Previous Article | Next Article ![]()
Eukaryotic Cell, January 2008, p. 154-161, Vol. 7, No. 1
1535-9778/08/$08.00+0 doi:10.1128/EC.00341-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

and
Ritsu Kamiya1,2*
Department of Biological Sciences, Graduate School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033,1 CREST, Japan Science and Technology Corporation, Kawaguchi, Japan2
Received 13 September 2007/ Accepted 23 October 2007
|
|
|---|
|
|
|---|
In a previous study, we identified the major subspecies of inner-arm dynein by ion-exchange chromatography and also noticed that the fraction of inner-arm dynein d contains two proteins of about 44 kDa and 38 kDa in addition to actin and p28 (7). None of these proteins were present in the corresponding fraction from the ida4 mutant, which has a mutation in the p28 gene and lacks dyneins a, c, and d (7), or from the ida5 mutant, which has a mutation in the gene for conventional actin and lacks dyneins a, c, d, and e (12, 13). It seemed likely that the 44- and 38-kDa proteins were subunits of dynein d. We have recently cloned the cDNA of the 38-kDa protein and shown that it is actually associated with isolated dynein d. This protein has been registered in the flagellar proteome database (17) as FAP146 and has been described as a zinc finger-like flagellum-associated protein (24).
In the present study, we cloned and sequenced the cDNA of the 44-kDa protein (p44). Our results suggest that it functions together with p38 in the docking of dynein d to the outer doublet microtubules. Homologues of this protein, as well as those of p38, are found in a wide variety of organisms with motile cilia and flagella, indicating that dyneins structurally related to dynein d are widely conserved and serve some unique functions in cilia and flagellar motility.
|
|
|---|
Isolation of axonemes. Flagella were isolated by the dibucaine method of Witman (21) and were demembranated to yield axonemes by extraction with 0.2% Nonidet P-40 in HMDEK solution (30 mM HEPES, 5 mM MgSO4, 1 mM dithiothreitol, 1 mM EGTA, and 50 mM potassium acetate [pH 7.4]).
Crude dynein extract and isolation of dynein. Crude extracts containing various dyneins were obtained by high-salt extraction of wild-type or ida5 axonemes as described elsewhere (23) and were fractionated into individual dynein species by chromatography on a Uno Q ion-exchange column (Bio-Rad). We used a Uno Q column instead of a Mono Q column to achieve better separation of dynein d.
Sucrose density gradient centrifugation. A crude dynein extract from wild-type or ida5 axonemes was layered on top of a 4.9-ml linear 5 to 20% sucrose density gradient that was prepared in HMDEK solution containing 0.2 mM protease inhibitor (Pefabloc). The gradients were centrifuged in a Hitachi RPS55T-2 swing rotor at 180,000 x g for 5.5 h at 4°C. Catalase (11.4S), aldolase (7S), bovine serum albumin (BSA) (4.4S), and RNase A (2S) were also centrifuged as sedimentation coefficient markers on separate sucrose gradients prepared in HMDEK solution. Thirteen fractions (400 µl each) were collected.
Protein identification. The p44 protein band of dynein d was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and was subsequently excised from the gels and digested with trypsin. The peptide mixture was then eluted and analyzed using an oMALDI-Qq-TOF MS/MS QSTAR Pulsar i (Applied Biosystems). The data were then used to search the C. reinhardtii genome database (JGI, version 2.0; http://genome.jgi-psf.org/chlre2/chlre2.home.html) using the Mascot search algorithm (http://www.matrixscience.com/) to identify the genomic sequences that encode each peptide.
