Previous Article | Next Article ![]()
Eukaryotic Cell, February 2008, p. 302-309, Vol. 7, No. 2
1535-9778/08/$08.00+0 doi:10.1128/EC.00310-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China,1 Department of Entomology, University of Maryland, College Park, Maryland 207422
Received 23 August 2007/ Accepted 19 November 2007
|
|
|---|
|
|
|---|
In this study, we report the identification of an M. anisopliae homolog to the yeast osmosensor SHO1 that is up-regulated in insect hemolymph and artificial high-osmotic-pressure conditions. The gene was designated Mos1 for Metarhizium osmosensor-like protein. To study its function, we used an antisense RNA interference method to suppress transcript levels of Mos1 and demonstrate that the gene links osmotic stress responses with appressorium and hyphal body differentiation, cell wall biosynthesis and virulence.
|
|
|---|
1 x 10–5) from 23 fungal species were collected for a phylogenetic analysis of the evolutionary history of MOS1. The amino acid sequences were aligned with Clustal X and a neighbor-joining tree was generated with 1,000 bootstrap replicates using the program MEGA v3.1 (9). Mos1 gene RNA interference. To study the function of Mos1, an RNA interference vector was constructed. The region (669 to 1132 bp) amplified by ShoF (CGGGATCCCCAAACATACCACGTTGCTG) and ShoR (CGGGATCCGCTTTGGCCTGATATGGGTA) was inserted into the BamHI site of pBARGPE1 (20) in the reverse direction to the GpdA promoter (Fig. 1). The orientation and sequence of the insert were verified by PCR and sequencing. The vector was linearized with ScaI, and 10 µg was used for protoplast transformation as described (20). The selected transformants were verified by PCR and maintained for five generations on potato dextrose agar (PDA) (Difco) before being used for further analyses.
![]() View larger version (20K): [in a new window] |
FIG. 1. Schematic map for vector construction. The sequences for primers are listed in Materials and Methods.
|
Growth and differentiation assays. The native wild-type strain and its antisense-Mos1 transformants were inoculated onto PDA (Difco) or PDA supplemented with 0.7 or 1.5 M KCl and incubated at 25°C or 37°C for different time periods to observe growth differences. Germination of wild-type and antisense-Mos1 spores was also compared in SDB and in SDB amended with 0.7 M, 1.0 M, or 1.5 M KCl. Production of appressoria by the wild-type and antisense-Mos1 strains was induced by inoculating spores onto locust hind wings (19). To test the effects of compounds that interfere with cell wall synthesis or cause oxidative stress (12), the wild type and antisense-Mos1 transformants were inoculated on PDA amended with calcofluor white (25 or 50 µg/ml), Congo red (250 or 500 µg/ml), or H2O2 (20 or 40 mM). Liquid biomass assays were conducted by inoculating 0.2 g (wet weight) of mycelia into 10 ml of SDB or SDB amended with 1.5 M KCl, 50 µg/ml calcofluor white, 500 µg/ml Congo red, or 40 mM H2O2, and incubating at 25°C and 200 rpm for 3 days. The growth of fungal cultures in SDB was also assayed at 37°C. The mycelia were collected and dried at 70°C to constant weight before weighing. There were three replicates for each treatment, and three independent antisense-Mos1 transformants were tested to verify reproducibility.
Insect bioassays. To investigate the effect of depleting Mos1 transcripts on virulence, insect bioassays were conducted against newly emerged fifth-instar larvae of Manduca sexta (16). Conidia of the wild-type and antisense-Mos1 strains were applied either topically by immersion of larvae in an aqueous suspension containing 1 x107 conidia/ml for 20 seconds or by injecting the second proleg with 10 µl of an aqueous suspension containing 5 x 106 spores per ml. Insects were maintained at 25°C and >90% relative humidity for 48 h and subsequently at 60 to 70% relative humidity. Each treatment had three replicates with 10 insects each, and the experiments were repeated twice. Mortality was recorded every 12 h. The median lethal time was calculated with cumulative mortality data. Additional insects were injected and bled 48 h later to observe the extent of hyphal body differentiation within the insect hemocoel.
Nucleotide sequence accession number. The Mos1 mRNA sequence has been submitted to GenBank under accession number EU106866.
|
|
|---|
![]() View larger version (15K): [in a new window] |
FIG. 2. Protein characteristics. (A) Schematic structure of MOS1 protein. (B to D) Hydropathicity analysis of MOS1 (B), Saccharomyces cerevisiae osmosensor SHO1 (C), and Candida albicans osmosensor (D), scaled by the algorithm of Kyte and Doolittle. TMR, transmembrane region. (E) Alignment of the conserved SH3 domain between MOS1 and the S. cerevisiae (SHO1S) and C. albicans (SHO1C) osmosensors. *, consensus residues.
