Eukaryotic Cell, November 2007, p. 2163-2167, Vol. 6, No. 11
1535-9778/07/$08.00+0 doi:10.1128/EC.00324-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Two Iron-Responsive Promoter Elements Control Expression of FOX1 in Chlamydomonas reinhardtii
Xiaodong Deng
and
Mats Eriksson*
Umeå Plant Science Center, Umeå University, SE-901 87 Umeå, Sweden
Received 30 August 2007/
Accepted 11 September 2007
 |
ABSTRACT
|
|---|
FOX1 encodes an iron deficiency-induced ferroxidase involved in a high-affinity iron uptake system. Mutagenesis analysis of the FOX1 promoter identified two separate iron-responsive elements, FeRE1 (CACACG) and FeRE2 (CACGCG), between positions –87 and –82 and between positions –65 and –60, respectively, and both are needed for induced FOX1 expression under conditions of iron deficiency.
 |
TEXT
|
|---|
Iron and other transition metals are essential for virtually all forms of living organisms; however, iron overload can lead to the production of highly reactive hydroxyl radicals through the Fenton reaction. To manage this balancing act between deficiency and overload, a cell must have precise mechanisms to regulate its gene/protein expression and its iron uptake and use. How this regulation is achieved in animal systems and in yeast is well characterized, but almost nothing is known about how these mechanisms function in plants. It is important that we better understand this regulation in plants, since iron deficiency frequently limits both the growth of microalgae in the oceans (2) and that of agricultural crops (11). The former is important since oceanic microalgae are a major sink for atmospheric CO2 and the latter because it leads to reduced yields and decreased nutritional quality of crops. In plants, two major strategies to acquire iron have evolved. Nongraminaceous plants use strategy I, a reduction strategy in which Fe3+ is solubilized in the rhizosphere by extruded protons, reduced to Fe2+ by an iron reductase, and taken up by an iron transporter. The other iron uptake strategy in plants, strategy II, is found in grasses (graminaceous monocots). Phytosiderophores are secreted into the rhizosphere, where they form stable Fe(III) chelates, which are transported into the root cells by specific transport systems (4, 20, 22). No iron-responsive promoter element (FeRE) that controls the expression of proteins induced by iron deficiency has been experimentally identified in a strategy I plant. However, in Arabidopsis thaliana, as many as 72 to 179 iron-regulated genes depend on the basic helix-loop-helix (bHLH) transcription factor FIT1 for their expression (3), and although the FeRE that FIT1 binds to has not been determined, bHLH factors are known to bind to the hexanucleotide E-box sequence CANNTG. A homolog of FIT1, FER, has also been identified in tomato (Lycopersicon esculentum) (18). In the strategy II plant barley, two FeREs have been identified in the IDS2 gene (15, 16). These two FeREs are IDE1 (ATCAAGCATGCTTCTTGC) and IDE2 (TTGAACGGCAAGTTTCACGCTGTCACT). The exact 5' and 3' borders of the cores of the FeREs in IDE1 and IDE2 have not been determined (IDE1 and IDE2 were defined by mutating the nucleotides of promoter regions needed for iron-regulated expression nine at a time), but when other iron-responsive genes from strategy II plants were searched for this sequence, several genes with similar motifs were found and a consensus sequence of CAAGCCTGCTTC(T/A)TGC was defined (16). Motifs fitting this consensus were also found in three A. thaliana genes (strategy I plant), but it has not been experimentally proven that these motifs act as FeREs in these genes. To better understand iron uptake in plants, we wanted to identify FeREs in a strategy I plant, and when studying plant processes, a valuable tool is often the use of less-complex photosynthetic organisms as model systems. One organism used to elucidate many processes in photosynthesis and other plant functions is the eukaryotic unicellular green alga Chlamydomonas reinhardtii (13). In C. reinhardtii, iron reductase and iron uptake activities are induced under iron-deficient conditions, and it is therefore proposed to use an iron uptake system similar to that of strategy I plants (9); this organism is especially well suited for use when studying metal-regulated gene expression, because since it requires only a few simple salts to grow, it is easy to control the exact metal concentrations in its growth medium. In the work presented here, we have analyzed the promoter of FOX1, which encodes an iron deficiency-induced ferroxidase involved in iron uptake (17). We have used C. reinhardtii strain CC425 (cw15 arg2), which was grown according to the method of Harris (12) in either liquid Tris-acetate-phosphate (TAP) medium in an orbital shaker (250 rpm, 25°C, and continuous light of 150 µmol m–2 s–1) or on solid TAP agar plates (22°C and 100 µmol m–2 s–1). The medium was prepared either with normal trace elements, giving it an iron concentration of 18 µM (iron sufficient) (+Fe), or with iron-free trace elements, giving it an iron concentration of 20 nM Fe (iron deficient) (–Fe). To analyze the FOX1 promoter for FeREs, we made a series of 5' and 3' deletions of the promoter and fused them to the reporter gene ARS (arylsulfatase) in either plasmid pJD54 or pJD100. In pJD54 the reporter gene is promoterless (6), and in pJD100 it is driven by a minimal promoter element derived from the C. reinhardtii ß2-tubulin gene (5). These constructs were transformed into C. reinhardtii by cotransformation with pArg7.8 (7, 14), and obtained transformants were screened for secreted arylsulfatase after 24 h on XSO4-TAP plates with or without Fe (+/–Fe) (6) (the presence of a blue halo around the colony); for key constructs, we measured the transcription of ARS on three representative transformants by using real-time PCR under +/–Fe conditions. The results are summarized in Fig. 1, and the conclusion was that the FeRE(s) of FOX1 is located in the –103 to –41 region relative to the transcription start site. The sequences of all constructs were confirmed by DNA sequencing, and primers used to make them are listed in Table 1.