Determination of the cDNA sequence of p44. The sequences at the 5' and 3' ends of the p44 cDNA were obtained following RACE (rapid amplification of cDNA ends) PCR. The primers used were as follows: for 5' RACE, forward primer AUAP (5'-GGCCACGCGTCGACTAGTAC-3') and reverse primer p44-R1 (5'-GCAGCAGACCCAGAGCCT-3'); for nested PCR, forward primer AUAP and reverse primer p44-R9 (5'-GGTTGTGTGTGAGGCTGAAA-3'); for 3' RACE, forward primer p44-F1 (5'-GAAGCTGCACAACCTCATTGC-3') and reverse primer AUAP; and for nested PCR, forward primer p44-F2 (5'-GGCTATCGCAGGACACACAG-3') and reverse primer AUAP. The resulting sequence of the 3' RACE was confirmed using primers p44-F5 (5'-GAACCTCACCACAGTGTACCTGAGAC-3'), p44-F9 (5'-GCGGTGTCGTACTTTGAGAAG-3'), and p44-R6 (5'-CTTCCGCTCTGGTCTACATTAGTTCC-3'). The cDNA used had been synthesized using Superscript III from poly(A)+ RNA trapped on poly(T)-anchored magnetic beads [Dynabeads Oligo(dT)25; Dynal Biotech]. Total wild-type RNA that was used for the isolation of poly(A)+ RNA was prepared by acid guanidium thiocyanate-phenol-chloroform extraction.
Northern and Southern blot analyses. To determine the size of the p44 transcript and also to detect its up-regulation upon deflagellation, total RNA was isolated from wild-type cells 45 min after deflagellation. The RNA samples were analyzed by Northern blotting using the 608-bp fragment of p44-cDNA as a probe. To determine the number of gene copies, DNA was isolated from the wild-type strain and digested with NotI, SacI, and SalI. The DNA samples were analyzed by Southern blotting using the same probe as that used for Northern blotting.
Bacterial expression of a partial amino acid sequence of p44. Amino acid residues 34 to 235 of p44 were expressed by amplifying the coding region of the cDNA by PCR with primers p44-NF (CTGGATCCAAGCTGCACAACCTCATTGC) and p44-NR (GAGAATTCCGTGCTCTCCTGCACCTC), which contained recognition sites for BamHI and EcoRI, respectively (underlined). The PCR product was ligated to the BamHI and EcoRI sites of the bacterial expression vector pCold. The resulting fusion protein contained a His tag sequence at its N terminus. Expression of the fusion protein was induced by the addition of isopropyl-β-D-thiogalactopyranoside to a logarithmically growing culture of Escherichia coli to a final concentration of 0.2 mM. Almost all of the expressed protein was contained in inclusion bodies.
Polyclonal antibody production. To produce a p44-specific antibody, the insoluble recombinant p44 protein was sequentially washed with phosphate-buffered saline (PBS) containing 1% Triton X-100, 0.5 M urea, 2 M urea, and 4 M urea, and the resulting pellet was used as an antigen to immunize two rabbits. Antibodies were affinity purified by using recombinant p44 blotted onto polyvinylidene difluoride membranes (16).
Immunoblotting. Immunoblotting was carried out using standard procedures. Immunoreactive bands were detected using an alkaline phosphatase-conjugated secondary antibody and a BCIP (5-bromo-4-chloro-3-indolylphosphate)-NBT (nitroblue tetrazolium phosphatase) solution kit (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, MD) or a horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and a TMB (3,3',5,5'-tetramethylbenzidine peroxidase) substrate kit (Vector Laboratories, Inc., Burlingame, CA). The primary-antibody dilutions used were as follows: for the affinity-purified anti-p44 antibody, 1:50 to 1:100; for the anti-p38 antibody, 1:50 to 1:100; for the anti-actin antibody, 1:50; and for the p28 antiserum, 1:5,000. The secondary goat anti-rabbit antibody was used at a dilution of 1:250 to 1:500.
Immunoprecipitation of p44. Immunoprecipitation from crude dynein extracts of the wild type or the ida5 mutant was performed using the affinity-purified anti-p44 antibody or anti-p44 antiserum. Protein A beads (Roche Diagnostics GmbH, Mannheim, Germany) were added to the mixture of the antibody, the crude dynein extract (0.5 to 1 mg/ml), and IP buffer (10 mM HEPES [pH 7.5], 5 mM MgCl2, 1 mM dithiothreitol, 0.1 mM EDTA, 25 mM KCl, 1 mM NaN3, 75 mM NaCl, 0.05% Triton X-100, 0.5 mM Pefabloc, 3% BSA), and the mixture was left standing for 1 h at 4°C. The precipitates were washed three times with IP buffer without BSA, and the samples were boiled and processed for SDS-PAGE.
