halle-Wittenberg), and E. coli anti-AdhE-antibody was donated by Dorothea Kessler (University of Heidelberg, Heidelberg, Germany). Mass-spectrometric measurement of CO2 was done with the help of Laurent Cournac (CEA Cadarache, Saint-Paul-lez-Durance, France). Finally, we thank our colleagues Danuta Krawietz and Gabriele Philipps for experimental help.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Ruhr-Universität Bochum, LS Biochemie der Pflanzen, AG Photobiotechnologie, ND2/134, Universitätsstrasse 150, 44780 Bochum, Germany. Phone: 49 234 3224282. Fax: 49 234 3214322. E-mail: anja.hemschemeier{at}rub.de Back

{triangledown} Published ahead of print on 1 February 2008. Back


arrow
REFERENCES
 
    1
  1. Akhmanova, A., F. G. J. Voncken, K. M. Hosea, H. Harhangi, J. T. Keltjens, H. J. M. op den Camp, G. D. Vogels, and J. H. P. Hackstein. 1999. A hydrogenosome with pyruvate formate-lyase: anaerobic chytrid fungi use an alternative route for pyruvate metabolism. Mol. Microbiol. 32:1103-1114.[CrossRef][Medline]
  2. 2
  3. Atteia, A., R. van Lis, G. Gelius-Dietrich, A. Adrait, J. Garin, J. Joyard, N. Rolland, and W. Martin. 2006. Pyruvate formate-lyase and a novel route of eukaryotic ATP synthesis in Chlamydomonas mitochondria. J. Biol. Chem. 281:9909-9918.[Abstract/Free Full Text]
  4. 3
  5. Bamberger, E. S., D. King, D. L. Erbes, and M. Gibbs. 1982. H2 and CO2 evolution by anaerobically adapted Chlamydomonas reinhardtii F-60. Plant Physiol. 69:1268-1273.[Abstract/Free Full Text]
  6. 4
  7. Becker, A., K. Fritz-Wolf, W. Kabsch, J. Knappe, S. Schultz, and A. F. V. Wagner. 1999. Structure and mechanism of the glycyl radical enzyme pyruvate formate-lyase. Nat. Struct. Biol. 6:969-975.[CrossRef][Medline]
  8. 5
  9. Blaschkowski, H. P., G. Neuer, M. Ludwig-Festl, and J. Knappe. 1982. Routes of flavodoxin and ferredoxin reduction in Escherichia coli. CoA-acetylating pyruvate:flavodoxin and NADP:flavodoxin oxidoreductase participating in the activation of pyruvate formate-lyase. Eur. J. Biochem. 123:563-569.[Medline]
  10. 6
  11. Boxma, B., F. Voncken, S. Jannink, T. van Alen, A. Akhmanova, S. W. H. van Weelden, J. J. van Hellemond, G. Ricard, M. Huynen, A. G. M. Tielens, and J. H. P. Hackstein. 2004. The anaerobic chytridiomycete fungus Piromyces sp. E2 produces ethanol via pyruvate:formate lyase and an alcohol dehydrogenase E. Mol. Microbiol. 51:1389-1399.[CrossRef][Medline]
  12. 7
  13. Dolferus, R., G. Marbaix, and M. Jacobs. 1985. Alcohol dehydrogenase in Arabidopsis: analysis of the induction phenomenon in plants and tissue cultures. Mol. Gen. Genet. 199:256-264.[CrossRef]
  14. 8
  15. Frey, M., M. Rothe, A. F. V. Wagner, and J. Knappe. 1994. Adenosylmethionine dependent synthesis of the glycyl radical in pyruvate formate-lyase by abstraction of the glycine C-2 pro-S hydrogen atom. J. Biol. Chem. 269:12432-12437.[Abstract/Free Full Text]
  16. 9
  17. Frey, P. A., and O. T. Magnusson. 2003. S-Adenosylmethionine: a wolf in sheep's clothing, or a rich man's adenosylcobalamin? Chem. Rev. 103:2129-2148.[CrossRef][Medline]
  18. 10
  19. Gfeller, R. P., and M. Gibbs. 1984. Fermentative metabolism of Chlamydomonas reinhardtii. I. Analysis of fermentative products from starch in dark and light. Plant Physiol. 75:212-218.[Abstract/Free Full Text]
  20. 11
  21. Goodlove, P. E., P. R. Cunningham, J. Parker, and D. P. Clark. 1989. Cloning and sequence analysis of the fermentative alcohol-dehydrogenase-encoding gene of Escherichia coli. Gene 85:209-214.[CrossRef][Medline]
  22. 12
  23. Happe, T., B. Mosler, and J. D. Naber. 1994. Induction, localization and metal content of hydrogenase in Chlamydomonas reinhardtii. Eur. J. Biochem. 222:769-775.[Medline]
  24. 13
  25. Happe, T., and A. Kaminski. 2002. Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii. Eur. J. Biochem. 269:1022-1032.[Medline]
