Previous Article
Eukaryotic Cell, November 2007, p. 2163-2167, Vol. 6, No. 11
1535-9778/07/$08.00+0 doi:10.1128/EC.00324-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Two Iron-Responsive Promoter Elements Control Expression of FOX1 in Chlamydomonas reinhardtii
Xiaodong Deng
and
Mats Eriksson*
Umeå Plant Science Center, Umeå University, SE-901 87 Umeå, Sweden
Received 30 August 2007/
Accepted 11 September 2007

ABSTRACT
FOX1 encodes an iron deficiency-induced ferroxidase involved
in a high-affinity iron uptake system. Mutagenesis analysis
of the
FOX1 promoter identified two separate iron-responsive
elements, FeRE1 (CACACG) and FeRE2 (CACGCG), between positions
–87 and –82 and between positions –65 and
–60, respectively, and both are needed for induced
FOX1 expression under conditions of iron deficiency.

TEXT
Iron and other transition metals are essential for virtually
all forms of living organisms; however, iron overload can lead
to the production of highly reactive hydroxyl radicals through
the Fenton reaction. To manage this balancing act between deficiency
and overload, a cell must have precise mechanisms to regulate
its gene/protein expression and its iron uptake and use. How
this regulation is achieved in animal systems and in yeast is
well characterized, but almost nothing is known about how these
mechanisms function in plants. It is important that we better
understand this regulation in plants, since iron deficiency
frequently limits both the growth of microalgae in the oceans
(
2) and that of agricultural crops (
11). The former is important
since oceanic microalgae are a major sink for atmospheric CO
2 and the latter because it leads to reduced yields and decreased
nutritional quality of crops. In plants, two major strategies
to acquire iron have evolved. Nongraminaceous plants use strategy
I, a reduction strategy in which Fe
3+ is solubilized in the
rhizosphere by extruded protons, reduced to Fe
2+ by an iron
reductase, and taken up by an iron transporter. The other iron
uptake strategy in plants, strategy II, is found in grasses
(graminaceous monocots). Phytosiderophores are secreted into
the rhizosphere, where they form stable Fe(III) chelates, which
are transported into the root cells by specific transport systems
(
4,
20,
22). No iron-responsive promoter element (FeRE) that
controls the expression of proteins induced by iron deficiency
has been experimentally identified in a strategy I plant. However,
in
Arabidopsis thaliana, as many as 72 to 179 iron-regulated
genes depend on the basic helix-loop-helix (bHLH) transcription
factor FIT1 for their expression (
3), and although the FeRE
that FIT1 binds to has not been determined, bHLH factors are
known to bind to the hexanucleotide E-box sequence CANNTG. A
homolog of FIT1, FER, has also been identified in tomato (
Lycopersicon esculentum) (
18). In the strategy II plant barley, two FeREs
have been identified in the
IDS2 gene (
15,
16). These two FeREs
are IDE1 (ATCAAGCATGCTTCTTGC) and IDE2 (TTGAACGGCAAGTTTCACGCTGTCACT).