To determine exactly which nucleotides in the –103 to –41 region are important for the regulation, we used a scanning mutagenesis analysis strategy, and for methodological reasons we analyzed the –103 to –77 region and the –76 to –41 region separately. To analyze the –103 to –77 region, nine constructs were generated by mutating the nucleotides in this region three by three in a –103 to +65 fragment and fusing these with pJD54 (Table 2, M103F to M79F). The mutations were made by using PCR with a forward primer, covering the region containing the desired mutation and a KpnI restriction site at the 5' end, and the reverse primer, SalI-65R (the sequence complementary to +46 to +65 relative to the FOX1 transcription start site and a SalI restriction site). To better quantify the expression of arylsulfatase, the activity was measured in liquid cultures using the method described by de Hostos et al. (8). In Table 2, it can be seen that the mutations in three of these constructs (M88F, M85F, and M82F) render them noninducible, showing that the sequence from –88 to –80 (GCACACGCC) contains the core of a FeRE. In a second series of mutagenesis, these nine nucleotides were mutagenized one by one to each of three other possible nucleotides (Table 2, FM2 to FM28), and from the lack of inducible arylsulfatase activity in cells transformed with constructs FM5 to FM9, FM11 to FM15, FM17 to FM19, FM21, and FM22, it could be determined that the sequence from –87 to –82, CACACG, is the core motif of this FeRE; we designated this motif FeRE1. From the single-nucleotide mutations, it can also be seen that the substitutions of A to G in construct FM10, A to G in construct FM16, and G to T in FM20 did not result in a significant decrease of arylsulfatase activity, indicating that changing the sequence to these nucleotides will also give a functional FeRE. The consensus sequence of the FOX1 FeRE1 is therefore C(A/G)C(A/G)C(G/T). To analyze the –76 to –41 region, these nucleotides were mutated one to five at a time in the –103 to –41 fragment pJF41R (Table 2, constructs M73R to M41R) and fused to pJD100. To make the mutations, a reverse primer covering the region containing the desired mutation and with a KpnI restriction site added at the 5' end was used in combination with a forward primer with a KpnI restriction site and the –103 to –86 region. Iron responsiveness could be measured for all constructs except for M60R, M61R, and M65R, and this shows that the sequence from –65 to –60 (CACGCG) is another FOX1 FeRE. This FeRE is not identical to FeRE1, but it fits the FeRE1 consensus sequence, and we designated this element FeRE2. It should, however, be noted that FeRE1 is still functional if the last nucleotide is changed from a G to a T, whereas doing the same substitution in FeRE2 abolishes iron regulation (constructs FM20 and M60R in Table 2). From the observation that with nonfunctional FeREs we receive a low level of expression under both +Fe and –Fe conditions, we can also draw the conclusion that these FeREs function as binding sites for activators during iron-deficient conditions and not for repressors under iron-sufficient conditions. If they had been repressor elements, with mutated FeREs, we would instead have seen an increase of expression under +Fe conditions.
