This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gebhart, D.
Right arrow Articles by Sil, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gebhart, D.
Right arrow Articles by Sil, A.

 Previous Article  |  Next Article 

Eukaryotic Cell, June 2006, p. 935-944, Vol. 5, No. 6
1535-9778/06/$08.00+0     doi:10.1128/EC.00028-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Identification of a Copper-Inducible Promoter for Use in Ectopic Expression in the Fungal Pathogen Histoplasma capsulatum{dagger}

Dana Gebhart,{ddagger} Adam K. Bahrami,{ddagger},§ and Anita Sil*

Department of Microbiology and Immunology, University of California, San Francisco, San Francisco, California 94143-0414

Received 31 January 2006/ Accepted 10 April 2006


arrow
ABSTRACT
 
Despite the existence of a number of genetic tools to study the fungal pathogen Histoplasma capsulatum, strategies for conditional gene expression have not been developed. We used microarray analysis to identify genes that are transcriptionally induced or repressed by the addition of copper sulfate (CuSO4) to H. capsulatum yeast cultures. One of these genes, CRP1, encodes a putative copper efflux pump that is significantly induced in the presence of CuSO4. The upstream regulatory region of CRP1 was sufficient to drive copper-regulated expression of two reporter genes, lacZ and the gene encoding green fluorescent protein. Microarray experiments were performed to determine a copper concentration that triggers accumulation of the CRP1 transcript without significant perturbation of global gene expression. These studies show that the CRP1 upstream regulatory region can be used for ectopic expression of heterologous genes in H. capsulatum. Furthermore, they demonstrate the strategic use of microarrays to identify conditional promoters that confer induction in the absence of large-scale shifts in gene expression.


arrow
INTRODUCTION
 
Histoplasma capsulatum, the etiologic agent of histoplasmosis, is a dimorphic fungal pathogen that causes systemic disease in humans. H. capsulatum grows in a mycelial (filamentous) form in soil and a yeast form in the host. Introduction of H. capsulatum into the host occurs by inhalation of mycelial fragments and/or vegetative spores. Once inside the host, these cells convert to a budding yeast form. Yeast cells evade killing and multiply within macrophages (3, 8, 21, 37). Subsequently, H. capsulatum yeasts use host phagocytes as vehicles to spread to multiple sites such as the spleen, liver, lymph nodes, and bone marrow. In severe disseminated disease, multiple additional organs can be colonized (7). Even in healthy hosts, the organism persists for many years and can reactivate if the immune status of the host declines.

The ability of H. capsulatum to sense its environment (soil versus host) and adjust its growth phase (mycelial versus yeast) is a fascinating example of how cells sense and respond to environmental cues. However, limited molecular tools have hampered the investigation of the signal transduction pathways and effectors that govern this response. Similarly, little is understood about how H. capsulatum is able to survive in the normally hostile environment of macrophages and to persist in the host. In recent years, a number of molecular genetic tools have been developed for H. capsulatum (20, 28, 31, 32, 36). These molecular advances have greatly facilitated the analysis of the biology of this organism. In addition, the sequence of the H. capsulatum genome (Genome Sequencing Center, Washington University, St. Louis, MO [http://genomeold.wustl.edu/projects/hcapsulatum], and Broad Institute, Cambridge, MA [http://www.broad.mit.edu/annotation/fungi/histoplasma_capsulatum/]) will accelerate the progress of molecular analysis.

One tool that has been missing from the H. capsulatum arsenal is a conditional promoter that can be used to ectopically express genes (36). This type of analysis is particularly useful for determining if ectopic expression of a gene is sufficient to confer a particular phenotype, for example, mycelial or yeast phase growth, even in the absence of the appropriate environmental signals. Here we used microarray analysis to identify a copper-regulated promoter that is sufficient to drive copper-dependent transcription of heterologous genes. This tool allows ectopic expression of a gene by the simple addition of CuSO4 to the culture medium and will be extremely useful for future characterization of gene function, especially in concert with previously developed molecular tools.