The exact 5' and 3' borders of the cores of the FeREs in IDE1
and IDE2 have not been determined (IDE1 and IDE2 were defined
by mutating the nucleotides of promoter regions needed for iron-regulated
expression nine at a time), but when other iron-responsive genes
from strategy II plants were searched for this sequence, several
genes with similar motifs were found and a consensus sequence
of CAAGCCTGCTTC(T/A)TGC was defined (
16). Motifs fitting this
consensus were also found in three
A. thaliana genes (strategy
I plant), but it has not been experimentally proven that these
motifs act as FeREs in these genes. To better understand iron
uptake in plants, we wanted to identify FeREs in a strategy
I plant, and when studying plant processes, a valuable tool
is often the use of less-complex photosynthetic organisms as
model systems. One organism used to elucidate many processes
in photosynthesis and other plant functions is the eukaryotic
unicellular green alga
Chlamydomonas reinhardtii (
13). In
C. reinhardtii, iron reductase and iron uptake activities are induced
under iron-deficient conditions, and it is therefore proposed
to use an iron uptake system similar to that of strategy I plants
(
9); this organism is especially well suited for use when studying
metal-regulated gene expression, because since it requires only
a few simple salts to grow, it is easy to control the exact
metal concentrations in its growth medium. In the work presented
here, we have analyzed the promoter of
FOX1, which encodes an
iron deficiency-induced ferroxidase involved in iron uptake
(
17). We have used
C. reinhardtii strain CC425 (
cw15 arg2),
which was grown according to the method of Harris (
12) in either
liquid Tris-acetate-phosphate (TAP) medium in an orbital shaker
(250 rpm, 25°C, and continuous light of 150 µmol m
–2 s
–1) or on solid TAP agar plates (22°C and 100 µmol
m
–2 s
–1). The medium was prepared either with normal
trace elements, giving it an iron concentration of 18 µM
(iron sufficient) (+Fe), or with iron-free trace elements, giving
it an iron concentration of 20 nM Fe (iron deficient) (–Fe).
To analyze the
FOX1 promoter for FeREs, we made a series of
5' and 3' deletions of the promoter and fused them to the reporter
gene
ARS (arylsulfatase) in either plasmid pJD54 or pJD100.
In pJD54 the reporter gene is promoterless (
6), and in pJD100
it is driven by a minimal promoter element derived from the
C. reinhardtii ß
2-tubulin gene (
5). These constructs
were transformed into
C. reinhardtii by cotransformation with
pArg7.8 (
7,
14), and obtained transformants were screened for
secreted arylsulfatase after 24 h on XSO
4-TAP plates with or
without Fe (+/–Fe) (
6) (the presence of a blue halo around
the colony); for key constructs, we measured the transcription
of
ARS on three representative transformants by using real-time
PCR under +/–Fe conditions. The results are summarized
in Fig.
1, and the conclusion was that the FeRE(s) of
FOX1 is
located in the –103 to –41 region relative to the
transcription start site. The sequences of all constructs were
confirmed by DNA sequencing, and primers used to make them are
listed in Table
1.
To determine exactly which nucleotides in the –103 to
–41 region are important for the regulation, we used a
scanning mutagenesis analysis strategy, and for methodological
reasons we analyzed the –103 to –77 region and the
–76 to –41 region separately. To analyze the –103
to –77 region, nine constructs were generated by mutating
the nucleotides in this region three by three in a –103
to +65 fragment and fusing these with pJD54 (Table
2, M103F
to M79F). The mutations were made by using PCR with a forward
primer, covering the region containing the desired mutation
and a KpnI restriction site at the 5' end, and the reverse primer,
SalI-65R (the sequence complementary to +46 to +65 relative
to the
FOX1 transcription start site and a SalI restriction
site). To better quantify the expression of arylsulfatase, the
activity was measured in liquid cultures using the method described
by de Hostos et al. (
8). In Table
2, it can be seen that the
mutations in three of these constructs (M88F, M85F, and M82F)
render them noninducible, showing that the sequence from –88
to –80 (GCACACGCC) contains the core of a FeRE. In a second
series of mutagenesis, these nine nucleotides were mutagenized
one by one to each of three other possible nucleotides (Table
2, FM2 to FM28), and from the lack of inducible arylsulfatase
activity in cells transformed with constructs FM5 to FM9, FM11
to FM15, FM17 to FM19, FM21, and FM22, it could be determined
that the sequence from –87 to –82, CACACG, is the
core motif of this FeRE; we designated this motif FeRE1. From
the single-nucleotide mutations, it can also be seen that the
substitutions of A to G in construct FM10, A to G in construct
FM16, and G to T in FM20 did not result in a significant decrease
of arylsulfatase activity, indicating that changing the sequence
to these nucleotides will also give a functional FeRE. The consensus
sequence of the
FOX1 FeRE1 is therefore C(A/G)C(A/G)C(G/T).