Immunofluorescence microscopy. Immunofluorescence microscopy was performed using standard procedures. Nucleoflagellar apparatuses (NFA) (22) isolated from the oda1 strain were fixed with 2% paraformaldehyde for 10 min at room temperature, followed by treatment with cold acetone (–20°C). Fixed samples were stained with the affinity-purified anti-p44 antibody diluted 1:10 in immunofluorescence blocking buffer and an Alexa Fluor 488-labeled anti-rabbit immunoglobulin G (IgG) antibody diluted 1:50 in immunofluorescence blocking buffer.
Electron microscopy. Immunoelectron microscopy (immuno-EM) of whole-mount axonemes was performed according to the method of Johnson (6) with modifications. Axonemes isolated from the wild-type and ida5 strains were suspended in the HMDEK solution containing 1 mM ATP before being absorbed onto carbon-coated Ni grids. Grids were briefly dried to render the axonemes splayed, rinsed with blocking solution (0.5% BSA plus 1% fish gelatin in PBS), and then incubated for 1 h in an anti-p44 antibody diluted 1:5 to 1:10 in blocking solution. The grids were washed with blocking solution four times. After the wash, specimens were layered with anti-rabbit IgG conjugated with 10-nm-diameter colloidal gold diluted at 1:10 to 1:25 in the blocking buffer. Grids were finally washed with PBS and distilled water and were negatively stained with 1% uranyl acetate.
Semiquantitative reverse transcription-PCR (RT-PCR) of mouse NYD-SP14 protein. Total RNA was prepared from various tissues using TRIzol reagent (Invitrogen). First-strand cDNA was generated using the Transcriptor RTase kit (Roche Diagnostics GmbH, Mannheim, Germany). Semiquantitative PCR was performed using primers mNYD-SP14 F (5'-GGCTGTCGAAAGAAGAGGTG-3') and mNYD-SP14 R (5'-TTTTCCAGCATCCTGTCTGA-3'). The partial sequence of the housekeeping protein NADPH dehydrogenase was amplified as a loading control.
Other methods. SDS-PAGE was performed using 10% or 11% acrylamide gels or 3 to 5% acrylamide gels with a 3 to 8 M urea gradient (5, 14). Gels were stained with Coomassie brilliant blue (CBB) or silver. Protein concentrations were measured using the method of Bradford (1). For the sequence comparison of p44 homologues, data were aligned using ClustalW, and the output was processed with Boxshade (http://www.ch.embnet.org/index.html). Protein motifs were obtained using SMART (simple modular architecture research tool) analysis (http://smart.embl-heidelberg.de/).
Nucleotide sequence accession number. The cDNA sequence of Chlamydomonas p44 has been deposited in GenBank with accession number AB353122.
|
|
|---|
![]() View larger version (21K): [in a new window] |
FIG. 1. Separation of the inner-arm dyneins by ion-exchange chromatography. (A) Elution patterns of extracts from wild-type axonemes. Axonemes were extracted with 0.6 M KCl, and the extracts were fractionated on a Uno Q column after desaltation. Peaks a to g are fractions of inner-arm subspecies, and peaks , β, and β are outer-arm subparticles. (B) SDS-PAGE patterns of the peak fractions of inner dynein arms from wild-type axonemal extracts fractionated on a Uno Q column. Bands were separated on an 11% acrylamide gel and stained with silver. Arrows indicate actin and p28. Asterisks indicate p44 and p38.
|
![]() View larger version (52K): [in a new window] |
FIG. 2. cDNA sequence and predicted amino acid sequence of p44. Five TPR motifs and a coiled-coil region were identified by SMART analysis. Stop codons are marked by asterisks. A Chlamydomonas polyadenylation signal sequence (TGTAA) is boxed. The two partial amino acid sequences that were determined by mass spectrometry are underlined. Broken lines indicate TPR motif regions.