arrow
MATERIALS AND METHODS
 
Strains and culture conditions. H. capsulatum strain G217B (ATCC 26032; a kind gift from William Goldman, Washington University, St. Louis, MO) was grown in Histoplasma macrophage medium (HMM) broth (40) or on HMM agar plates supplemented with 5 mg/ml bovine serum albumin. H. capsulatum strain G217B ura5-23 (a kind gift from William Goldman) (38) was grown in HMM broth supplemented with 0.2 mg/ml uracil (Sigma-Aldrich, St. Louis, MO). After transformation with URA5-containing plasmids, G217B ura5-23 was grown in HMM broth or on HMM-agarose plates with no uracil supplementation. H. capsulatum liquid cultures were grown at 37°C under 5% CO2 on an orbital shaker and were passaged every 2 to 3 days at 1:25 dilution. Plates were grown at 37°C under 5% CO2 in a humidified incubator.

Transformation of G217B ura5-23 with pDG7, pDG8, pDG10, pJBP33 (26), or pBY33 (16) was used to generate the DG7, DG8, DG10, JBP33, and BY33 strains, respectively.

To determine the gene expression profile of cells exposed to CuSO4 by microarray analysis, 1.1 liter of HMM was inoculated with G217B at a concentration of 2.4 x 107 cells/ml and cells were grown for 24 h to a concentration of 1.35 x 108 cells/ml. Immediately prior to CuSO4 addition (0-min time point), 200 ml of cells was harvested for gene expression analysis. Additionally, 100 ml of cells was removed to a separate flask and cultured for 8 h (untreated control) before harvesting. Ten or 50 µM CuSO4 was added to the remaining 800 ml. Two hundred milliliters of cells was harvested at 30 min, and 2, 4, and 8 h after the addition of CuSO4. All samples were harvested by vacuum filtration and frozen at –80°C until the time of RNA preparation.

For the CuSO4 titration experiment, DG7 cells were inoculated into 100 ml HMM broth at a concentration of 2.4 x 107 cells/ml and grown for 24 h to a concentration of 1.2 x 108 cells/ml. The culture was split into eight 10-ml aliquots; CuSO4 was added at 0, 1, 5, 10, 50, 100, 200, or 500 µM; and cells were cultured for an additional 8 h. To assess the potential toxicity of CuSO4, the numbers of CFU at the 0-, 4-, and 8-h time points were determined. Three independent 10–5 serial dilutions of each culture were made, and 100 µl of each dilution was plated in duplicate on HMM plates. Colonies were counted 13 days later. Additionally, at the 8-h time point, three 1.5-ml aliquots were removed from each flask for the ß-galactosidase assay.

To grow cells for fluorescence analysis of green fluorescent protein (GFP), DG10, JBP33, and BY33 strains were diluted to 2.25 x 107 cells/ml in 10 ml HMM broth and grown for 24 h until they reached 1.35 x 108 cells/ml. Each culture was divided into two 5-ml aliquots, and one of the aliquots per culture was treated with 50 µM CuSO4. Cells were harvested 12 h later.

RNA preparation. Total RNA was isolated using a guanidine thiocyanate lysis protocol as previously described (14). Polyadenylated [poly(A)] RNA was isolated from total RNA using an Oligotex mRNA kit (QIAGEN Inc., Valencia, CA) or an oligonucleotide-dT cellulose (Ambion, Austin, TX) column.

cDNA synthesis, labeling, and analysis. Fluorescently labeled cDNA was made by incorporating amino-allyl-dUTP during reverse transcription of poly(A)-selected RNA. Cy3 or Cy5 dyes (Amersham Biosciences, Piscataway, NJ) were coupled to the amino-allyl group as previously described (5). An equal mass of RNA from each time point was pooled to create a reference sample, which was reverse transcribed and labeled with Cy3. cDNA from each time point was labeled with Cy5 and competitively hybridized against the reference sample using the H. capsulatum genomic shotgun microarray (14).

Microarray data analysis. Arrays were scanned on a GenePix 4000B scanner (Axon Instruments/Molecular Devices, Union City, CA) and analyzed using GENEPIX PRO, version 4.0, NOMAD (http://nomad2.ucsf.edu/NOMAD/nomad-cgi/login.pl), CLUSTER (6), and Java Treeview 1.0.8 (available at http://sourceforge.net/project/showfiles.php?group_id=84593). Each spot on the microarray corresponds to a random genomic fragment that is referred to hereafter as a microarray element. To eliminate elements with low signal, we did not analyze elements for which the sum of the medians for the 635-nm and 532-nm channels was ≤500 intensity units. Since all samples were hybridized against reference pools, each ratio measurement was normalized relative to the ratio of its untreated 0-minute time point.