To analyze the –76 to –41 region, these nucleotides
were mutated one to five at a time in the –103 to –41
fragment pJF41R (Table
2, constructs M73R to M41R) and fused
to pJD100. To make the mutations, a reverse primer covering
the region containing the desired mutation and with a KpnI restriction
site added at the 5' end was used in combination with a forward
primer with a KpnI restriction site and the –103 to –86
region. Iron responsiveness could be measured for all constructs
except for M60R, M61R, and M65R, and this shows that the sequence
from –65 to –60 (CACGCG) is another
FOX1 FeRE. This
FeRE is not identical to FeRE1, but it fits the FeRE1 consensus
sequence, and we designated this element FeRE2. It should, however,
be noted that FeRE1 is still functional if the last nucleotide
is changed from a G to a T, whereas doing the same substitution
in FeRE2 abolishes iron regulation (constructs FM20 and M60R
in Table
2). From the observation that with nonfunctional FeREs
we receive a low level of expression under both +Fe and –Fe
conditions, we can also draw the conclusion that these FeREs
function as binding sites for activators during iron-deficient
conditions and not for repressors under iron-sufficient conditions.
If they had been repressor elements, with mutated FeREs, we
would instead have seen an increase of expression under +Fe
conditions.
When searching for the FeRE1 consensus in the IDE1 and IDE2
elements in barley, the only exact match was the sequence CACGCT
in IDE2, but since the T in this sequence is outside the IDE
consensus motif and because of the poor similarity to IDE1 in
this region, we doubt that these are homologous motifs. A more
striking similarity to the IDE consensus is seen directly upstream
of FeRE1; if a 1-nucleotide gap is inserted, 11
Chlamydomonas nucleotides are identical to the 16-nucleotide IDE consensus
(Fig.
2). From the data in Table
2, we know that this region
is not needed for iron-regulated expression of
FOX1, but further
investigations are needed to clarify if this sequence has a
regulatory role under circumstances not tested in this study.
There are two other systems to regulate gene expression under
iron deficiency that have been described. In
Saccharomyces cerevisiae,
the transcription factors Aft1p and Aft2p activate the transcription
of a set of more than 10 genes involved in the reductive and
nonreductive uptake of iron into the cell (
21), and they bind
to a common FeRE motif with the consensus core (C/T)(A/G)CACCC(A/G).
When the
C. reinhardtii FeREs are compared with this consensus
motif, it is seen that five out of six
Chlamydomonas nucleotides
are identical to the yeast consensus FeRE sequence (Fig.
2).
We want to emphasize that this similarity is not enough to show
that these two systems are homologous, but it is important to
note that they are similar. We have searched the
C. reinhardtii genome and expressed-sequence-tag database using the protein
sequences of Aft1p and Aft2p, but we cannot find any
Chlamydomonas homologues to these two transcription factors. Another aspect
that argues against similar transcription factors is the fact
that in yeast only one copy of the FeRE is needed, whereas in
the
Chlamydomonas FOX1 promoter two FeREs are needed to get
iron-regulated gene expression. In both
Arabidopsis and tomato,
a putative bHLH transcription factor controls the induction
of a number of genes at the onset of iron deficiency (
3,
18).
The nucleotide sequence that such transcription factors bind
to is CANNTG, but although five of six nucleotides in the
Chlamydomonas FeREs fit this motif (see Fig.
2), we do not believe these systems
are homologous. The strongest argument against such homology
is that the fifth nucleotide of the bHLH-binding site must be
a T, whereas in
Chlamydomonas, to get a functioning FeRE a C
must be at this position (Table
2). Other arguments against
similar regulatory systems in
Chlamydomonas and
Arabidopsis/tomato
are the same as in the case with the yeast: only one copy of
the bHLH motif is needed in
Arabidopsis and tomato, and no
FIT1 homolog can be found when searching the
Chlamydomonas genome.