|
![]() View larger version (39K): [in a new window] |
FIG. 3. Characterization of p44. (A) Predicted domain structure in p44. Five TPR motifs, a coiled-coil region (light shaded box), and a low-complexity region (dark shaded box) were predicted by SMART analysis. (B) Western immunoblot analysis of wild-type (Wt) axonemes with an affinity-purified anti-p44 antibody. Only a single band of 44 kDa is recognized with the purified anti-p44 antibody. (C) SDS-PAGE of identical amounts of axonemes from various strains stained with CBB (upper panel) and Western blot of the same samples with the anti-p44 antibody (lower panel). p44 levels are diminished in the ida4 and ida5 strains. (D) Extractability in a high-salt solution. Wild-type flagella were demembranated with 0.2% NP-40, and the resulting axonemes were extracted with 0.6 M KCl. Equal amounts of sample were separated on a 10% acrylamide gel and stained with CBB (upper panel) or blotted and probed with antibodies against p44 and p28 (lower panel). Most of the p44, as well as most of the p28, was extracted with the high-salt solution. M&M, NP-40-soluble fraction; sup, KCl-soluble fraction; ppt, KCl-insoluble fraction.
|
![]() View larger version (54K): [in a new window] |
FIG. 4. Northern and Southern blot analyses of p44. (A) Northern blot analysis of Chlamydomonas mRNA showing up-regulation of the 1.6-kb p44 mRNA in deflagellated cells (45 min) relative to nondeflagellated cells (0 min). This result suggests that p44 is a flagellar protein. (B) Southern blot analysis of Chlamydomonas genomic DNA using a p44-specific probe. The blot demonstrates that p44 is present in a single copy in the Chlamydomonas genome.
|
Immunoprecipitation of a p44-containing complex. To define the proteins that are associated with p44, we carried out immunoprecipitation experiments on crude dynein extracts using the anti-p44 antibody and protein A-conjugated beads. In addition to p44, the resultant precipitate from wild-type extracts always contained actin, p38, p28, and a high-molecular-weight protein that was the size of a dynein heavy chain, as detected by gel patterns and specific antibodies (Fig. 5A). SDS-PAGE analysis using 3 to 5% acrylamide gels with a 3 to 8 M urea gradient confirmed that the high-molecular-weight protein was the dynein d heavy chain (Fig. 5B). These results indicate that p44 is associated with a complex that contains the dynein d heavy chain, actin, p38 and p28, all of which have been previously identified as the components of dynein d. A high-salt extract from ida5 axonemes, which do not contain dynein d, did not yield the dynein heavy chain, actin, or p28 in the precipitate upon addition of the anti-p44 antibody and protein A beads; interestingly, it did yield p38 (Fig. 5A). This suggests that although p44 does not associate with the dynein d heavy chain, actin, or p28 in the ida5 axonemes, it forms a complex with p38. Essentially the same result was obtained with the high-salt extract from ida4 axonemes (data not shown).
![]() View larger version (33K): [in a new window] |
FIG. 5. Silver-stained gels and corresponding Western blots of immunoprecipitates. (A) (Top panel) Silver-stained gel (10% acrylamide) of immunoprecipitates obtained from wild-type and ida5 axonemal extracts using an anti-p44 antibody. Crude dynein extracts from equivalent amounts of wild-type (Wt) and ida5 axonemes were used. Lanes +, precipitates after incubation with the anti-p44 antibody and protein A beads; lanes –, precipitates produced with protein A beads only. In the wild-type axonemal extract, the dynein heavy chain (open circle), actin (arrow), p38 (asterisk), and p28 (filled circle), in addition to p44, were precipitated using an anti-p44 antibody. In the ida5 axonemal extract, p38 (asterisk) was precipitated together with p44. p44 is not visible in the gels because it overlaps with the IgG heavy-chain band. The identity of a minor band appearing at the position of the dynein heavy chain is unknown. (Lower panels) Corresponding Western blots for immunoprecipitations were probed with antibodies against p44, p38, p28, and actin. (B) Comparison of the heavy-chain bands in immunoprecipitates (IP) with those in the dyneins separated with a Uno Q column (Fig. 1). Shown is a silver-stained urea gradient gel (3 to 5% acrylamide) of IP obtained from the wild-type axonemal extract using the anti-p44 antibody. The heavy chain of inner-arm dynein d was precipitated.