5' RACE analysis. The 5' untranslated region of the CRP1 gene was determined using 5' rapid amplification of cDNA ends (RACE) with the FirstChoice RLM-RACE kit (Ambion, Dallas, Texas) according to the manufacturer's instructions. The RACE reactions were performed on 500 ng of poly(A) RNA isolated from H. capsulatum yeast cells exposed to 100 µM CuSO4 for 30 min. The gene-specific outer primer used in these experiments was OAS389 (5'GCGGCCGCCCTTGCCTGGACGTTCTTGTCAC3'), and the gene-specific inner primer used in these experiments was OAS388 (5'GCGGCCGCGCTCCCGACTCATCGCGAGAAC3').

Lambda library screening. A CRP1 genomic fragment was identified from sequencing microarray clone 97B8, but this clone did not contain a complete open reading frame (ORF) sequence, nor did it contain upstream regulatory sequences. To obtain a large genomic clone, we screened a lambda library containing H. capsulatum genomic DNA inserts that ranged from 6 to 10 kb. This library, a kind gift from Lena Hwang and Jasper Rine, was constructed using the ZAP Express predigested-vector kit (Stratagene, La Jolla, CA) and screened according to the manufacturer's instructions. The 97B8 microarray clone and the CRP1 5' RACE clone were used as probes to identify five overlapping CRP1 lambda clones. These clones were fully sequenced and then assembled using Sequencher 4.2 (Gene Codes, Ann Arbor, MI) to provide a physical map of the CRP1 locus.

Plasmid construction. Plasmids pDG7 and pDG8 were constructed in two steps. For pDG7, a 1.45-kb region directly upstream of the CRP1 start codon was amplified by PCR using forward primer OAS427 (5'CGAGATCTGATCAGATGGGAAATGAGGC3') and reverse primer OAS397 (5'GCTCTAGACATCGTTATTCCGCGAGATAAAATAGCGGTCAAGTAGC3'). For pDG8, a 1.28-kb region directly upstream of the CRP1 start codon was amplified using OAS445 (5'CGGGATCCCGAAATCGCGAGGATAGG3') and OAS397. The 1.45- and 1.28-kb fragments were each digested with BglII and XbaI and ligated into pJBP33 (26) digested with BamHI/XbaI to give pDG7 and pDG8, respectively. The resultant plasmids contain the CRP1 promoter fragments directly upstream of lacZ. Because the pJBP33 lacZ gene does not have a start codon, an in-frame ATG codon was incorporated into OAS397.

Plasmid pDG10 was constructed by first digesting pBY33 (16) with BamHI and XbaI to remove the CBP1 promoter. This promoter was replaced with the 1.28-kb BamHI/XbaI CRP1 PCR fragment described above to give pDG10b. Since the start codon for the resultant CRP1-GFP construct was out of frame, an adaptor to bring the start codon in frame was constructed by annealing oligonucleotides OAS456 (5'CTAGTGGCGCCGGT3') and OAS457 (5'CTAGACCGGCGCCA3'). This adaptor was ligated into the XbaI-digested pDG10b to make pDG10.

Since both the –1451 region (in pDG7) and the –1276 region (in pDG8 and pDG10) conferred copper-dependent induction, we chose to use the –1276 region for future constructs. The –1276 region spans the entire intergenic sequence between CRP1 and the adjacent 5' ORF, whereas the –1451 region includes a small region of the upstream ORF coding sequence.

Electrotransformation of DNA. Approximately 100 ng of PacI-linearized plasmid DNA with exposed telomere ends was transformed into yeasts as previously described (39).

Northern analysis. Five micrograms of total RNA was separated by gel electrophoresis, transferred to nylon membranes, and hybridized as previously described (14). Probes were generated by PCR from G217B genomic DNA using the primers OAS744 (5'ATGGCAGACAATCAGCCAATCC3') and OAS745 (5'TCACGCCTTCGTCCAAAATCGC3') for the CRP1 probe and OLH9 (5'AAGTCGCTGCCCTCGTTAT3') and OLH10 (5'TAGAAGCACTTGCGGTGGAC3') for the ACT1 probe.

