Previous Article | Next Article ![]()
Eukaryotic Cell, September 2007, p. 1595-1605, Vol. 6, No. 9
1535-9778/07/$08.00+0 doi:10.1128/EC.00037-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
,
Section of Molecular Genetics and Microbiology, School of Biological Science and Institute of Cellular and Molecular Biology, The University of Texas at Austin, Austin, Texas 78712
Received 30 January 2007/ Accepted 14 July 2007
|
|
|---|
|
|
|---|
The predominant vegetative morphotype of W. dermatitidis is a budding yeast cell, but because of its polymorphism, it also produces pseudohyphae, moniliform hyphae, true hyphae, and sclerotic forms (see the comprehensive review by Szaniszlo [44]). At the light microscope level, the pseudohyphal and moniliform hyphal morphotypes appear similar, because both have constrictions at septal regions. However, they can be distinguished by noting that the cells of a moniliform hypha do not separate at septal regions, get progressively longer as the filament elongates, and may eventually terminate in the production of true hyphae having parallel sidewalls in optical section. In contrast, pseudohyphae are simply polarized chains of relatively normal size yeast that separate poorly. The differences between the two are even more evident at the transmission electron microscope level (31). Most importantly, and in the manner also of the true hyphae, the moniliform hyphae are distinguished from pseudohyphae by the former having septa with a single central pore and adjacent Woronin bodies, whereas the latter are devoid of such structures. In stark contrast, sclerotic cells and sclerotic bodies are isotropically enlarged, nonpolarized morphotypes that may become divided by one internal transverse septum or multiple intersecting septa (14, 45). Yeast, pseudohyphae, moniliform hyphae, true hyphae, and sclerotic forms are all found in the infected tissues. Finally conidia of W. dermatitidis are produced by relatively undifferentiated conidiophores that develop from aerial moniliform and true hyphae (32).
Yeast-to-hyphal transition in W. dermatitidis has been critically monitored by transmission electron microscopy (31). As yeast cells age on agar media, they first become isotropically enlarged, thick-walled cells that contain one or more large lipid bodies. These cells are then competent to produce moniliform and true hyphae if subcultured in fresh media. Moniliform and true hyphal growth in W. dermatitidis can also be induced under nitrogen limitation conditions and in temperature-sensitive (ts), hyphal-form mutants (44, 50, 53). On the other hand, sclerotic morphotypes can be induced in nutrient-rich media at pH 2.5, by calcium limitation at pH 6.5, and by culture of certain ts multicellular-form mutants (Mc2/cdc1 and Mc3/cdc2) at the restriction temperature (5, 14, 44, 45). Also in W. dermatitidis, WdCDC42 encodes a Rho/Rac member of small GTP-binding proteins, and the dominant active mutation WdCDC42G14V activates sclerotic growth in the wild-type strain and represses filamentous growth in both the wild type and the ts hyphal-form mutant Hf1 at 37°C (53).
APSES (Neurospora crassa Asm1p, S. cerevisiae Phd1p, Aspergillus nidulans StuAp, C. albicans Efg1p, and S. cerevisiae Sok2p) transcription factors have diverse effects on cellular development and differentiation in fungi. Among conidiogenous Ascomycota, StuAp of the obligate filamentous fungus A. nidulans is best known for its involvement in conidiation (26). Strains with mutations in STUA lack phialides and metulae. In a similar manner, deletion of PmSTUA in the dimorphic conidiogenous fungus P. marneffei also affects conidiation but does not influence its yeast-phase cells or their transition to hyphae (2). By comparison, deletion of FoSTUA in F. oxysporum represses the development of macroconidia and activates the growth of chlamydospores (30). Deletion of AfSTUA in Aspergillus fumigatus also results in abnormal conidiophores and conidia, and microarray analysis of this species shows that AfStuAp activates numerous other genes involved in development and virulence, including genes encoding secondary metabolites in the period preceding conidiogenesis (37).