  26. 14
  27. Harris, E. H. 1989. The Chlamydomonas sourcebook. Academic Press, Inc., San Diego, CA.
  28. 15
  29. Hemschemeier, A., and T. Happe. 2005. The exceptional photofermentative hydrogen metabolism of the green alga Chlamydomonas reinhardtii. Biochem. Soc. Trans. 33:39-41.[CrossRef][Medline]
  30. 16
  31. Hemschemeier, A., S. Fouchard, L. Cournac, G. Peltier, and T. Happe. 2008. Hydrogen production by Chlamydomonas reinhardtii: an elaborate interplay of electron sources and sinks. Planta 227:397-407.[CrossRef][Medline]
  32. 17
  33. Hesslinger, C., S. A. Fairhurst, and G. Sawers. 1998. Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Mol. Microbiol. 27:477-492.[CrossRef][Medline]
  34. 18
  35. Horner, D. S., B. Heil, T. Happe, and T. M. Embley. 2002. Iron hydrogenases-ancient enzymes in modern eukaryotes. Trends Biochem. Sci. 27:148-153.[CrossRef][Medline]
  36. 19
  37. Johanningmeier, U., and S. H. Howell. 1984. Regulation of light-harvesting chlorophyll-binding protein mRNA accumulation in Chlamydomonas reinhardi. Possible involvement of chlorophyll synthesis precursors. J. Biol. Chem. 259:13541-13549.[Abstract/Free Full Text]
  38. 20
  39. Kaiser, M., and G. Sawers. 1994. Pyruvate formate-lyase is not essential for nitrate respiration by Escherichia coli. FEMS Microbiol. Lett. 117:163-168.[CrossRef][Medline]
  40. 21
  41. Kessler, D., I. Leibrecht, and J. Knappe. 1991. Pyruvate-formate-lyase-deactivase and acetyl-CoA-reductase activities of Escherichia coli reside on a polymeric protein particle encoded by adhE. FEBS Lett. 281:59-63.[CrossRef][Medline]
  42. 22
  43. Knappe, J., F. A. Neugebauer, H. P. Blaschkowski, and M. Gänzler. 1984. Post-translational activation introduces a free radical into pyruvate formate-lyase. Proc. Natl. Acad. Sci. USA 81:1332-1335.[Abstract/Free Full Text]
  44. 23
  45. Kosourov, S., M. Seibert, and M. L. Ghirardi. 2003. Effects of extracellular pH on the metabolic pathways in sulfur-deprived, H2-producing Chlamydomonas reinhardtii cultures. Plant Cell. Physiol. 44:146-155.[Abstract/Free Full Text]
  46. 24
  47. Kreuzberg, K. 1984. Starch fermentation via a formate producing pathway in Chlamydomonas reinhardtii, Chlorogonium elongatum and Chlorella fusca. Physiol. Plant 61:87-94.[CrossRef]
  48. 25
  49. Kreuzberg, K. 1985. Pyruvate degradation via pyruvate formate lyase and the enzymes of formate fermentation in the green alga Chlorogonium elongatum. Planta 163:60-67.[CrossRef]
  50. 26
  51. Kreuzberg, K., G. Klöck, and D. Grobheiser. 1987. Subcellular distribution of pyruvate-degrading enzymes in Chlamydomonas reinhardtii studied by an improved protoplast fractionation procedure. Physiol. Plant 69:481-488.[CrossRef]
  52. 27
  53. Kürsteiner, O., I. Dupuis, and C. Kuhlemeier. 2003. The pyruvate decarboxylase 1 gene of Arabidopsis is required during anoxia but not other environmental stresses. Plant Physiol. 132:968-978.[Abstract/Free Full Text]
  54. 28
  55. Marvin-Sikkema, F. D., T. M. P. Gomes, J.-P. Grivet, J. C. Gottschal, and R. A. Prims. 1993. Characterization of hydrogenosomes and their role in glucose metabolism of Neocallimastix sp. L2. Arch. Microbiol. 160:388-396.[Medline]
  56. 29
  57. Melis, A., L. Zhang, M. Forestier, M. L. Ghirardi, and M. Seibert. 2000. Sustained photobiological hydrogen gas production upon reversible inactivation of oxygen evolution in the green alga Chlamydomonas reinhardtii. Plant Physiol. 122:127-135.[Abstract/Free Full Text]
  58. 30
  59. Melis, A., and T. Happe. 2001. Hydrogen production. Green algae as a source of energy. Plant Physiol. 127:740-748.[Abstract/Free Full Text]
  60. 31
  61. Mnatsakanyan, N., A. Vassilian, L. Navasardyan, K. Bagramyan, and A. Trchounian. 2002. Regulation of Escherichia coli formate hydrogenlyase activity by formate at alkaline pH. Curr. Microbiol. 45:281-286.[CrossRef][Medline]
  62. 32
  63. Mücke, U., S. König, and G. Hübner. 1995. Purification and characterisation of pyruvate decarboxylase from pea seeds (Pisum sativum cv. Miko). Biol. Chem. Hoppe-Seyler 376:111-117.[Medline]
  64. 33