GFP fluorescence analysis. Cell pellets were resuspended and fixed in a paraformaldehyde solution (4% paraformaldehyde, 0.1 M sodium phosphate, and 6 mM NaOH) for 1 h on ice and then washed with phosphate-buffered saline. Cells were examined under a DMLB microscope (Leica, Solms, Germany), and images were captured using Image software (Scion Corporation, Frederick, Maryland).

ß-Galactosidase assays. To assay ß-galactosidase activity on solid media, eight single-colony isolates of a DG8 transformant were transferred into individual wells of a 96-well plate containing 50 µl HMM. A multichannel pipette was used to spot 5 µl from each well onto HMM plates supplemented with 0, 1, 5, 10, or 100 µM CuSO4. These plates were incubated for 7 days at 37°C under 5% CO2 before the application of 2% X-Gal (5-bromo-4-chloro-3-indolyl-ß-D-galactopyranoside) in dimethyl formamide as previously described (39).

For quantitative liquid ß-galactosidase assays, cell pellets were resuspended in 150 µl Z buffer (100 mM sodium phosphate, pH 7.0, 50 mM ß-mercaptoethanol, 10 mM KCl, 1 mM MgSO4). Twenty microliters was transferred to 1 ml of saline formaldehyde solution (150 mM NaCl, 3.7% formaldehyde) for cell density determination by measuring the optical density at 600 nm (OD600). The remainder of each sample was treated with 2 µl of toluene and 5% Sarkosyl. Aliquots of this mixture were incubated with 1 ml of 1-mg/ml o-nitrophenyl-ß-D-galactopyranoside (ONPG) in Z buffer at 28°C until the solution reached a light yellow color. At that point, reactions were quenched by adding 0.5 ml of 1 M NaCO3. Reaction mixtures that failed to turn yellow were quenched after 45 min. The cells were pelleted by centrifugation, and the OD420 of the supernatants was measured. Units were calculated according to the following formula, where t is incubation time with ONPG, v is the volume of cells incubated with ONPG, and d is the dilution factor for the cell density measurement: (1,000 x OD420 x d)/(t x v x OD600).

Analysis of other fungal genomes. The sequences of H. capsulatum ELI1, CTR2, and FRL1 were compared to genomes of the following fungi: Ashbya gossypii, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus nidulans, Aspergillus oryzae, Aspergillus terreus, Botryotinia fuckeliana, Candida albicans, Candida glabrata, Candida lusitaniae, Chaetomium globosum, Coccidioides immitis, Coprinus cinereus, Cryptococcus neoformans, Debaryomyces hansenii, Fusarium graminearum, Gibberella moniliformis, Kluyveromyces lactis, Magnaporthe grisea, Neosartorya fischeri, Neurospora crassa, Pneumocystis carinii, Podospora anserina, Rhizopus oryzae, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Sclerotinia sclerotiorum, Stagonospora nodorum, Trichoderma reesei, Uncinocarpus reesii, Ustilago maydis, and Yarrowia lipolytica. BLASTX was used in the cases where annotated protein sequences were available, and TBLASTN was used in the cases where only the genomic sequence was available. BLAST hits with an E value ≤1e-12 were considered to be homologous to the query sequence. Sequence data from a number of sources were interrogated, including the National Center for Biotechnology Information (NCBI), the Broad Institute Fungal Genome Initiative (http://www.broad.mit.edu/annotation/fgi/), the Saccharomyces Genome Database (http://www.yeastgenome.org/cite.shtml), the Candida Genome Database (1), and the Database of Genomes Analyzed at NITE (http://www.bio.nite.go.jp/ngac/e/rib40-e.html). Preliminary sequence data for Aspergillus fumigatus was obtained from The Institute for Genomic Research website at http://www.tigr.org.


arrow
RESULTS
 
Identification of CRP1. To identify a regulatory sequence that could be used for copper-regulated expression of genes, we treated H. capsulatum yeast cells with 100 µM copper sulfate and examined the resultant transcriptional profile by microarray analysis (data not shown). We used a shotgun genomic microarray in which each array element, or spot, consists of either a random genomic clone or a cDNA sequence (14). Among those clones that displayed transcriptional induction in the presence of CuSO4, clone 97B8 contained coding sequence for an ortholog of copper-transporting proteins (34) from other organisms (Fig. 1). We named this gene CRP1 (copper-sulfate regulated protein) and reasoned that its upstream sequence was likely to confer transcriptional induction in the presence of copper.