Among ascomycetous yeast species, overexpression the APSES transcription factor gene PHD1 in S. cerevisiae activates pseudohyphal growth and deletion of SOK2 accelerates pseudohyphal growth to the level caused by PHD1 overexpression (10, 51). In mutants lacking SOK2, PHD1 is up-regulated to activate the expression of FLO11, which encodes a cell wall glycosylphosphatidylinositol protein required for pseudohyphal growth and biofilm formation (33, 34). However, in the dimorphic human pathogenic yeast C. albicans, mutants lacking the APSES transcription factor gene EFG1 are defective in hyphal growth under aerobic conditions, as well as in virulence (20, 43), white-phase colony production (41), and chlamydospore formation (40). Genes regulated by Efg1p include some involved in cell wall synthesis, metabolism, and cellular differentiation (7, 16, 17, 28, 38). In addition, Efg1p is known to function downstream of protein kinase A in yeast-hyphal transitions (1), and overexpression of EFG1 has been shown to lead to production of pseudohyphae instead of true hyphae. Interestingly, the transcript level of EFG1 is decreased to its lowest level during the induction of hyphal growth, and Efg1p must be repressed to allow continued apical growth (43, 46). Furthermore, under hypoxic conditions at incubation temperatures lower than 37°C, deletion of EFG1 activates filamentous growth. In this case, another set of genes is regulated, including particularly those for fatty acid biosynthesis that require Efg1p for activation (36).
Although a number of genes of W. dermatitidis encode proteins that when defective affect its morphology, nothing is known about how transcription factors control the cellular morphogenesis of this fungal pathogen of humans. Therefore, the purpose of this study was to investigate the importance of the gene WdSTUA, and particularly how its encoded APSES transcription factor affects yeast-hyphal transitions. The results reported provide numerous new insights into the importance of the APSES family of transcription factors in fungi in general, and particularly in the pathogenic fungus W. dermatitidis, a polymorphic, conidiogenous black mold with yeast-phase predominance.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Strains used in this research
|
-32P]dATP (Dupont NEN, Boston, MA). From 104 colonies screened, one positive cosmid was isolated. To subclone the fragments containing WdSTUA, Southern analysis of the cosmid digested by different restriction enzymes was also carried out with the 386-bp WdSTUA probe. After the fragments with WdSTUA were identified, they were released by digestion with XbaI, HindIII, and PstI and subcloned into the corresponding sites of the pBSKS vector (Stratagene, La Jolla, CA), yielding plasmids pBSKS-WS1, pBSKS-WS2, and pBSKS-WS3, respectively. DNA sequencing of the plasmids was performed by the Core Facility of Institute of Cellular and Molecular Biology, University of Texas at Austin, using BigDye technology (Applied Biosystems, Foster City, CA). The locations of introns, first predicted in silico by alignments and by consensus splice sequences, were then confirmed by the comparison of the cDNA sequence produced from reverse transcription-PCR (RT-PCR) using the One-Step RT-PCR kit (QIAGEN, Valencia, CA) with the genomic DNA sequence.
Deletion of WdSTUA in W. dermatitidis.
To create the WdSTUA deletion construct, which contained the hph selection marker gene (19) flanked by WdSTUA 5' and 3' sequences, a 0.8-kb PstI-SalI fragment corresponding to the 5' region of WdSTUA was first released from pBSKS-WS3 and then ligated into vector pBSKS to generate pBSKS-WS4. Next a 1.4-kb SalI-SalI hph gene sequence from pCB1636 (Fungal Genetics Stock Center, University of Kansas Medical Center) was inserted into the SalI site of pBSKS-WS4 to obtain pBSKS-WS5. After a 0.6-kb 3' region of WdSTUA was amplified from pBSKS-WS3 by PCR with primers WSF5 (GCTCTCGAGTGACTCCAAGCGACGTAAG; the introduced XhoI restriction digestion enzyme recognition site is underlined) and WSR5 (AGTGAAGCCAGGAACACATC), it was cloned into the pGEM-T Easy vector (Promega), producing pT-WS559. Subsequently, a 0.6-kb 3' region of WdSTUA was released by XhoI and SalI digestion of pT-WS559 and cloned into the XhoI site of pBSKS-WS5 to create pBSKS-WS6. Finally, pBSKS-WS6 was cut with BglI (two BglI sites exist in the pBSKS vector) and PstI to release the WS5'-hph-WS3' fragment, which was first gel purified and then used to transform competent W. dermatitidis yeast cells by electroporation as described previously (50, 54). After transformants were selected on YPDA medium containing 50 µg/ml hygromycin B (Invitrogen, Carlsbad, CA), WdstuA
strains were identified by Southern analysis, PCR, and RT-PCR. The specific primers for the PCR and RT-PCR were designed to flank the second intron of WdSTUA and had the following sequences: WSF6, AAGTCGAAGCGAAGGGAGTCT; WSR6, GAGCTTTGTCCCGTTGATGAA. For the RT-PCR, RNA was extracted with hot acidic phenol from cells grown in YPDB for 24 h at 37°C and treated with RQ1 RNase-free DNase (Promega). After the RT-PCR was carried out with the One-Step RT-PCR kit (QIAGEN), the amplification products were analyzed by electrophoresis in a 3% agarose gel with 2-log DNA markers (New England Biolabs, Ipswich, MA) as references.