|
![]() View larger version (67K): [in a new window] |
FIG. 6. Western blots of axonemal extracts obtained from wild-type (Wt) and ida5 axonemes fractionated on 5 to 20% sucrose gradients. Fractions were probed with antibodies against p44, p38, and p28. p44 cosedimented with inner-dynein arm d at 11.3 to 13.0S on sucrose gradients of Wt axonemal extracts but sedimented in at 4.4 to 5.5S on sucrose gradients of ida5 mutant axonemal extracts.
|
![]() View larger version (107K): [in a new window] |
FIG. 7. Immunofluorescence micrographs of the NFA of the oda1 mutant (A and B) and immuno-EM of wild-type and ida5 axonemes (C and D). (A) NFA of the oda1 mutant were stained with the anti-p44 antibody, followed by Alexa Fluor 488-labeled anti-rabbit IgG. Flagella are uniformly stained, suggesting that the inner-arm dynein d is uniformly present along the length of the axoneme. (Left) Differential interference contrast images; (right) indirect immunofluorescence micrographs. (B) NFA of the oda1 mutant were stained with the anti-p38 antibody. (Left) Differential interference contrast images; (right) indirect immunofluorescence micrographs. (C and D) Wild-type (C) and ida5 (D) axonemes were detected with the anti-p44 antibody and a 10-nm-gold-labeled secondary antibody and were negatively stained with 1% uranyl acetate. Note that gold particles show an axial spacing of 100 nm (arrowheads). Bars, 5 µm in panels A and B and 200 nm in panels C and D.
|
100 nm (Fig. 7C and D). p44 exists in various organisms and tissues with motile cilia and flagella. BLAST searches identified putative homologues of p44 in a wide range of ciliated organisms, including Tetrahymena thermophila (BLAST E value, 1e–17), Trypanosoma brucei (2e–6), zebrafish (8e–14), mouse (1e–12), and human (9e–10) (Fig. 8). All of these homologues were registered as proteins of unknown function. Chlamydomonas p44 is similar to a TPR motif-containing protein, NYD-SP14, which is present in mouse and human. We examined the expression levels of the NYD-SP14 protein in various mouse tissues by semiquantitative RT-PCR (Fig. 9). The NYD-SP14 protein was strongly expressed in the lung, trachea, testis, and oviduct, i.e., tissues with motile cilia and flagella. This result suggests that the mouse NYD-SP14 protein also functions in cilia and flagella, most likely as an inner-arm dynein subunit.
![]() View larger version (93K): [in a new window] |
FIG. 8. Sequence comparison of potential homologues of p44. The sequences of Chlamydomonas p44 and homologues were aligned using ClustalW, and the output was processed with Boxshade. Characters with black and gray backgrounds represent identical and conservatively substituted amino acids, respectively. TPR motifs in the Chlamydomonas p44 sequence are underlined. The second, fourth, and fifth TPR motifs are conserved in several organisms. However, other organisms have another TPR motif between the fourth and fifth, while Trypanosoma has no TPR motifs as judged by SMART analysis. GenBank accession numbers are as follows: for Chlamydomonas p44, AB353122; for mouse NYD-SP14, NP_898919; for human NYD-SP14, NP_114162; for zebrafish p44, XP_001340503; for Tetrahymena p44, XP_001014763; for Trypanosoma p44, XP_843793.
|
![]() View larger version (57K): [in a new window] |
FIG. 9. Expression analyses of the mouse homologue of p44, NYD-SP14. (A) Expression levels of mouse NYD-SP14 protein in various tissues, assessed by semiquantitative RT-PCR. The 589-bp fragments of the NYD-SP14 mRNA sequence were amplified. (Upper panel) Amplification with 25 cycles; (lower panel) 35 cycles. NYD-SP14 is strongly expressed in tissues with motile cilia and flagella such as the lung, trachea, testis, and oviduct, suggesting its role in ciliary and flagellar activity. (B) Control experiments amplifying part of the mRNA of a housekeeping protein, NADPH dehydrogenase. (Upper panel) Amplification with 25 cycles; (lower panel) 35 cycles.