When searching for the FeRE1 consensus in the IDE1 and IDE2 elements in barley, the only exact match was the sequence CACGCT in IDE2, but since the T in this sequence is outside the IDE consensus motif and because of the poor similarity to IDE1 in this region, we doubt that these are homologous motifs. A more striking similarity to the IDE consensus is seen directly upstream of FeRE1; if a 1-nucleotide gap is inserted, 11 Chlamydomonas nucleotides are identical to the 16-nucleotide IDE consensus (Fig. 2). From the data in Table 2, we know that this region is not needed for iron-regulated expression of FOX1, but further investigations are needed to clarify if this sequence has a regulatory role under circumstances not tested in this study. There are two other systems to regulate gene expression under iron deficiency that have been described. In Saccharomyces cerevisiae, the transcription factors Aft1p and Aft2p activate the transcription of a set of more than 10 genes involved in the reductive and nonreductive uptake of iron into the cell (21), and they bind to a common FeRE motif with the consensus core (C/T)(A/G)CACCC(A/G). When the C. reinhardtii FeREs are compared with this consensus motif, it is seen that five out of six Chlamydomonas nucleotides are identical to the yeast consensus FeRE sequence (Fig. 2). We want to emphasize that this similarity is not enough to show that these two systems are homologous, but it is important to note that they are similar. We have searched the C. reinhardtii genome and expressed-sequence-tag database using the protein sequences of Aft1p and Aft2p, but we cannot find any Chlamydomonas homologues to these two transcription factors. Another aspect that argues against similar transcription factors is the fact that in yeast only one copy of the FeRE is needed, whereas in the Chlamydomonas FOX1 promoter two FeREs are needed to get iron-regulated gene expression. In both Arabidopsis and tomato, a putative bHLH transcription factor controls the induction of a number of genes at the onset of iron deficiency (3, 18). The nucleotide sequence that such transcription factors bind to is CANNTG, but although five of six nucleotides in the Chlamydomonas FeREs fit this motif (see Fig. 2), we do not believe these systems are homologous. The strongest argument against such homology is that the fifth nucleotide of the bHLH-binding site must be a T, whereas in Chlamydomonas, to get a functioning FeRE a C must be at this position (Table 2). Other arguments against similar regulatory systems in Chlamydomonas and Arabidopsis/tomato are the same as in the case with the yeast: only one copy of the bHLH motif is needed in Arabidopsis and tomato, and no FIT1 homolog can be found when searching the Chlamydomonas genome. During review of the manuscript, FeREs in another Chlamydomonas gene, ATX1, were identified (10), but the sequences are completely different from those of the FeREs identified in this work. When we search five other Chlamydomonas genes also shown to be iron responsive at the transcriptional level (1, 17) for FOX1 and ATX1 FeREs, the FeREs of FOX1 are found upstream of FER1, FEA1, and FEA2 and the ATX1 FeREs upstream of FTR1, FRE1, FEA1, and FEA2. In conclusion, the data presented here show that the FeREs in FOX1 are different from those in all other previously described iron-regulatory systems and that there are (at least) two classes of FeREs in Chlamydomonas.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2. Comparison of the FOX1 FeREs with FeREs in barley and yeast and with the E-box sequence that bHLH transcription factors bind to. Nucleotides with a black background are identical to FeRE1 or to the sequence upstream of FeRE1, and the gray background denotes nucleotide alternatives that also give a functional FOX1 FeRE1.
|
|
 |
ACKNOWLEDGMENTS
|
|---|
We thank Arthur Grossman and Jeffrey Moseley, Carnegie Institution of Washington, Stanford, CA, for plasmids pJD54 and pJD100.
This work was supported by grants from the Swedish Research Council (to M.E.), the Knut and Alice Wallenberg Foundation (to M.E.), and the Kempe Foundations (to X.D.).
 |
FOOTNOTES
|
|---|
* Corresponding author. Mailing address: Umeå Plant Science Center, Umeå University, SE-901 87 Umeå, Sweden. Phone: 46-90-7866918. Fax: 46-90-7866676. E-mail: mats.eriksson{at}plantphys.umu.se 
Published ahead of print on 28 September 2007. 
Present address: State Key Laboratory of Tropical Crop Biotechnology, Institute of Tropical Bioscience and Biotechnology, Chinese Agricultural Academy for Tropical Crops, Haikou 571101, China. 