The ectopic expression analyses using a vector containing an hph marker required the disruption of WdSTUA with a sur marker. For this, a construct with the sur gene flanked by 5' and 3' WdSTUA fragments was used. After the 2.8-kb sur marker was obtained by SalI digestion of pCB1551 (Fungal Genetics Stock Center, University of Kansas Medical Center), it was ligated with SalI-digested pBSKS-WS6 to produce pBSKS-WS7. The WS5'-sur-WS3' fragment was then excised by PstI digestion, gel purified, and finally used for transformation. Putative Wdstua::sur deletion strains were selected on SD agar [0.17% yeast nitrogen base, 0.5% (NH4)2SO4, 2% dextrose, 2% agar] supplemented with 20 µg/ml chlorimuron-ethyl (sulfonylurea; Fisher Scientific, Pittsburgh, PA). PCR analysis using specific primers WSF6 and WSR6 was performed to identify Wdstua::sur deletion strains by the absence of a 123-bp WdSTUA amplification product.
Northern analysis. Log-phase, 25°C-cultured W. dermatitidis yeast cells were first inoculated into YPDB at 106 cells/ml and then incubated with shaking in YPDB at 25°C or 37°C. After 24 h, the cells were collected by centrifugation and RNA was isolated with the QIAGEN RNeasy kit. The concentration of RNA was determined using an ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE), and RNA integrity was evaluated by electrophoresis in a 1% agarose gel containing 2 M formaldehyde. Probes were labeled as described above. For the WdSTUA probe, the 386-bp WdSTUA fragment from the pT-WdSTUA386 plasmid was used. After Northern hybridization, radioactive signals were detected by exposure to a phosphorimager screen, sized by comparison to a 0.24- to 9.5-kb RNA ladder (Invitrogen) and then scanned with a Molecular Imager FX Pro Plus multi-imager system (Bio-Rad, Hercules, CA).
Ectopic overexpression of WdSTUA in W. dermatitidis. The site-specific, integrative expression vector pYEX303 was used for the expression of WdSTUA in the nonessential WdPKS1 genomic locus of W. dermatitidis as described previously (52, 53). Briefly, pYEX303 contains the glaA promoter and terminator, the hph gene, a WdPKS1 targeting sequence, an Escherichia coli replication origin sequence, and a Cam resistance marker. Because WdPKS1 encodes a specific enzyme in the melanin biosynthesis pathway, the disruption of which makes black W. dermatitidis white without otherwise affecting its growth rate or morphology, numerous transformants having integrations at the same locus and in the same orientation are easily obtained for comparisons; the resulting mutants thus are not affected by random gene disruptions that might in turn adversely affect the processes being investigated (19, 53). The WdSTUA cDNA was amplified by RT-PCR (One-Step RT-PCR kit; QIAGEN) with primers WSF8, GAAGATCTAATGAACCAAACTCAATCGTATATG, and WSR9, GAAGATCTAGTGAGGCGTCGGAGGAGCTTG (the start and stop codons are indicated by italic letters, and the introduced BglII restriction digestion enzyme recognition sites are underlined). The amplified product was then cloned into the pGEM-T Easy vector, which, after sequence confirmation, produced plasmid pT-WdSTUAN, containing the 5' 1-kb WdSTUA cDNA. The 1-kb WdSTUAN cut with BglII from pT-WdSTUAN was ligated to the pYEX303 BglII site with the correct orientation to generate pYEX303-WdSTUAN. A 1-kb BamHI-SmaI sequence from pBSKS-WS1 was ligated into the BamHI-SpeI site (with the SpeI site first filled in by Klenow enzyme) of pT-WdSTUAN to create pT-WdSTUA. pT-WdSTUA was cut with NotI, next filled in with Klenow enzyme, and then cut with BglII to obtain the 2-kb WdSTUA cDNA. pYEX303 was also cut, but in this case with XbaI, before being filled in with Klenow enzyme and cut with BglII prior to being ligated with the 2-kb WdSTUA cDNA to produce pYEX303-WdSTUA. pYEX303, pYEX303-WdSTUAN, and pYEX303-WdSTUA were all linearized in the WdPKS1 targeting sequence by NarI prior to transformation of W. dermatitidis. Consistent morphotypes were observed from the numerous white transformants obtained for each constructed strain. PCR amplifications with the specific primers WSF6 and WSR6 were used to confirm that expression strains were derived. The morphotypes of the expression strains and the control strains were characterized by growth on YPMA, YPDA, and PDA.