|
|
|
|---|
An interesting finding made in this study is that the axonemes of the ida4 and ida5 mutants, which lack dynein d and other inner-arm dyneins, retain a reduced amount of p44. This observation is reminiscent of our previous observation that p38, another dynein d subunit, is present in the axonemes of these mutants (24). The results of immunoprecipitation and sucrose density gradient centrifugation indicated that p44 in the axonemes of the ida5 mutant does not form a complex with a dynein heavy chain but forms a 60- to 150-kDa complex with p38. This complex may involve other proteins as well. We hypothesize that, in the wild-type axoneme, the p38/p44 complex may bind to both dynein d and another, unidentified protein on the outer doublet microtubules, thereby functioning to attach dynein d to specific loci. In the ida4 and ida5 mutants, however, the amounts of p38 and p44 attached to the axoneme differ: the level of p38 is reduced to 30 to 50%, and that of p44 is reduced to 5 to 10%, of the wild-type value. We speculate that possibly this occurs because p38 is bound to the outer doublets more strongly than p44 and because the association between p38 and p44 is not so strong.
Immuno-EM shows that p44 epitopes are localized along outer doublet microtubules at intervals of
100 nm; this distance is similar to the 96-nm axial repeat of inner dynein arms. Importantly, the
100-nm interval is also observed for the ida5 mutant, which lacks dynein d. This observation is consistent with the idea that p44 constitutes the docking site of dynein d. p44 has five TPR motifs in its amino acid sequence, as indicated by SMART analysis. The TPR motif, a motif consisting of 3 to 16 tandem repeats of 34 amino acid residues, has been found in >800 kinds of proteins from various organisms ranging from bacteria to humans. It is thought to mediate protein-protein interactions and the assembly of multiprotein complexes. A TPR motif is also found in a kinesin light chain (3). The five TPR motifs in the p44 molecule may well be involved in the interaction between dynein d and another protein, possibly participating in dynein docking. As an alternative possibility, the residual p38 and p44 present in ida5 axonemes may be derived from some minor dyneins or dynein d heavy chains that can be present in very small amounts in the mutants. However, since our sucrose density analysis of the ida5 extract indicated that the majority of p38 and p44 sediment at 4.4 to 5.5S (Fig. 6) and not at >11S, where dynein complexes sediment, it seems unlikely that all of the residual p38 and p44 are present in association with minor dyneins.
BLAST searches have indicated that p44 has putative homologues in organisms with motile cilia and flagella, such as humans and zebrafish, but not in organisms that have only immotile cilia, such as Caenorhabditis elegans. Together with the previous findings that p38 and p28 are conserved in organisms with motile cilia and flagella, our finding suggests that the subunit composition of single-headed inner-arm dyneins is conserved in a wide range of organisms. In accordance with this idea, the mouse homologue of p44, NYD-SP14, is strongly expressed in tissues with motile cilia (Fig. 9). Furthermore, p38 is a homologue of the trypanosome flagellar protein TAX-1, the depletion of which greatly impairs the motility of bloodstream trypanosomes (2). Our hypothesis that p38 and p44 form a docking complex for dynein d suggests that the motility impairment in TAX-1-depleted trypanosomes is caused by the loss of a dynein(s) homologous to dynein d.
Recent phylogenetic analyses of dynein heavy-chain genes from various organisms have shown that the genes for single-headed dyneins can be classified into three groups and that the dynein d heavy chain belongs to a group distinct from the other two groups, which contain all other Chlamydomonas single-headed dynein heavy chains (15, 20; T. Yagi et al., unpublished data). The conserved presence of p38 and p44 suggests that the single-headed dyneins that are associated with these light chains, such as dynein d of Chlamydomonas, constitute a unique subgroup of single-headed dyneins and have unique importance for axonemal activity.
This study was supported by a grant from the Ministry of Education, Culture, Sports, Science, and Technology of Japan. R.Y. is a recipient of the JSPS Fellowship for Junior Scientists.
Published ahead of print on 2 November 2007. ![]()
Present address: Structural Biology, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwake, Sakyo, Kyoto 606-8502, Japan. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»