Figure 1
View larger version (82K):
[in this window]
[in a new window]
 
FIG. 1. CRP1 encodes a putative copper ion pump. (A) Diagram of the CRP1 gene locus, showing the position of the 97B8 microarray element. 5' RACE analysis determined that transcription begins 331 nucleotides upstream of the ATG start codon (arrow). Whereas pDG7 contains sequence from position –1451 to the ATG, pDG8 and pDG10 contain sequence from position –1276 to the ATG. The predicted coding sequence of the gene extends from the ATG to a TGA codon at position +3789. No experimental analysis has been completed regarding the existence or location of potential introns. HMA motifs are marked by light gray boxes numbered 1 through 4. HMA1 spans amino acid residues 32 to 95, HMA2 spans residues 219 to 283, HMA3 spans residues 302 to 365, and HMA4 spans residues 389 to 458. The E1-E2 ATPase motif is marked by a dark gray box labeled 5 and spans residues 619 to 867. The hydrolase motif is marked by a black box labeled 6 and spans residues 871 to 1141. (B) Multiple protein sequence alignment comparing H. capsulatum Crp1 (HcCrp1) to known fungal copper extrusion proteins Candida albicans Crp1 (CaCrp1), Colletotrichum lindemuthianum CLAP1 (ClCLAP1), and the mammalian copper extrusion pump Homo sapiens ATP7B (HsATP7B). Residues that are conserved (i.e., similar or identical) in two or three proteins in the alignment are highlighted in gray. Residues that are conserved in all four proteins are highlighted in black.

Because this work predated the H. capsulatum genome-sequencing project, it was necessary to obtain a genomic clone to characterize the entire CRP1 locus. Several large genomic clones containing the CRP1 gene were obtained by screening a lambda genomic library with a probe containing sequence from clone 97B8. The putative structure of the CRP1 gene was determined after sequencing these clones (Fig. 1A). We used 5' RACE to determine that the start site for transcription of the gene is at –331 relative to the ATG (data not shown). The predicted protein contains four N-terminal repeats of a heavy metal-associated (HMA) domain and a C-terminal ATPase motif and hydrolase motif characteristic of cation transporters (http://myhits.isb-sib.ch/cgi-bin/motif_scan). A multiple sequence alignment of a human copper extrusion pump, the copper extrusion pumps from the fungi Candida albicans and Colletotrichum lindemuthianum, and the H. capsulatum Crp1 protein revealed extensive homology over the entire sequence (Fig. 1B).

CRP1 upstream region drives copper-regulated transcription. To determine whether the upstream region of CRP1 is sufficient to drive copper-regulated gene expression of a heterologous reporter gene, we placed either the lacZ or GFP coding sequence under the control of the CRP1 upstream region (PCRP1). The PCRP1-lacZ and PCRP1-GFP constructs were expressed on telomeric plasmids in the G217B ura5-23 strain. The CRP1 upstream region was sufficient to confer copper-dependent expression of both lacZ and GFP (Fig. 2). ß-Galactosidase activity was dose dependent through a range of CuSO4 concentrations from 1 to 100 µM (Fig. 2A), indicating that it may be possible to titrate CRP1 promoter activity. Expression of PCRP1-GFP allowed the examination of promoter activity in individual cells (Fig. 2B). Although the majority of cells show a GFP signal in the presence of exogenous CuSO4, a few cells do not, likely due to lower copy number or loss of the telomeric plasmid, which does not contain a segregation sequence (39).