Expression of WdSTUA in S. cerevisiae. For expression of WdSTUA in S. cerevisiae, the WdSTUA cDNA coding sequence was placed under the control of the GAL1 promoter in vector pYES2 (Invitrogen). After the 1-kb WdSTUAN was cut from pT-WdSTUAN by BglII, it was ligated to the pYES2 BamHI site with the correct orientation to produce pYES2-WdSTUAN. The BglII-NotI WdSTUA fragment from pT-WdSTUA was inserted into the BamHI-NotI site of pYES2, generating expression plasmid pYES2-WdSTUA. Plasmids pYES2, pYES2-WdSTUAN, and pYES2-WdSTUA were finally transformed into S. cerevisiae strain MR12, which contains a FLO11-promoter-lacZ reporter construct (35), kindly provided by S. Rupp (Fraunhofer IGB, Germany). To induce the GAL1 promoter, a synthetic low-ammonium raffinose agar medium [SLARA; 0.17% yeast nitrogen base, 50 µM (NH4)2SO4, 2% raffinose, and 0.2% galactose] was used for culture. For the ß-galactosidase assay, log-phase cells cultured in SD broth medium were washed and then spread on SLARA, incubated at 30°C, and, after 2 days of incubation, harvested and assayed by a standard protocol (4a). Two biological repeats were carried out. For the microarray assays, we used chips kindly produced in the laboratory of Vishy Iyer (The University of Texas at Austin). These chips carried fragments representing all genes and some intergenic sequences of the S. cerevisiae genome. Log-phase cells of strains harboring pYES2 or pYES2-WdSTUA plasmids were first cultured in SD broth medium, washed, and then spread on SLARA and incubated for 2 days at 30°C. RNA from cells harvested from SLARA was extracted with the RNeasy minikit (QIAGEN). After the RNA concentration was measured using an ND-1000 spectrophotometer (NanoDrop Technologies), the RNA quality was determined by RNA gel electrophoresis. Reverse transcription reactions were then performed with 15 µg RNA, amino allyl-modified dUTP, oligo(dT), and SuperScript II reverse transcriptase. The cDNA of the expression strain was labeled with fluorescent dye Cy5 (red, channel 2, 635 nm), and cDNA of the vector alone strain was labeled with Cy3 (green, channel 1, 532 nm). After the two labeled samples were simultaneously denatured, they were then hybridized to the same glass slide at 65°C overnight. The slides were then washed and scanned with a GenePix 4000B scanner (Axon, Union City, CA), and the resulting files were loaded to the Longhorn Microarray Database for normalization (15). Three biological repeats were carried out. Undetected spots on the array were flagged and excluded from the analysis. Spots with sum of the mean intensities of both channels (532 and 635) of more than 150 were accepted. Only genes with regulation levels of more than 1.4-fold and greater than 80% were subjected to further analysis.
Nucleotide sequence accession number. The sequence of WdSTUA was submitted to the GenBank database. The accession number is AY445507.
|
|
|---|
WdSTUA is not an essential gene, but its deletion alters colony morphology at 37°C.
To help reveal the functions of WdSTUA, its entire coding region, except for a 100-bp sequence upstream of the stop codon, was deleted from the W. dermatitidis genome by a one-step gene replacement strategy. Southern analysis, PCR, and RT-PCR showed that about 10% of the hygromycin B-resistant transformants had an hph insertion at the WdSTUA locus (see Fig. S3 in the supplemental material). Because a variety of preliminary studies revealed that the phenotypes of all the Wdstua
mutants were identical, most subsequent detailed comparisons with the wild type were carried out with the Wdstua
1A mutant.