  65. Mus, F., A. Dubini, M. Seibert, M. C. Posewitz, and A. R. Grossman. 2007. Anaerobic acclimation in Chlamydomonas reinhardtii: anoxic gene expression, hydrogenase induction and metabolic pathways. J. Biol. Chem. 282:25475-25486.[Abstract/Free Full Text]
  66. 34
  67. Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e45.[Abstract/Free Full Text]
  68. 35
  69. Pieulle, L., V. Magro, and E. C. Hatchikian. 1997. Isolation and analysis of the gene encoding the pyruvate-ferredoxin oxidoreductase of Desulfovibrio africanus, production of the recombinant enzyme in Escherichia coli, and effect of carboxy-terminal deletions on its stability. J. Bacteriol. 179:5684-5692.[Abstract/Free Full Text]
  70. 36
  71. Plaga, W., R. Frank, and J. Knappe. 1988. Catalytic-site mapping of pyruvate formate lyase. Hypophosphite reaction on the acetyl-enzyme intermediate affords carbon-phosphorus bond synthesis (1-hydroxyethylphosphonate). Eur. J. Biochem. 178:445-450.[Medline]
  72. 37
  73. Pringssheim, E. G. 1937. Beiträge zur Physiologie saprotropher Algen und Flagellaten. 3. Mitteilung: die Stellung der Azetatflagellaten in einem physiologischen Ernährungssystem. Planta 27:61-72.[CrossRef]
  74. 38
  75. Ramakers, C., J. M. Ruijter, R. H. Deprez, and A. F. Moorman. 2003. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci. Lett. 339:62-66.[CrossRef][Medline]
  76. 39
  77. Sawers, G., C. Heβlinger, N. Müller, and M. Kaiser. 1998. The glycyl radical enzyme TdcE can replace pyruvate formate-lyase in glucose fermentation. J. Bacteriol. 180:3509-3526.[Abstract/Free Full Text]
  78. 40
  79. Sawers, R. G., and D. P. Clark. 2004. Fermentative pyruvate and acetyl-CoA metabolism, chapter 3.5.3. In R. Curtiss III (ed.), Escherichia coli and Salmonella: cellular and molecular biology. ASM Press, Washington, DC. http://www.ecosal.org.
  80. 41
  81. Sawers, G. 2005. Formate and its role in hydrogen production in Escherichia coli. Biochem. Soc. Trans. 33:42-46.[CrossRef][Medline]
  82. 42
  83. Smith, G. M. 1946. The nature of sexuality in Chlamydomonas. Am. J. Bot. 33:625-630.[CrossRef]
  84. 43
  85. Sofia, H. J., G. Chen, B. G. Hetzler, J. F. Reyes-Spindola, and N. E. Miller. 2001. Radical SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic pathways with radical mechanisms: functional characterization using new analysis and information visualization methods. Nucleic Acids Res. 29:1097-1106.[Abstract/Free Full Text]
  86. 44
  87. Stal, L. J., and R. Moezelaar. 1997. Fermentation in cyanobacteria. FEMS Microbiol. Rev. 21:179-211.
  88. 45
  89. Suppmann, B., and G. Sawers. 1994. Isolation and characterization of hypophosphite-resistant mutants of Escherichia coli: identification of the FocA protein, encoded by the pfl operon, as a putative formate transporter. Mol. Microbiol. 11:965-982.[Medline]
  90. 46
  91. Vignais, P. M., B. Billoud, and J. Meyer. 2001. Classification and phylogeny of hydrogenases. FEMS Microbiol. Rev. 25:455-501.[Medline]
  92. 47
  93. Wagner, A. F. V., M. Frey, F. A. Neugebauer, W. Schäfer, and J. Knappe. 1992. The free radical in pyruvate formate-lyase is located on glycine-734. Proc. Natl. Acad. Sci. USA 89:996-1000.[Abstract/Free Full Text]
  94. 48
  95. Winkler, M., A. Hemschemeier, C. Gotor, A. Melis, and T. Happe. 2002. [Fe]-hydrogenases in green algae: photo-fermentation and hydrogen evolution under sulfur-deprivation. Int. J. Hydrogen Energy 27:1431-1439.[CrossRef]


Eukaryotic Cell, March 2008, p. 518-526, Vol. 7, No. 3
1535-9778/08/$08.00+0     doi:10.1128/EC.00368-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Dubini, A., Mus, F., Seibert, M., Grossman, A. R., Posewitz, M. C. (2009). Flexibility in Anaerobic Metabolism as Revealed in a Mutant of Chlamydomonas reinhardtii Lacking Hydrogenase Activity. J. Biol. Chem. 284: 7201-7213 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hemschemeier, A.
Right arrow Articles by Happe, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hemschemeier, A.
Right arrow Articles by Happe, T.
Right arrowPubmed/NCBI databases
*Gene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*FORMIC ACID