Previous Article | Next Article ![]()
Eukaryotic Cell, November 2007, p. 2112-2121, Vol. 6, No. 11
1535-9778/07/$08.00+0 doi:10.1128/EC.00199-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, SIBS, Chinese Academy of Sciences, 320 Yue Yang Road, Shanghai 200031, China
Received 5 June 2007/ Accepted 10 August 2007
|
|
|---|
|
|
|---|
Morphogenesis in C. albicans is subject to both positive and negative controls. Multiple positive signaling pathways have been characterized, including the Cph1-mediated mitogen-activated protein kinase cascade (27), the Efg1- and Flo8-mediated cyclic AMP (cAMP)-dependent protein kinase A (PKA) signaling pathway (8, 42), and the Rim101-mediated pH response signaling pathway (11). The negative control is mediated mainly by Tup1 through Rfg1 and Nrg1. A lack of any one of these regulators leads to constitutive filamentous growth and derepression of hypha-specific genes under non-filament-inducing conditions (5, 6, 24, 33). In Saccharomyces cerevisiae, the Tup1-Ssn6 transcriptional repression complex is recruited to regulatory promoters via pathway-specific DNA-binding proteins in response to various environmental signals (23), including Nrg1, Rox1, Sfl1, Mig1, and alpha2 (10, 13, 36, 43, 46). In C. albicans, the homologs of Nrg1, Rox1 (Rfg1), and Mig1, but not Sfl1, have been identified and characterized.
SFL1 of S. cerevisiae was originally identified in a genetic screen for suppressors of flocculation. Its N-terminal sequence has a high degree of similarity with the DNA-binding domain (heat shock factor [HSF] domain) of heat shock transcription factors (17). Dependent upon the HSF domain, Sfl1 can bind specifically to heat shock elements with an inverted DNA repeat 5'AGAA-n-TTCT3' (10). Genes with heat shock elements, such as FLO11, STA1, and SUC2, are repressed by Sfl1 and derepressed in sfl1 mutants (25, 37, 41). Sfl1 can form a multimer via its coiled-coil domain, and this multimerization is believed to be important for its DNA binding activity. Tpk2, a catalytic subunit of the cAMP-dependent PKA, inactivates Sfl1 by phosphorylation and releases Sfl1 from DNA (10, 35). Sfl1 can interact with the TPR motifs of Ssn6 and represses transcription by recruiting an Ssn6-Tup1 complex. Sin4 and Srb10, components of a specific RNA polymerase II subcomplex that are required for Ssn6-Tup1 repression, are also required for Sfl1 repression (10).
Flo8 is a transcription factor that is critical for invasive growth and flocculation in haploids and pseudohyphal growth in diploids of S. cerevisiae (28). It functions downstream of the cAMP-dependent PKA pathway (38). Interestingly, Flo8 has been shown to bind to the same region of the FLO11 promoter as Sfl1, and phosphorylation of Flo8 by Tpk2 is required for its interaction with the FLO11 promoter both in vivo and in vitro (35). Candida albicans has a Flo8 homolog. (We use the prefixes Sc and Ca in this report to distinguish S. cerevisiae and C. albicans genes and proteins, respectively, where there may be confusion.) The Candida albicans Flo8 (CaFlo8) is essential for hyphal development and hypha-specific gene expression and is also important for Candida pathogenicity, since a flo8/flo8 mutant is avirulent in a mouse model of systemic infection. Like ScFlo8, CaFlo8 may function downstream of the cAMP/PKA pathway in C. albicans (8, 42).