The deletion of WdSTUA produced no phenotypic differences in growth rate or gross colony morphology between the wild type and the Wdstua
1A mutant cultured at 25°C on YPDA medium (Fig. 1A). However, because 37°C is the infection temperature W. dermatitidis encounters when introduced into the human body, the growth on YPDA of the WdSTUA deletion mutant was also compared with that of the wild-type strain at the higher temperature. The results revealed that, while the growth patterns of the wild type and the Wdstua
1A mutant at 37°C were again generally the same, the morphology of Wdstua
1A colonies was obviously distinct from that of the wild type (Fig. 1A). Specifically the Wdstua
1A strain produced colonies with surfaces that were considerably more convoluted than those of the wild type, although the colonies of both were darker and more convoluted than the colonies produced at 25°C. In addition, the morphotypes making up the colonies of the Wdstua
1A strain were two times more likely to be hypha-like, instead of yeast-like, than those of the wild-type colonies (data not shown). Furthermore, when both strains were grown in YPDB medium at 37°C, the hyphae of the Wdstua
1A strain were more aggregated than were those of the wild type (Fig. 1B). This aggregation was particularly evident after the liquid cultures were allowed to be stationary: in this case, the Wdstua
1A strain formed sediment at the bottom of a test tube more quickly than the wild type (data not shown).
![]() View larger version (80K): [in a new window] |
FIG. 1. Effects of WdSTUA disruption on growth and colony morphology on YPDA at 25°C and 37°C. (A) Yeast cells were spotted (5 µl) at 105, 104, 103, and 102 concentrations on YPDA and incubated at 25°C and 37°C. After 4 days, the growth at the spots was photographed without magnification, whereas the surface morphologies at the spots inoculated with the 102 yeast concentration were visualized with a dissecting microscope and also photographed. WT, wild type. (B) Wild-type and Wdstua 1A strains cultured with shaking in YPDB at 37°C to late log phase were visualized with a compound light microscope and then photographed. Note that the Wdstua 1A strain produced more hyphae that tended to be aggregated. Scale bar, 10 µm (applicable to the growth in both photomicrographs).
|
1A mutant both increased the diameters of their initial central yeast colonies equally (Fig. 2). However, at 25°C, the colonies of the wild type formed many long branching hyphae at the colony edges, whereas Wdstua
1A colonies produced considerably fewer hyphae, which were shorter (Fig. 2A). On CMDA and CMA, two other nitrogen-poor, hypha- and conidium-inducing media, the Wdstua
1A strain showed similar filamentation defects (data not shown). In contrast, on Sabouraud dextrose agar, a relatively nitrogen-rich medium for molds, neither the wild type nor the Wdstua
1A strain formed equivalent filamentous growth (data not shown). Therefore, we tested the effects of the WdSTUA deletion on a SLADA (50 µM NH4+) medium. As on PDA, CMA, and CMDA at 25°C, the wild type produced colonies with many hyphae, whereas the Wdstua
1A colonies exhibited considerably fewer hyphae (data not shown). When the ammonium concentration of the SLADA was increased 10-fold, hyphal growth was largely repressed, suggesting that nitrogen limitation was a critical factor in the induction of filamentous growth (data not shown). When cultured at 37°C on PDA (Fig. 2B), CMA, CMDA, and SLADA (data not shown), Wdstua
1A colonies again produced fewer hyphae than did the wild type but considerably more than at 25°C (Fig. 2A), suggesting that 37°C suppressed the inhibition of filamentation caused by the WdSTUA deletion.
![]() View larger version (117K): [in a new window] |
FIG. 2. The WdSTUA deletion reduced W. dermatitidis filamentous growth on PDA at 25°C. The wild-type (WT) and Wdstua 1A strains were streaked on PDA and incubated at 25°C (A) and 37°C (B). The filamentous growth at the colony edges was visualized with a compound light microscope, and the photomicrographs were taken after 4 days of incubation. Scale bar, 0.2 mm (applicable to all colonies in the figure).
|
1A strain was strongly repressed in aerial hyphal growth and conidiation (Fig. 3). Critical observation of the few hyphae produced by the Wdstua
1A mutant cultured in this manner showed they were obviously shorter, appeared to be pseudohyphae, and were largely covered with yeast cells. Thus, without WdStuAp, aerial hyphal development was dramatically reduced in W. dermatitidis, which consequently inhibited conidiation.