During review of the manuscript, FeREs in another
Chlamydomonas gene,
ATX1, were identified (
10), but the sequences are completely
different from those of the FeREs identified in this work. When
we search five other
Chlamydomonas genes also shown to be iron
responsive at the transcriptional level (
1,
17) for
FOX1 and
ATX1 FeREs, the FeREs of
FOX1 are found upstream of
FER1, FEA1,
and
FEA2 and the
ATX1 FeREs upstream of
FTR1, FRE1, FEA1, and
FEA2. In conclusion, the data presented here show that the FeREs
in
FOX1 are different from those in all other previously described
iron-regulatory systems and that there are (at least) two classes
of FeREs in
Chlamydomonas.

ACKNOWLEDGMENTS
We thank Arthur Grossman and Jeffrey Moseley, Carnegie Institution
of Washington, Stanford, CA, for plasmids pJD54 and pJD100.
This work was supported by grants from the Swedish Research Council (to M.E.), the Knut and Alice Wallenberg Foundation (to M.E.), and the Kempe Foundations (to X.D.).

FOOTNOTES
* Corresponding author. Mailing address: Umeå Plant Science Center, Umeå University, SE-901 87 Umeå, Sweden. Phone: 46-90-7866918. Fax: 46-90-7866676. E-mail:
mats.eriksson{at}plantphys.umu.se 
Published ahead of print on 28 September 2007. 
Present address: State Key Laboratory of Tropical Crop Biotechnology, Institute of Tropical Bioscience and Biotechnology, Chinese Agricultural Academy for Tropical Crops, Haikou 571101, China. 

REFERENCES
1 - Allen, M. D., J. A. del Campo, J. Kropat, and S. S. Merchant. 27 July 2007. FEA1, FEA2, and FRE1, encoding two homologous secreted proteins and a candidate ferrireductase, are expressed coordinately with FOX1 and FTR1 in iron-deficient Chlamydomonas reinhardtii. Eukaryot. Cell. [Epub ahead of print.] doi:10.1128/EC.00205-07.[Abstract/Free Full Text]
2 - Behrenfeld, M. J., A. J. Bale, Z. S. Kolber, J. Aiken, and P. G. Falkowski. 1996. Confirmation of iron limitation of phytoplankton photosynthesis in the equatorial Pacific Ocean. Nature 383:508-511.[CrossRef]
3 - Colangelo, E. P., and M. L. Guerinot. 2004. The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response. Plant Cell 16:3400-3412.[Abstract/Free Full Text]
4 - Curie, C., Z. Panaviene, C. Loulergue, S. L. Dellaporta, J. F. Briat, and E. L. Walker. 2001. Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 409:346-349.[CrossRef][Medline]
5 - Davies, J. P., and A. R. Grossman. 1994. Sequences controlling transcription of the Chlamydomonas reinhardtii ß2-tubulin gene after deflagellation and during the cell cycle. Mol. Cell. Biol. 14:5165-5174.[Abstract/Free Full Text]
6 - Davies, J. P., D. P. Weeks, and A. R. Grossman. 1992. Expression of the arylsulfatase gene from the ß2-tubulin promoter in Chlamydomonas reinhardtii. Nucleic Acids Res. 20:2959-2965.[Abstract/Free Full Text]
7 - Debuchy, R., S. Purton, and J. D. Rochaix. 1989. The argininosuccinate lyase gene of Chlamydomonas reinhardtii: an important tool for nuclear transformation and for correlating the genetic and molecular maps of the ARG7 locus. EMBO J. 8:2803-2809.[Medline]
8 - de Hostos, E. L., R. K. Togasaki, and A. Grossman. 1988. Purification and biosynthesis of a derepressible periplasmic arylsulfatase from Chlamydomonas reinhardtii. J. Cell Biol. 106:29-37.[Abstract/Free Full Text]
9 - Eckhardt, U., and T. J. Buckhout. 1998. Iron assimilation in Chlamydomonas reinhardtii involves ferric reduction and is similar to Strategy I higher plants. J. Exp. Bot. 49:1219-1226.[Abstract/Free Full Text]
10 - Fei, X., and X. Deng. 21 August 2007. A novel Fe deficiency responsive element (FeRE) regulates the expression of atx1 in Chlamydomonas reinharditii. Plant Cell Physiol. [Epub ahead of print.] doi:10.1093/pcp/pcm110.[Abstract/Free Full Text]
11 - Guerinot, M. L., and Y. Yi. 1994. Iron: nutritious, noxious, and not readily available. Plant Physiol. 104:815-820.[CrossRef][Medline]
12 - Harris, E. H. 1989. The Chlamydomonas source book: a comprehensive guide to biology and laboratory use. Academic Press, San Diego, CA.