Since Sfl1 is a target of the cAMP/PKA pathway negatively regulating the invasive/filamentous growth in S. cerevisiae, we wanted to determine whether a similar regulator exists in C. albicans. We cloned a C. albicans SFL1 homolog by sequence comparison and functional complementation of an S. cerevisiae sfl1 mutant. SFL1 deletions in C. albicans promote hyphal development. Our genetic analysis of sfl1/sfl1, flo8/flo8, and sfl1/sfl1 flo8/flo8 double mutants of C. albicans suggests that Sfl1 and Flo8 act antagonistically in the regulation of hyphal development in C. albicans.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Yeast strains and plasmids used in this study
|
Plasmid and strain construction. All the plasmids used in this study are described in Table 1. To investigate the function of CaSFL1 in S. cerevisiae, primers 5'CTGGGATCCGTATGAGTCATTTGGTACTGTCT and 5'CTGGAGCTCTTATTCTAATTTTCTCTTTTTATG were used to amplify the CaSFL1 open reading frame (ORF) from C. albicans genomic DNA, and the PCR product was digested with BamHI and SstI and subcloned into pVTU102, generating pVTU-CaSFL1 for expression of CaSFL1 in S. cerevisiae. The same PCR fragment containing C. albicans SFL1 was inserted into the EcoRV site of pBA1 to construct pBA1-SFL for overexpression of SFL1 in C. albicans. To construct a CaSFL1 revertant in C. albicans, a 3.7-kb fragment containing the entire CaSFL1 ORF and 1.3 kb of upstream sequence was amplified with primers 5'GCGCAGGAAATAGAGAAAGAA and 5'CTGGAGCTCTTATTCTAATTTTCTCTTTTTATG and inserted in pBES116 to generate pBES116-SFL1. The sfl1/sfl1 null mutant (CAL2) was transformed with a NheI-digested pBES116-SFL1 to revert CaSFL1 into its own locus for complementation assay. To express the green fluorescent protein (GFP) gene in C. albicans, a GFP ORF amplified with primers 5'TACGGATCCATGTCTAAAGGTGAAGAATTAT and 5'CCTGGATTCTTATTTGTACAATTCATCCATAC from pSWI1-GFP (31) was digested with BamHI and ligated with BglII-digested pBA1, generating pBA1-GFP. To express the Sfl1-GFP fusion protein, the SFL1 ORF was amplified with primers 5'CTGGGATCCGTATGAGTCATTTGGTACTGTCT and 5'AGCTGAATAATTCTTCACCTTTAGACATTTCTAATTTTCTCTTTTTA TGA, the GFP ORF was amplified from pSWI1-GFP with primers 5'ATGTCTAAAGGTGAAGAATTAT and 5'CCTGGATTCTTATTTGTACAATTCATCCATAC, and then an SFL1-GFP fragment amplified by overlap PCR was digested with BamHI and ligated with BglII-digested pBA1, generating pBA1-SFL1-GFP. The pBA1-GFP or pBA1-SFL1-GFP was digested with AscI and introduced into CAI4 for GFP or Sfl1-GFP expression.
Northern blotting. RNA was prepared and subjected to Northern analysis with the probes indicated. PCR products were used for probing C. albicans SFL1, ECE1, HWP1, and ACT1. The primers used were 5'CAATCGTGCGCTGGGAAGTTC and 5'TTATTCTAATTTTCTCTTTTTATG for SFL1, 5'GCCATCCACCATGCTCC and 5'GTGCTACTGAGCCGGCATCTC for ECE1, 5'TGCTCCAGGTACTGAATCCGC and 5'GGCAGATGGTTGCATGAGTGG for HWP1, and 5'CGGTGGTATGTTTTAGTTTAGC and 5'ACCACTGCCGACAGATCAATC for ACT1. The sizes of mRNAs on Northern blots correlated with the expected lengths based on information from the Candida Genome Database.