![]() View larger version (55K): [in a new window] |
FIG. 3. The WdSTUA deletion repressed aerial hyphal growth and consequently conidiogenesis. The wild-type (WT) and Wdstua 1A strains were inoculated on PDA in slide cultures and incubated at 25°C. Growth at the edge of the medium and protruding into the air space between the slide and coverslip was visualized with a compound light microscope and photographed after 2 weeks of incubation. Scale bar, 10 µm (applicable to all the growth in both photomicrographs). The arrow points to a cluster of conidia produced at the terminus of a conidiogenous hypha.
|
1A mutant is defective in invasive hyphal growth.
Hyphal growth in vitro and in vivo often includes both aerial hyphae and invasive hyphae. Because the WdSTUA deletion produced hyphal growth defects and invasive growth is sometimes important for fungal penetration of human tissues, the wild type and Wdstua
1A mutant were examined in vitro for the ability to produce invasive growth (growth that penetrates agar media). After 8 days, the yeast colonies of the mutant strain produced at 25°C on the surface of PDA plate medium containing 2% agar had formed very few hyphae of any type, whereas the wild type developed luxurious filamentous growth around and over the surface of the central yeast colonies (Fig. 4A). After the surface growth of the colonies was washed away, comparisons revealed that the wild-type strain had invaded the agar medium considerably more than had the Wdstua
1A mutant (Fig. 4B and C). Microscopic examination showed that the invasive growth of the wild type consisted of both yeast and long true hyphae, whereas that of the Wdstua
1A mutant consisted mostly of yeast (Fig. 4D). These results indicated that the Wdstua
1A mutant was defective in invasive hyphal growth.
![]() View larger version (73K): [in a new window] |
FIG. 4. The Wdstua mutant was defective in invasive growth. (A) Wild-type (WT) and Wdstua 1A cells were spotted on PDA and incubated at 25°C. After incubation for 8 days, colonies were visualized with a dissecting microscope and photographed. (B) The biomass above the agar was then rinsed away and the remaining, invasive growth photographed again. (C) Cross sections of the growth that invaded the agar. (D) The morphotypes in the invasive growth visualized with a light microscope. Scale bar, 10 µm (applicable to the growth in both photomicrographs).
|
mutants were made by the one-step gene replacement of WdSTUA in the Hf1 background. Because subsequent studies revealed that the phenotypes of these mutants were identical, only the results of the phenotypic comparisons with the Hf1 Wdstua
1 mutant are described. On YPDA medium at 37°C, the colony surfaces of Hf1 were more convoluted and were not particularly affected by the deletion of WdSTUA (Fig. 5A). However, culture of the strains on PDA medium at 25°C showed that the deletion of WdSTUA obviously reduced hyphal growth in Hf1 (Fig. 5B). Nonetheless, the deletion of WdSTUA did not completely inhibit hypha production by Hf1, suggesting that WdSTUA influenced only one hyphal developmental pathway among a number that may be triggered in Hf1. Slide culture observations showed that both Hf1 and Hf1 Wdstua
1 produced conidia on PDA at 25°C, although the conidiophores of Hf1 were longer and more abundant than those produced by the Hf1 Wdstua
1 mutant (Fig. 5C). These results demonstrated that the Hf1 Wdstua
1 strain retained the ability to produce conidia.
![]() View larger version (115K): [in a new window] |
FIG. 5. WdSTUA deletion in the Hf1 strain inhibited filamentous growth on PDA. Wild-type (WT), Wdstua 1A, Hf1, and Hf1 Wdstua 1 strains were grown on YPDA at 37°C for 6 days (A) and on PDA at 25°C for 6 days (B). The Hf1 and Hf1 Wdstua 1 strains were also inoculated on PDA for slide culture at 25°C. After 2 weeks, conidiophores and conidia were visualized with a light microscope and photographed (C). Scale bars, 10 µm (applicable to the growth in both photomicrographs). The arrows point to clusters of conidia produced at the termini of conidiogenous hyphae.