Figure 2
View larger version (57K):
[in this window]
[in a new window]
 
FIG. 2. Conditional expression of reporter genes under the control of the CRP1 promoter. (A) lacZ expression. DG8 transformants were spotted onto HMM plates supplemented with 0, 1, 5, 10, or 100 µM CuSO4 and grown for 7 days. Each spot was treated with 2 mg/ml X-Gal dissolved in dimethyl formamide and incubated for 30 min at room temperature before the plates were photographed. (B) GFP expression. DG10 transformants were induced for 12 h in HMM broth supplemented with 50 µM CuSO4, fixed in 4% paraformaldehyde, and examined under a microscope.

We used a liquid ß-galactosidase assay to quantitate copper-dependent induction of PCRP1-lacZ at different concentrations of CuSO4. A 100-ml culture carrying the PCRP1-lacZ plasmid was grown to mid-log phase, aliquots of this culture were treated with various concentrations of CuSO4 for 8 h, and Miller units of ß-galactosidase activity were determined (Fig. 3A). Maximal induction (between 107-fold and 125-fold) was observed for the 1, 5, and 10 µM samples compared to the control culture. Since high concentrations of exogenous CuSO4 can be lethal, the viability of cells was monitored in parallel by determining the number of CFU at the 4-hour and 8-hour time points (Fig. 3B). As a control, untreated cells (0 µM sample) were shown to grow normally over the 8-hour period. In contrast, cells treated with 10 µM CuSO4 failed to increase in number over the time period of the experiment, and cells treated with higher concentrations had a significant viability defect. This decrease in viability at higher concentrations of CuSO4 is likely to account for the concomitant decrease in ß-galactosidase activity (Fig. 3A).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. Effects of CuSO4 on CRP1 promoter expression and H. capsulatum viability. DG7 transformants were incubated in HMM with CuSO4 added at a final concentration of 0, 1, 5, 10, 50, 100, 200, or 500 µM for 8 hours. (A) The mean ß-galactosidase activity of each sample in Miller units is shown on the y axis. Numbers above each bar reflect the change in induction (n-fold) over the uninduced (0 µM) sample. Error bars indicate 1 standard deviation. (B) Viability was assessed by plating three independent dilutions of the cells on HMM plates at 0, 4, and 8 h after the addition of copper and counting CFU. The dashed line indicates the mean number of CFU recovered from the 0-h time point, and the error bars indicate 1 standard deviation.

Characterization of transcriptional induction of CRP1. The ideal conditional promoter would allow rapid transcriptional induction of a gene of interest without significant perturbation of the global transcript profile. We tested two concentrations of CuSO4 to identify a concentration that allowed induction of the CRP1 gene with minimal disturbance of the expression profile. We exposed H. capsulatum cells to either 10 or 50 µM CuSO4 for an 8-hour period. Cells were harvested at various time points after the addition of CuSO4, followed by RNA isolation and preparation of samples for microarray analysis (Fig. 4). The transcriptional profile of each sample relative to the zero time point was determined as described in Materials and Methods.


Figure 4
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 4. Copper sulfate stress microarray experiments. (A) Comparison of H. capsulatum response to 10 µM and 50 µM CuSO4. H. capsulatum yeast cells were incubated with either 10 or 50 µM CuSO4 for 8 h, and gene expression analysis was performed at 0.5, 2, 4, and 8 h after the addition of CuSO4 using H. capsulatum shotgun genomic microarrays (14) as described in Materials and Methods. Shown here is a hierarchical clustering of all microarray clones induced or repressed by fourfold or more in at least one sample. The shaded triangle above each of the two experiments indicates increasing time. U represents an 8-hour H. capsulatum culture grown in parallel in the absence of exogenous CuSO4. Red indicates genes that are up-regulated in a particular sample, green indicates genes that are down-regulated, black indicates genes that do not change in expression, and gray indicates that no data are available. (B) Enlarged image of the region of the cluster containing two microarray elements that contain homology to CRP1. Strong up-regulation of CRP1 by CuSO4 is seen as early as 30 min. CRP1 remains up-regulated for the duration of the incubation with CuSO4. The 8-hour untreated microarray (U) shows that CRP1 is not induced in the absence of exogenous CuSO4. (C) Graph of the ratio of intensities of all elements at the 30-min time point in microarrays relative to the zero time point for the 10 µM and 50 µM CuSO4 treatments. For each element in the 30-min microarrays of the 10 µM and 50 µM experiments, the log2 of the 635-nm/532-nm signal intensity ratio (i.e., log2 of the change in expression) was calculated and plotted as shown. Elements with a log2 of 0 represent genes whose expression is not affected by addition of copper, elements with a log2 >0 represent induced genes, and elements with a log2 <0 represent repressed genes. The 50 µM treatment gives a wider and shorter distribution of elements than the 10 µM treatment, indicating a greater perturbation of gene expression by the 50 µM treatment. (D) Induction levels for element 97B8 across all microarrays. The 635-nm/532-nm signal intensity ratio for the 97B8 element (after transformation relative to the zero time point as described in Materials and Methods) is shown for both experiments. Induction is highest 30 min after the addition of 50 µM CuSO4 but is less pronounced at later time points. After addition of 10 µM CuSO4, induction occurred by 30 min, dipped at 2 and 4 h, and rose again at 8 h. (E) Confirmation of microarray results by Northern analysis. Total RNA from each time point in the 10 µM CuSO4 treatment was run on a denaturing gel and probed with the CRP1 coding sequence. The blot was then stripped and hybridized to an ACT1 probe as an RNA loading control.