Virulence assay. The newly plated C. albicans strains were grown in liquid YPD at 30°C overnight, suspended in physiological saline solution, counted in a hemacytometer, and adjusted to a concentration of 5 x106 cells/ml. ICR male mice from the Shanghai Laboratory Animal Center, Chinese Academy of Sciences, were used for the virulence assay. Eight ICR male mice weighing from 18 to 21 g for each strain were injected in the lateral tail veins with 0.1 ml cells. The survival of mice was observed and recorded continuously for at least 25 days after injection (9).
|
|
|---|
![]() View larger version (37K): [in a new window] |
FIG. 1. C. albicans Sfl1 is a functional homolog of S. cerevisiae Sfl1. (A) Schematic depiction of the HSF domain (black box), coiled-coil region (gray box), and glutamine-rich (Q-rich) regions (underlined areas) in C. albicans Sfl1 and S. cerevisiae Sfl1. aa, amino acids. (B) Ectopically expressed CaSFL1 suppresses the flocculation phenotype of a haploid sfl1 mutant. S. cerevisiae strains HLY334 (wild type [WT]) and XPY108 (sfl1) carrying pVTU102 or pVTU-CaSFL1 were grown in YPD to saturation, allowed to settle for 15 min, and then photographed. (C) Ectopically expressed CaSFL1 suppresses the pseudohyphal development phenotype of a diploid sfl1 mutant. S. cerevisiae strains CGx68 (wild type) and XPY108 a/ (sfl1/sfl1) carrying pVTU102 or pVTU-CaSFL1 were grown on SLAD plates at 30°C for 2 days.
|
Deletion of SFL1 promotes filament formation in C. albicans. To elucidate the role of SFL1 in the hyphal development of C. albicans, we deleted two copies of SFL1 by PCR-based homologous recombination, as described previously (48) (Table 1). Deletion of both alleles of SFL1 enhanced filamentous growth in nutrient-poor media. On solid YPD medium, the C. albicans sfl1/sfl1 mutant generated smooth colonies and was indistinguishable from the wild-type strain CAF2-1, even after 7 days of incubation at 30°C. When incubated on SCD plates for 6 days at 30°C, the sfl1/sfl1 mutant produced rough wrinkled colonies, in contrast to the wild-type, heterozygous, and revertant strains, which all formed smooth colonies (Fig. 2A, upper panels). Increased germination of the sfl1/sfl1 mutant was also observed in liquid media. After growth in SCD medium at 30°C for 6 h, the sfl1/sfl1 mutant was a mixture of yeast and filaments, with about 30% of the cells developing into hyphae (Fig. 2A, lower panel). The increase in filamentous growth was caused by the SFL1 deletion, as the phenotype was reversed by reintroducing wild-type SFL1 back into its own locus under control of the SFL1 endogenous promoter. In C. albicans, the expression of hypha-specific genes, such as ECE1 and HWP1, correlates with hyphal morphogenesis. Consistent with the phenotype, the transcription levels of ECE1 and HWP1 increased in the sfl1/sfl1 mutant in liquid SCD medium at 30°C but were undetectable in wild-type, heterozygous, or revertant strains, indicating that deletion of SFL1 enhanced the expression of hypha-specific genes under a non-hypha-inducing condition (Fig. 2B). Interestingly, the sfl1/sfl1 mutant did not form hyphae in YPD liquid medium at 30°C, but removal of glucose from the YPD medium promoted filament formation (Table 2). The sfl1/sfl1 mutant also enhanced filamentous growth in other liquid media, including the glucose-depleted medium SCLD, the nitrogen-limited medium SLAD, and the nutrient-deprived medium Spider, suggesting that Sfl1 acts as a repressor of hyphal development in C. albicans.
![]() View larger version (70K): [in a new window] |
FIG. 2. Deletion of SFL1 promotes filamentous growth in C. albicans. (A) Phenotypes of sfl1 mutants. Wild-type (WT) (CAF2-1), SFL1/sfl1 (CAL1+pBES116), sfl1/sfl1 (CAL2+pBES116), and SFL1 revertant (CAL2+ pBES116-SFL1) strains were streaked onto solid SCD for 6 days (upper panels) or cultured in liquid SCD for 6 h (lower panels) at 30°C. (B) An sfl1/sfl1 mutant has derepressed expression of hypha-specific genes. The same strains used for panel A were grown in liquid SCD for 6 h at 30°C. RNA was prepared and subjected to Northern analysis with the probes. PCR products were used for probing C. albicans SFL1, ECE1, HWP1, and ACT1.