|
Wdstua
-1) were eliminated. Microscopic examination of the morphotypes making up the colonies showed that those overexpressing WdSTUA in the WdSTUA deletion strain background (Wdpks1
Wdstua
WdSTUAEct-1) as well as in the presence of the wild-type WdSTUA gene (Wdpks1
WdSTUAWt WdSTUAEct-1) were the least hyphal among the strains tested (data not shown). Moreover, on PDA at 37°C, hyphal growth was also most inhibited in the same two overexpression strains among the strains tested (Fig. 6B). In this case, the WdSTUA deletion mutant (Wdpks1
Wdstua
-1) produced fewer filaments at the colony periphery than the wild type, and the two overexpression strains produced the least number of filaments. This inhibition of morphotype transition by WdSTUA overexpression in the absence of wild-type WdSTUA and in the presence of wild-type WdSTUA was also observed when the strains were cultured on PDA at 25°C (Fig. 6C). Moreover, the overexpression of WdSTUA in the Hf1 strain also repressed the convoluted colony surface growth on YPDA at 37°C and hyphal growth on PDA at 37°C and 25°C (data not shown). Confirmation that the WdSTUA RNA levels were increased in the ectopically overexpressed strains was obtained by Northern analyses of cells cultured in PDB and YPDB at 25°C and 37°C (see Fig. S4 in the supplemental material), which showed that wild-type endogenous WdSTUA produced a transcript of about 3 kb, whereas the overexpressed WdSTUA under the control of the glaA promoter-terminator produced a transcript of about 2 kb, due to the reduced sizes of the 5' and 3' untranslated regions. The results from these experiments showed that the overexpression of WdSTUA in W. dermatitidis strongly repressed filamentous growth. In contrast, the ectopic expression of only the amino-terminal half of WdStuAp had no effect (data not shown), suggesting that full-length WdStuAp is required for its function in W. dermatitidis.
![]() View larger version (77K): [in a new window] |
FIG. 6. Ectopic overexpression of WdSTUA in W. dermatitidis. Strains were grown on YPDA at 37°C (A) and PDA at 37°C (B) and 25°C (C). After 5 days of incubation, colonies were photographed with the aid of a dissecting microscope.
|
|
|
|---|
After the WdSTUA gene of W. dermatitidis was identified and cloned by a degenerate PCR method, our analyses showed that its APSES DNA-binding domain was well conserved, implying it evolved early among fungi and has remained relatively unchanged since. Similar to its homologs in other filamentous, conidiogenous fungi (2, 26, 30), WdSTUA has three introns near and at the region encoding the 78-amino-acid APSES domain. Multiple alignment of WdStuAp with orthologs of closely related filamentous fungi showed several conserved sequence fragments (see Fig. S1C in the supplemental material): first, residues 122 to 231, a region that includes the APSES domain; second, residues 308 to 321, a region rich in proline, serine, and threonine; third, residues 359 to 371, a second region also rich in proline, serine, and threonine; fourth, residues 577 to 581, a cluster of charged amino acids; and fifth, residues 598 to 601, a region of all positive amino acids that contains a predicted nuclear localization signal. We speculate that these sequences play important roles in WdStuAp interactions with other proteins and in regulation. In contrast with the finding that PmSTUA transcripts are detected only in conidiogenous cells (2), our Northern analysis showed that WdSTUA was expressed at similar levels during vegetative growth in YPDB at 25°C and 37°C (see Fig. S2 in the supplemental material), as well as when cells were cultured on PDA for 6 days (data not shown). Therefore, the expression patterns for WdSTUA were more like those of the FoSTUA and AnSTUA transcripts, which are also expressed during the periods of vegetative growth and conidiation (25, 30).
A functional characterization of WdStuAp was possible because the deletion of WdSTUA from the W. dermatitidis genome was not a lethal event. This allowed for the production of numerous Wdstua
knockout mutants, not only in the wild-type strain but also in a strain defective in melanin biosynthesis (Wdpks1
-1 strain) and in a ts, so-called hyphal-form mutant strain (Hf1). In spite of these different genetic backgrounds, all of the mutants that were derived having a WdSTUA deletion exhibited the same general characteristics, with the expected exceptions that the Wdpks1
Wdstua
double mutants were albino and the Hf1 Wdstua
double mutants tended to produce more hyphae. Unfortunately, for unknown reasons, our attempts to disrupt WdSTUA in our ts Mc3 (Wdcdc2) mutant, which converts to sclerotic cells and sclerotic bodies that can undergo slow fission at 37°C, were unsuccessful. Therefore, we investigated whether the WdSTUA deletion affected the production of sclerotic bodies and their ability to proliferate by slow fission when induced by pH 2.5 (50). In the manner of the wild type, the Wdstua
strain still produced normal numbers of sclerotic cells, planate cells, and sclerotic bodies, with the last retaining the ability to undergo slow fission (data not shown). This is in agreement with a previous report that yeast growth by fission in P. marneffei is not affected by PmSTUA deletion (2).