Microarray data were then subjected to hierarchical clustering to identify array elements with common patterns of gene expression. The cluster of 232 array elements that were induced or repressed at least fourfold in at least one sample is shown in Fig. 4A; the transformed intensity ratios (log2 of the change in expression) for this experiment are available as supplemental material. The 42G7 and 97B8 elements contain sequence from the CRP1 gene and cluster together (Fig. 4B). The effect of CuSO4 on the global transcript profile is depicted in Fig. 4C, which graphs the 10 µM and 50 µM CuSO4 array data for the 30-minute time point. This graph shows the number of array elements versus their change in gene expression as determined by the log2 of the change in signal intensity. The peak for the 50 µM array is broader and shorter than the peak for the 10 µM array, indicating that more genes show a higher change in the 50 µM experiment. The same pattern is observed for the other time points (data not shown). The CRP1 gene was induced in both 10 and 50 µM CuSO4, as evidenced by the 12.5-fold induction and 19-fold induction seen for the 97B8 element in the 10 and 50 µM experiments, respectively (Fig. 4D). Northern analysis of the CRP1 transcript in the 10 µM experiment showed a pattern of induction consistent with the array data (Fig. 4E), and this same pattern was observed in an independent time course of cells treated with 10 µM CuSO4 (data not shown). Taken together, these data demonstrate that 10 µM CuSO4 induced CRP1 to significant levels without perturbing as many other genes as 50 µM CuSO4. Thus 10 µM CuSO4 appears to be a satisfactory concentration to use for ectopic gene expression using the CRP1 promoter (see Discussion).

Copper-repressible genes in H. capsulatum. The array experiments also revealed the existence of copper-repressible genes in H. capsulatum (Fig. 5A). The promoters of such genes could also provide a useful means of ectopic gene regulation in H. capsulatum. To annotate at least a subset of the repressed genes, we obtained sequence information for the relevant array clones that were repressed upon exposure to both 10 and 50 µM CuSO4. We used BLASTx analysis against the nonredundant protein database maintained by the NCBI to identify any homologs of the corresponding genes and then named the H. capsulatum genes accordingly. We identified seven elements representing a cDNA that is homologous to Podospora anserina CTR3 (2). In P. anserina, CTR3 encodes a copper uptake transporter that is transcriptionally induced under low-copper conditions and repressed in high-copper conditions. Other highly repressed genes include ELI1, a homolog of the Coccidioides immitis gene encoding ELI-Ag1, whose function in C. immitis is unknown (15). ELI1 was represented by two microarray elements: one derived from a cDNA clone (spot C3E2) and one derived from a shotgun genomic fragment (spot 55D9, which also contains partial sequence for a neighboring gene) (Fig. 5A and C). One of the mildly repressed genes (CTR2) is homologous to Podospora anserina CTR2, which encodes a low-affinity copper uptake transporter (2). The other mildly repressed gene (FRL1, ferric reductase-like 1) is homologous to C. albicans CFL1 and S. cerevisiae FRE1 (10, 11), which encode a copper-dependent ferric reductase that is induced only under low-copper conditions.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5. Copper sulfate-repressed cluster. (A) Expanded image of the repressed elements in the 10 and 50 µM CuSO4 experiments. The shaded triangle above each of the two treatments indicates increasing time. U represents an 8-hour H. capsulatum culture grown in parallel in the absence of exogenous CuSO4. Red indicates genes that are up-regulated in a particular sample, green indicates genes that are down-regulated, black indicates genes that do not change in expression, and gray indicates that no data are available. Elements of interest are annotated by their spot identification numbers followed by the name of the corresponding gene or genes. The CTR3 gene is represented by multiple array spots. (B) Signal intensity ratios of four representative elements that showed repression in the presence of 10 µM CuSO4. Cells were collected from two independent 10 µM CuSO4 time courses and subjected to independent microarray analysis as described in Materials and Methods. The mean 532-nm/635-nm signal intensity ratios from these two experiments are shown for four microarray elements. Two of these elements, C3E2 and C3G7, corresponding to EL1I and CTR3, respectively, represent highly repressed genes. The other two elements, 35D6 and 69F11, corresponding to CTR2 and FRL1, respectively, represent genes that are repressed to a lesser extent. Error bars indicate 1 standard deviation. In one of the two data sets, no data were available for element 69F11, so the standard deviation could not be determined. (C) Three of the four repressed genes map to adjacent positions in the genome. Black arrows represent regions of homology to genes in the NCBI nr database. Boxes above the arrows show the alignment of microarray elements with the genomic sequence. Names of the putative genes are shown below the corresponding arrows.