|
|
View this table: [in a new window] |
TABLE 2. Filamentous growth in liquid mediaa
|
![]() View larger version (64K): [in a new window] |
FIG. 3. Sfl1 functions as a repressor in hyphal development. The colony morphologies of the wild-type (WT) strain with vector (CAI4+pBES116) or overexpressed SFL1 (CAI4+pBA1-SFL1) and the sfl1/sfl1 mutant with vector (CAL2+pBES116) or overexpressed SFL1 (CAL2+ pBA1-SFL1), plated on solid serum-containing medium and Lee's medium at 37°C for 3 and 5 days, respectively, are shown.
|
![]() View larger version (18K): [in a new window] |
FIG. 4. Virulence assay of C. albicans strains. Survival curves for wild-type (CAF2-1), sfl1/sfl1 (CAL2+pBES116), SFL1 revertant (CAL2+ pBES116-SFL1), and SFL1-overexpressing (CAI4+pBA1-SFL1) strains in a mouse model of systemic infection are shown. For each strain, eight ICR male mice weighing 18 to 21 g were injected with 5 x 105 cells into the tail vein. Survival of mice was observed and recorded continuously for at least 25 days after injection.
|
![]() View larger version (55K): [in a new window] |
FIG. 5. Nuclear localization of Sfl1. Overnight-cultured cells of CAI4+ pBA1-GFP (GFP) or CAI4+ pBA1-SFL1-GFP (Sfl1-GFP) were diluted in fresh YPD at 25°C for yeast growth (A) and in YPD plus 10% serum at 37°C for hyphal growth (B). Cells were resuspended in phosphate-buffered saline and stained with 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI) (Sigma) for fluorescence observation. DIC, differential interference contrast.
|
At an intermediate temperature (30°C), the wild-type strain SC5314 or CAF2-1 could not induce true hyphae in all liquid media examined. In contrast, the sfl1/sfl1 mutant could form true hyphae in all media except YPD. The ratio of filament formation varied from 10% in low pH medium (Lee's, pH 4) to 100% in nutrient-limited medium (Spider without a carbon source) (Table 2). Addition of serum was not sufficient to release the inhibition of hyphal induction in wild-type cells but was sufficient to promote the sfl1/sfl1 mutant cells to develop true hyphae. The absence of Sfl1 reduced the threshold of sensing nutrient starvation and serum at 30°C.
At a lower temperature (25°C), wild-type strains favored growth in the yeast form, but about 2 to 5% of the sfl1/sfl1 mutant cells could develop into short hyphae in nutrient-poor media, including SCLD, SLAD, and Spider (Table 2). The hyphal induction was inhibited in Spider supplemented with 2% glucose or 2% mannitol. Addition of 10 to 30% serum to the nutrient-poor media increased the hyphal induction by 6- to 25-fold. The combinative effect was only observed in SCLD, SLAD, and Spider and not in other media, indicating that serum is an additional input that activates hyphal development at low temperature. The lack of Sfl1 reduces the temperature threshold for nutrients and serum sensing. Our results showed that serum, high temperature, neutral pH, and nutrient starvation each have an additive effect on hyphal induction in the sfl1/sfl1 mutant. Sfl1 functions as a new negative regulator of hyphal development.
Flo8 is required for germination and hyphal development in sfl1/sfl1 mutants. In S. cerevisiae, the Sfl1 repressor and Flo8 activator play antagonistic roles in controlling the expression of FLO11 via a common promoter element (35). To address the relationship between Sfl1 and Flo8 in the regulation of C. albicans hyphal development, we deleted CaFLO8 in a C. albicans sfl1/sfl1 mutant. In the constructed sfl1/sfl1 flo8/flo8 double mutant the repressive effect of Sfl1 on hyphal induction was abolished, and the mutant failed to form filaments in all liquid media examined (Table 2), resulting in a phenotype similar to that of the flo8/flo8 mutant (Fig. 6). Thus, flo8/flo8 loss of function blocks the hyperfilamentous phenotype of sfl1/sfl1 loss of function. On the other hand, overexpression of FLO8 in C. albicans wild-type strain CAI4 did not activate germination (data not shown), but overexpression of FLO8 in the sfl1/sfl1 mutant enhanced filamentous growth in all liquid media and even in YPD medium at 30°C (Table 2). These data suggest that Sfl1 may inhibit hyphal development by antagonizing Flo8 functions.