 |
REFERENCES
|
|---|
- Allen, M. D., J. A. del Campo, J. Kropat, and S. S. Merchant. 27 July 2007. FEA1, FEA2, and FRE1, encoding two homologous secreted proteins and a candidate ferrireductase, are expressed coordinately with FOX1 and FTR1 in iron-deficient Chlamydomonas reinhardtii. Eukaryot. Cell. [Epub ahead of print.] doi:10.1128/EC.00205-07.[Abstract/Free Full Text]
- Behrenfeld, M. J., A. J. Bale, Z. S. Kolber, J. Aiken, and P. G. Falkowski. 1996. Confirmation of iron limitation of phytoplankton photosynthesis in the equatorial Pacific Ocean. Nature 383:508-511.[CrossRef]
- Colangelo, E. P., and M. L. Guerinot. 2004. The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response. Plant Cell 16:3400-3412.[Abstract/Free Full Text]
- Curie, C., Z. Panaviene, C. Loulergue, S. L. Dellaporta, J. F. Briat, and E. L. Walker. 2001. Maize yellow stripe1 encodes a membrane protein directly involved in Fe(III) uptake. Nature 409:346-349.[CrossRef][Medline]
- Davies, J. P., and A. R. Grossman. 1994. Sequences controlling transcription of the Chlamydomonas reinhardtii ß2-tubulin gene after deflagellation and during the cell cycle. Mol. Cell. Biol. 14:5165-5174.[Abstract/Free Full Text]
- Davies, J. P., D. P. Weeks, and A. R. Grossman. 1992. Expression of the arylsulfatase gene from the ß2-tubulin promoter in Chlamydomonas reinhardtii. Nucleic Acids Res. 20:2959-2965.[Abstract/Free Full Text]
- Debuchy, R., S. Purton, and J. D. Rochaix. 1989. The argininosuccinate lyase gene of Chlamydomonas reinhardtii: an important tool for nuclear transformation and for correlating the genetic and molecular maps of the ARG7 locus. EMBO J. 8:2803-2809.[Medline]
- de Hostos, E. L., R. K. Togasaki, and A. Grossman. 1988. Purification and biosynthesis of a derepressible periplasmic arylsulfatase from Chlamydomonas reinhardtii. J. Cell Biol. 106:29-37.[Abstract/Free Full Text]
- Eckhardt, U., and T. J. Buckhout. 1998. Iron assimilation in Chlamydomonas reinhardtii involves ferric reduction and is similar to Strategy I higher plants. J. Exp. Bot. 49:1219-1226.[Abstract/Free Full Text]
- Fei, X., and X. Deng. 21 August 2007. A novel Fe deficiency responsive element (FeRE) regulates the expression of atx1 in Chlamydomonas reinharditii. Plant Cell Physiol. [Epub ahead of print.] doi:10.1093/pcp/pcm110.[Abstract/Free Full Text]
- Guerinot, M. L., and Y. Yi. 1994. Iron: nutritious, noxious, and not readily available. Plant Physiol. 104:815-820.[CrossRef][Medline]
- Harris, E. H. 1989. The Chlamydomonas source book: a comprehensive guide to biology and laboratory use. Academic Press, San Diego, CA.
- Harris, E. H. 1998. Introduction to Chlamydomonas, p. 1-11. In J.-D. Rocheix, M. Goldschmidt-Clermont, and S. Merchant (ed.), The molecular biology of chloroplast and mitochondria in Chlamydomonas. Kluwer Academic Publishers, Dordrecht, The Netherlands.
- Kindle, K. L. 1990. High frequency nuclear transformation of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 87:1228-1232.[Abstract/Free Full Text]
- Kobayashi, T., M. Suzuki, H. Inoue, R. N. Itai, M. Takahashi, H. Nakanishi, S. Mori, and N. K. Nishizawa. 2005. Expression of iron-acquisition-related genes in iron-deficient rice is coordinately induced by partially conserved iron-deficiency-responsive elements. J. Exp. Bot. 56:1305-1316.[Abstract/Free Full Text]
- Kobayashi, T., Y. Nakayama, R. N. Itai, H. Nakanishi, T. Yoshihara, S. Mori, and N. K. Nishizawa. 2003. Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants. Plant J. 36:780-793.[CrossRef][Medline]
- La Fontaine, S., J. M. Quinn, S. S. Nakamoto, M. D. Page, V. Göhre, J. L. Moseley, J. Kropat, and S. Merchant. 2002. Copper-dependent iron assimilation pathway in the model photosynthetic eukaryote Chlamydomonas reinhardtii. Eukaryot. Cell 1:736-757.[Abstract/Free Full Text]
- Ling, H.-Q., P. Bauer, Z. Bereczky, B. Keller, and M. Ganal. 2002. The tomato fer gene encoding a bHLH protein controls iron-uptake responses in roots. Proc. Natl. Acad. Sci. USA 99:13938-13943.[Abstract/Free Full Text]
- Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402-408.[CrossRef][Medline]
- Römheld, V., and H. Marchner. 1986. Evidence for a specific uptake system for iron phytosiderophores in roots of grasses. Plant Physiol. 80:175-180.[Abstract/Free Full Text]
- Rutherford, J. C., and A. J. Bird. 2004. Metal-responsive transcription factors that regulate iron, zinc, and copper homeostasis in eukaryotic cells. Eukaryot. Cell. 3:1-13.[Free Full Text]
- Takagi, S., K. Nomoto, and T. Takemoto. 1984. Physiological aspects of muginic acid, a possible phytosiderophore of graminaceous plants. J. Plant Nutr. 7:469-477.
Eukaryotic Cell, November 2007, p. 2163-2167, Vol. 6, No. 11
1535-9778/07/$08.00+0 doi:10.1128/EC.00324-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Long, J. C., Sommer, F., Allen, M. D., Lu, S.-F., Merchant, S. S.
(2008). FER1 and FER2 Encoding Two Ferritin Complexes in Chlamydomonas reinhardtii Chloroplasts Are Regulated by Iron. Genetics
179: 137-147
[Abstract]
[Full Text]