|
![]() View larger version (20K): [in a new window] |
FIG. 3. Phylogenetic relationship of MOS1 with fungal homologs. Fungal species: BD, Batrachochytrium dendrobatidis; SC, Saccharomyces cerevisiae; CG, Candida glabrata; CA, Candida albicans; PG, Pichia guilliermondii; CI, Coccidioides immitis; CGL, Chaetomium globosum; MG, Magnaporthe grisea; NC, Neurospora crassa; GZ, Gibberella zeae; MA, Metarhizium anisopliae; PN, Phaeosphaeria nodorum; AN, Aspergillus nidulans; NF, Neosartorya fischeri; AC, Aspergillus clavatus; AF, Aspergillus fumigatus; AT, Aspergillus terreus; ANI, Aspergillus niger; AO, Aspergillus oryzae; CN, Cryptococcus neoformans var. neoformans; UM, Ustilago maydis; CC, Coprinopsis cinerea; RO, Rhizopus oryzae.
|
![]() View larger version (57K): [in a new window] |
FIG. 4. Gene expressions and Mos1 RNA interference. (A) RT-PCR analysis of Mos1 gene expression by wild-type and antisense-Mos1 strains in Manduca sexta hemolymph. (B) Mos1 gene expression by mycelia incubated in SDB amended with 0.7 M KCl, 500 µg/ml Congo red (CR), 50 µg/ml calcofluor white (CW), or 40 mM H2O2 at 25°C or in SDB at 37°C. (C). RT-PCR analysis of differential gene expression by mycelium in SDB amended with 0.7 M KCl. Mycelial inoculum from 36-h SDB cultures was transferred into insect hemolymph or SDB plus KCl medium for 0, 1, 2, 4, and 8 h. (D) Relative expression of Mos1 by wild type (calibrated as 100%) and antisense-Mos1 strains. The genes for Mcl1, Mad1, So, Mpl1, Hsp70, and 18S are described in Materials and Methods.
|
2-fold by the wild type but up-regulated >2-fold by the antisense-Mos1 transformant (Fig. 4C).
Biological characterization.
Growth of the wild type (4.72 ± 0.10 cm in colony diameter) and the antisense-Mos1 transformant (4.67 ± 0.08 cm in diameter) was not significantly different (t = 6.31; P = 0.25) at 9 days postinoculation on PDA (Fig. 5A). Both the wild-type and antisense-Mos1 strains demonstrated similar low growth rates (ca. 3.5 cm in diameter after 30 days) on PDA amended with 0.7 M KCl, but inhibition of antisense-Mos1 transformants was significantly greater than that of the wild type with 1.5 M KCl (t = 5.15; P = 7.08 x 10–3) (Fig. 5B). In addition, as described for Candida Sho1 deletion mutants (11), growth of antisense-Mos1 transformants was significantly repressed on PDA medium amended with calcofluor white at 25 µg/ml (t = 16.56; P = 2.67 x 10–5) (Fig. 5C) or 50 µg/ml (t = 14.31; P = 2.96 x 10–5) and by Congo red at 250 µg/ml (t = 8.41; P = 5.45 x 10–4) (Fig. 5D) or 500 µg/ml (t = 6.21; P = 0.025). Growth of antisense-Mos1 transformants was also repressed by addition of 20 mM H2O2 (t = 16.56; P = 3.89 x 10–5) (Fig. 5E) or 40 mM H2O2 (t = 6.31; P = 3.96 x 10–4) to induce oxidative stress. Both the wild type and antisense-Mos1 strains grew very slowly during 9 days at 37°C, but the difference between them was not significant (P = 6.31; t = 0.25) (Fig. 5F). Liquid biomass assays demonstrated similar effects as plate assays for growth repression by different compounds or stressful growth conditions (Fig. 5G). However, using dry weight measurements, we detected significant differences (
< 0.05) in growth in unamended SDB between the wild type and the antisense-Mos1 transformant.
![]() View larger version (58K): [in a new window] |
FIG. 5. Culture growth and spore germination assays. (A and B) Growth of wild-type (WT) and antisense-Mos1 strains after 9 days on PDA (A) or after 30 days on PDA amended with 1.5 M KCl (B). (C to E) Growth after 9 days at 25°C in the presence of 25 µg/ml calcofluor white (C), 250 µg/ml Congo red (D), or 20 mM H2O2 (E). (F) Growth after 9 days on PDA at 37°C. Bar, 1 cm. (G) Liquid biomass assays in SDB or SDB amended with 1.5 M KCl, 250 µg/ml Congo red (CR), 25 µg/ml calcofluor white (CW), or 20 mM H2O 2 after incubation for 3 days at either 25°C or 37°C. *, significant difference at an value of <0.05; **, significant difference at an value of <0.01. (H) Percentages of spore germination by the wild-type and antisense-Mos1 strains in SDB amended with 0.7 M KCl for different times as indicated. Error bars indicate standard deviations.
|
![]() View larger version (133K): [in a new window] |
FIG. 6. Cell differentiation. (A) Appressorium differentiation on locust hind wing by wild-type (WT) and antisense-Mos1 (B) strains at 18 h postinoculation. (C) Hyphal body differentiation by WT and (D) antisense-Mos1 strains in Manduca hemocoel at 48 h postinjection. CO, conidia; AP, appressorium; HB, hyphal body; HE, hemocytes of insect. Bar, 10 µm.