![]() View larger version (49K): [in a new window] |
FIG. 6. Flo8 is required for germination in sfl1 mutants. Cell and colony morphologies of wild-type (WT) (CAI4+pBES116), sfl1/sfl1 (CAL2+pBES116), flo8/flo8 (CCF4+pBES116), and sfl1/sfl1 flo8/flo8 (CAL4+pBES116) strains are shown. Cells were grown in liquid medium (YPD plus 10% serum) at 37°C for 3.5 h or plated on solid serum-containing medium and incubated at 37°C for 5 days.
|
![]() View larger version (89K): [in a new window] |
FIG. 7. Effects of Sfl1 and Flo8 on hyphal growth under embedded conditions. The wild-type (WT) strain (CAI4), sfl1/sfl1 mutant (CAL2), flo8/flo8 mutant (CCF4), and sfl1/sfl1 flo8/flo8 mutant (CAL4) carrying vector (pBES116), overexpressed SFL1 (pBA1-SFL1), or overexpressed FLO8 (pBA1-FLO8) were plated with molten YPS agar and grown at 37°C for 2 days (A) or at 24°C for 3 days (B). Cells and colonies were photographed with a microscope using x40 and x10 lenses.
|
The observations suggest that Sfl1 acts as a repressor at both temperatures, whereas Flo8 functions as an activator at 37°C and as a repressor at 24°C. In both cases, Sfl1 repression seems to be mediated through Flo8, as repression is not seen in either flo8/flo8 or sfl1/sfl1 flo8/flo8 mutants at either temperature. In addition, at low temperature, the enhancement of filamentous growth by SFL1 overexpression in flo8/flo8 mutants and the lack of hyphae in the sfl1/sfl1 flo8/flo8 double mutant suggest that Sfl1 may play a positive role in hyphal development in flo8/flo8 mutants.
|
|
|---|
In this study, we identified a C. albicans homolog of S. cerevisiae Sfl1. Like ScSfl1, CaSfl1 functions as a negative regulator of filamentous growth in C. albicans. Deletion of SFL1 enhances filamentous growth in several media, and overexpression of SFL1 inhibits hyphal development. Growth temperatures, serum, high temperature, neutral pH, and nutrient starvation each had an additive effect on hyphal induction in the sfl1/sfl1 mutant. Lack of Sfl1 reduces the threshold of hyphal induction responding to multiple extracellular stimuli. Unlike the case for the other heat shock factors, SFL1 expression is not responsive to heat shock, which is similar to that of SFL1 in S. cerevisiae. In C. albicans, the level of SFL1 expression remains constant in various growth conditions (data not shown). Its protein level and cellular localization are also the same in all growth conditions examined. Therefore, Sfl1 might be regulated at the level of transcriptional activity or DNA binding.