The initial observation suggesting that deletion of WdSTUA might affect morphotype transitions between yeast and hyphae in W. dermatitidis was our finding that the Wdstua
deletion strains produced colonies with more convoluted surfaces than those of the wild type during culture on rich YPDA medium at 37°C (Fig. 1). Colonies of the Wdstua
mutants were also found to be less convoluted than those of the ts Hf1 strain at 37°C (Fig. 5A), suggesting that WdStuAp is associated with partial expression of this trait. Among ascomycetous yeast species, such correlations between colony morphology changes and morphotype changes, such as those associated with white-opaque colony morphology switching of the WO-1 strain, are best known in C. albicans (39). EFG1 deletion strains of this pathogen display opaque colonies that contain elongated yeast (41), and it is well documented that Efg1p is required for a subset of characteristics associated with this colony switching event (42). In S. cerevisiae, convoluted colony morphology is similarly reported to be related to the polarized growth of yeast cells and to cell wall adhesin proteins (49).
WdSTUA is required not only for smooth yeast colonial growth on YPDA at 37°C, but also for vigorous aerial and invasive hyphal growth on PDA at 25°C (Fig. 2, 3, and 4). For aerial and invasive hyphal growth to occur, new cell wall proteins are often required. For example, hydrophobins are cell wall proteins reported to be necessary for aerial hyphal growth, which serve as activators to overcome surface tensions and to provide hydrophobic surfaces on aerial hyphae to prevent desiccation (8). In S. cerevisiae, FLO11 is required for pseudohyphal growth on the colony periphery and cell adhesion to substrates (48). And in C. albicans, many cell wall genes have been identified as hyphal phase specific, required for biofilm formation (18, 29). We speculate that WdStuAp may also activate similar cell wall proteins. In addition, WdStuAp appears to be part of a network of pathways needed to produce hyphae during development. For example, the repression of hyphal growth in the Wdstua
mutant at 25°C on PDA was suppressed by 37°C (Fig. 2). Also, WdSTUA deletion in the ts hyphal-form mutant strain Hf1 still permitted hyphal production to some degree even at 25°C (Fig. 5B). Possibly the elevation of the temperature of culture of W. dermatitidis and mutations in Hf1 stimulated other parallel pathways to suppress the Wdstua
phenotype.
Overexpression of WdSTUA in W. dermatitidis under the control of the glaA promoter repressed filamentous growth (Fig. 6). These results are in general agreement with those obtained with C. albicans, which documented that EFG1 overexpression causes a switch from the opaque-phase phenotype to the white-phase phenotype (41), represses true hyphal growth, and induces pseudohyphal development (43, 46). After the initiation of hyphal growth in C. albicans, EFG1 expression is immediately repressed at the beginning of the filamentation process. We suspect that, when WdSTUA is not under the control of its own promoter, the inhibition of its expression after the initiation of filamentation also does not occur. Consequently, the hyphal morphotypes are not induced. Furthermore, because filamentous growth was more strongly repressed by the overexpression of WdSTUA than by its deletion, we additionally suspect that WdSTUA overexpression may affect other pathways that repress filamentous growth. It is interesting to note that, in contrast to the repressive effects of overexpression of WdSTUA in W. dermatitidis, the overexpression of WdSTUA, in the manner of PHD1 and EFG1, induced pseudohyphal growth in S. cerevisiae (see Fig. S5 in the supplemental material) (10, 35).
In summary, this study determined that WdStuAp is an important regulator of yeast-hyphal transitions in W. dermatitidis. Our results document for the first time among conidiogenous fungi that this APSES transcription factor can act both as a positive and negative regulator. Our evidence for this conclusion is that WdSTUA overexpression strongly repressed W. dermatitidis filamentous growth and that, at the wild-type WdSTUA expression level, WdStuAp negatively regulated filamentous growth on rich media at 37°C and positively regulated filamentous growth on nitrogen-poor media at 25°C. We anticipate that further exploration of the mechanism of WdStuAp function in this fungus will help us better understand the complex mechanisms controlling yeast and hyphal transitions and ultimately their contribution to fungal pathogenesis.
This research was supported by a grant to P.J.S. from the National Institute of Allergy and Infectious Disease (AI33049).
Published ahead of print on 10 August 2007. ![]()
Supplemental material for this article may be found at http://ec.asm.org/. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»