13 - Harris, E. H. 1998. Introduction to Chlamydomonas, p. 1-11. In J.-D. Rocheix, M. Goldschmidt-Clermont, and S. Merchant (ed.), The molecular biology of chloroplast and mitochondria in Chlamydomonas. Kluwer Academic Publishers, Dordrecht, The Netherlands.
14 - Kindle, K. L. 1990. High frequency nuclear transformation of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 87:1228-1232.[Abstract/Free Full Text]
15 - Kobayashi, T., M. Suzuki, H. Inoue, R. N. Itai, M. Takahashi, H. Nakanishi, S. Mori, and N. K. Nishizawa. 2005. Expression of iron-acquisition-related genes in iron-deficient rice is coordinately induced by partially conserved iron-deficiency-responsive elements. J. Exp. Bot. 56:1305-1316.[Abstract/Free Full Text]
16 - Kobayashi, T., Y. Nakayama, R. N. Itai, H. Nakanishi, T. Yoshihara, S. Mori, and N. K. Nishizawa. 2003. Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. Plant J. 36:780-793.[CrossRef][Medline]
17 - La Fontaine, S., J. M. Quinn, S. S. Nakamoto, M. D. Page, V. Göhre, J. L. Moseley, J. Kropat, and S. Merchant. 2002. Copper-dependent iron assimilation pathway in the model photosynthetic eukaryote Chlamydomonas reinhardtii. Eukaryot. Cell 1:736-757.[Abstract/Free Full Text]
18 - Ling, H.-Q., P. Bauer, Z. Bereczky, B. Keller, and M. Ganal. 2002. The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc. Natl. Acad. Sci. USA 99:13938-13943.[Abstract/Free Full Text]
19 - Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402-408.[CrossRef][Medline]
20 - Römheld, V., and H. Marchner. 1986. Evidence for a specific uptake system for iron phytosiderophores in roots of grasses. Plant Physiol. 80:175-180.[Abstract/Free Full Text]
21 - Rutherford, J. C., and A. J. Bird. 2004. Metal-responsive transcription factors that regulate iron, zinc, and copper homeostasis in eukaryotic cells. Eukaryot. Cell. 3:1-13.[Free Full Text]
22 - Takagi, S., K. Nomoto, and T. Takemoto. 1984. Physiological aspects of muginic acid, a possible phytosiderophore of graminaceous plants. J. Plant Nutr. 7:469-477.[CrossRef]
Eukaryotic Cell, November 2007, p. 2163-2167, Vol. 6, No. 11
1535-9778/07/$08.00+0 doi:10.1128/EC.00324-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Strozycki, P. M., Szymanski, M., Szczurek, A., Barciszewski, J., Figlerowicz, M.
(2010). A New Family of Ferritin Genes from Lupinus luteus--Comparative Analysis of Plant Ferritins, Their Gene Structure, and Evolution. Mol Biol Evol
27: 91-101
[Abstract]
[Full Text]
-
Fei, X., Eriksson, M., Yang, J., Deng, X.
(2009). An Fe Deficiency Responsive Element with a Core Sequence of TGGCA Regulates the Expression of FEA1 in Chlamydomonas reinharditii. J Biochem
146: 157-166
[Abstract]
[Full Text]
-
Long, J. C., Sommer, F., Allen, M. D., Lu, S.-F., Merchant, S. S.
(2008). FER1 and FER2 Encoding Two Ferritin Complexes in Chlamydomonas reinhardtii Chloroplasts Are Regulated by Iron. Genetics
179: 137-147
[Abstract]
[Full Text]