In S. cerevisiae, Sfl1 has been shown to interact with the TPR motifs of Ssn6 as well as Sin4 and Srb10 in response to environmental signals (10). Ssn6-Tup1 and specific subunits of the RNA polymerase II holoenzyme are required for Sfl1 repression function. Biochemical evidence demonstrates that Sfl1 is present at the promoters of three Ssn6-Tup1-repressible genes: FLO11, HSP26, and SUC2 (10). Sfl1 inhibits transcription by recruiting Ssn6-Tup1, which is responsible for the repression of over 180 genes in S. cerevisiae (20). The Ssn6-Tup1 complex represses multiple subsets of genes when recruited to promoters by sequence-specific DNA binding repressors (30). In C. albicans, the negative regulator Ssn6 is postulated to form a complex with Tup1 (18, 21). Sfl1 may act as a repressor by interacting with Ssn6, which in turn represses the transcription of target genes. Binding sites for the HSF domain were found at the promoters of several of hypha-specific genes, including HWP1 and ECE1 (2, 40). The HWP1 mRNA level was increased 100-fold in an sfl1/sfl1 mutant compared with a wild-type strain in YPD at 37°C but was reduced dramatically in an SFL1-overexpressing strain (data not shown). Consistent with its putative binding to specific DNA via the HSF domain, Sfl1 is localized in the nucleus independent of growth forms. We suggest that Sfl1 may bind to specific promoter sequences of hypha-specific genes and repress their expression by recruiting Ssn6-Tup1 complex and Srb/mediator proteins.
Antagonistic effects of Sfl1 and Flo8 on hyphal development. In S. cerevisiae, the transcriptional activator Flo8 and the repressor Sfl1 function downstream of the PKA pathway, antagonistically controlling expression of FLO11 and the dimorphic filamentous transition in response to nutrient cues (35). Both Flo8 and Sfl1 can bind to the same region of the FLO11 promoter. Phosphorylation by Tpk2 promotes Flo8 binding and activation of the FLO11 promoter and relieves repression by prohibiting dimerization and DNA binding by Sfl1. A double-barreled mechanism was proposed to illustrate a finer network of checks and balances to modulate gene expression in S. cerevisiae, by controlling the ratios of phosphorylated and unphosphorylated forms of both Sfl1 and Flo8 (35). The combination of dual control by the activation of Flo8 and the relief of repression of Sfl1 may contribute to control morphogenesis of C. albicans responding to different environmental cues in aerobic conditions. Similarly, in C. albicans, Sfl1 functions as a negative regulator and Flo8 acts as a positive regulator of filamentous growth in liquid and solid media (Table 2; Fig. 6). The hyperfilamentous phenotype of the sfl1/sfl1 mutant was abolished by deleting FLO8 but enhanced by overexpression of FLO8 (Table 2). These data suggest that Sfl1 may inhibit filamentous development by antagonizing Flo8 functions. The mechanism for the antagonizing roles of Sfl1 and Flo8 in hyphal development is likely similar to that in S. cerevisiae.
In microaerophilic conditions, C. albicans Sfl1 may act as an activator as well as a repressor. In presence of Flo8, Sfl1 functions as a repressor of hyphal development; deletion of Sfl1 caused the formation of stronger heterogeneous filaments at both 24°C and 37°C (Fig. 7A and B). In absence of Flo8, Sfl1 acts as a repressor at high temperature but an activator at low temperature. When embedded in agar at 24°C, overexpression of SFL1 enhances filamentous growth, whereas deletion of SFL1 blocks the filament formation in an flo8/flo8 mutant (Fig. 7B). Consistent with our data, S. cerevisiae Sfl1 was recently reported to be an activator involved in transcriptional control of the stress-responsive gene HSP30 (1). Interestingly, the strain that Ansanay Galeote et al. used is derived from S288C, which contains a mutated FLO8 gene (1), but Pan and Heitman used a sigma background strain containing a wild-type FLO8 gene for study of Sfl1 (35). The existence of Flo8 may prevent Sfl1 from binding to the promoter and then inhibit its activating effect as well as its repressing effect on target genes in response to physical environmental cues. Our observations suggest that Sfl1 has a dual function in filamentous growth of C. albicans: it acts as a repressor of hyphal development antagonizing activation of the Flo8 but functions as an activator releasing from inhibition of the Flo8 in matrix at low temperature. Further investigation should help in elucidating the mechanisms of Sfl1 and Flo8 in regulation of hyphal development.
This work was supported by the Chinese National Natural Science Foundation (grants 30330010 and 30600008) and Chinese 863 grants 2006AA02Z178.
Published ahead of print on 22 August 2007. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»