|
![]() View larger version (14K): [in a new window] |
FIG. 7. Survival of Manduca sexta larvae after infection with wild-type or antisense-Mos1 conidia. (A) Survival of Manduca larvae following topical application with suspensions of 1 x 107 conidia/ml of wild-type or antisense-Mos1 strains. Control insects were dipped in water. (B) Survival of Manduca larvae following injection into the second proleg with 10 µl of suspensions of 5 x 106 conidia/ml. Control insects were injected with 10 µl water. Error bars indicate standard deviations.
|
|
|
|---|
Expression of Mos1 is up-regulated in insect hemolymph or in artificial media with high osmolarity. Presumably, low-level expression in the absence of hyperosmotic stress is to provide sufficient MOS1 for surveillance of osmotic conditions. Up-regulation may provide increased sensitivity and signaling capacity in hyperosmotic growth conditions. In yeast, HOG1 inhibits SHO1 as part of a negative feedback loop, leading to diminished cellular responses to an osmotic-stress stimulus (6). Up-regulation of Mos1 could function to bypass this system during prolonged osmotic stress. Gene silencing by RNA interference is being increasingly used for fungal functional genomic studies (11). To explore the functions of Mos1, we used an expression vector that generates antisense RNA to the transcript encoding MOS1. Compared to those of the wild type, the spores of the antisense Mos1 transformants showed greater delays in germination with increasing concentrations of KCl, demonstrating a reduced ability to respond to osmotic stress. The ability of the transformant to still grow, albeit very slowly, on media with high osmolarity could be due to residual Mos1 mRNA or to the alternative osmotic signaling branches known to exist in yeast (12, 17).
Similar to the case for C. albicans Sho1 null mutants (12), Mos1 knockdown transformants were more sensitive to oxidative stress and perturbation of cell wall biosynthesis than the wild type. The mechanisms by which osmosensors interact with fungal cell wall development and oxidative stress responses are not clear. In yeast, SHO1 acts as a scaffold protein in the MAP kinase pathway during adaptation to high OP (12, 24). This could explain the pleiotropic effects produced by repressing Mos1, as fungal MAP kinase pathways are involved in a wide range of biological functions, including development, oxidative stress responses, and virulence (1, 8, 13). Knockdown of Mos1 did not affect expression of the immune coat protein gene Mcl1, which is specifically expressed in hemolymph (20). Mcl1 may therefore use inducers that are more precisely diagnostic of hemolymph than OP. However, knockdown of Mos1 represses expression of a subset of genes that are coordinately up-regulated during growth in hemolymph as well as some other media. OP may therefore act as a pathogenicity-related signal for M. anisopliae. The down-regulated genes included Mad1, an adhesin involved in spore germination and hyphal body differentiation (21). This could at least in part explain the delay in germination and the formation of multicellular branched hyphal bodies by antisense-Mos1 transformants that mimic the effects of disrupting Mad1. Yeast C4-methyl sterol oxidase (encoded by So) is an important component in biosynthesis of ergosterol, the compound responsible for cell membrane permeability and stiffness (2). The homolog of Metarhizium So was among the most common transcripts during growth in insect hemolymph (18). Up-regulation of So by the wild type implies that membrane permeability decreases and stiffness increases under osmotic stress, providing a barrier to solutes and cellular deformation. Conversely, down-regulation of So in antisense-Mos1 transformants suggests a diminished ability to control membrane permeability and stiffness. The perilipin homolog MPL1 covers lipid droplets, masking them from enzymolysis. Levels of MPL1 control turgor pressure and appressorium differentiation by regulating breakdown of triacylglycerols and consequent production of the osmoticant glycerol (22). Mpl1 is down-regulated by the wild type at high OP, which should allow an accumulation of glycerol in the cell, increasing intracellular OP. Conversely, Mpl1 was up-regulated after Mos1 knockdown, indicating a diminished ability to increase intracellular OP in response to osmotic stress. Heat shock proteins are known to chaperone biological responses under nonoptimal conditions, including those provided by the "shocks" of heat, cold, nutrient deprivation, and oxidative stress, etc. The knockdown mutants showed a dramatic down-regulation of Hsp70 indicative of a general decrease in osmotic and oxidative stress responses.
Bioassay data indicate that proper Mos1 functioning is important for virulence against M. sexta. Repressing Mos1 causes dysfunctional appressorium differentiation on the cuticle surface. However, the Mos1 knockdown was also less virulent if the cuticle was bypassed by injection, demonstrating the importance of adaptive responses to hemolymph OP in maintaining virulence. Further studies will be required to better understand how MOS1 interacts with other proteins/pathways during adaptation to osmotic stress and regulation of OP-mediated developmental and behavioral functions.
Published ahead of print on 30 November 2007. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»