Repression of this subset of genes relative to the zero time point is shown in Fig. 5B. The genes exhibited different levels of maximal repression upon exposure to CuSO4 at different time points. For example, when cells were exposed to 10 µM CuSO4, FRL1 was repressed approximately 2.5-fold over the entire time course whereas CTR3 reached a maximum of 21-fold repression at the 2-hour time point. The regulatory sequences of these genes may be useful for engineering copper-repressible constructs in future experiments.

Interestingly, we observed that, in H. capsulatum, several of the copper-repressed genes (FRL1, CTR2, and ELI1) are adjacent to each other in the genome (Fig. 5C). We explored available sequence information (see Materials and Methods) to determine if these genes are universally clustered in fungi. We identified potential orthologs of all three genes in Botryotinia fuckeliana, Chaetomium globosum, Coccidioides immitis, Magnaporthe grisea, Neosartorya fischeri, Neurospora crassa, Sclerotinia sclerotiorum, Stagonospora nodorum, Trichoderma reesei, Uncinocarpus reesii, Yarrowia lipolytica, Aspergillus flavus, A. clavatus, A. fumigatus, A. oryzae, and A. terreus (but not A. nidulans). Of these genomes, the three genes in question displayed genomic clustering in C. immitis, S. nodorum, U. reesii, Y. lipolytica, N. fischeri, and all Aspergillus species that contain the relevant homologs. The structure of the genomic cluster is shown for a subset of these genomes in Fig. 6A. The phylogenetic tree in Fig. 6B (derived from information at http://fungal.genome.duke.edu/#phylogeny) shows the relative evolutionary relationship of genomes that (i) contain a genomic cluster of the three orthologs, (ii) contain orthologs of the three genes that fail to be clustered in the genome, or (iii) do not contain orthologs of all three genes. U. reesii, which has retained the genomic cluster but is not represented on the phylogenetic tree, is a close (but nonpathogenic) relative of Coccidioides species and thus a member of the C lineage. Similarly, S. nodorum, which also contains the cluster but is not represented in Fig. 6B, is a relative of the C lineage (http://fungal.genome.duke.edu/#phylogeny). Y. lipolytica is the only known B lineage descendant that contains the genomic cluster. This phylogenetic analysis suggests that the genomic cluster was present in a common ancestor of the A and B lineages depicted in Fig. 6B but retained only in a small subset of descendants. Furthermore, obvious homologs of the ELI1 and CTR2 genes are limited to the A lineage, with the exception of Y. lipolytica, which is in the B lineage. Interestingly, Y. lipolytica is more resistant to copper than S. cerevisiae (29), suggesting that it may have a fundamentally different response to changes in exogenous copper levels than other members of the B lineage.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. Phylogenetic analysis of a copper-repressed cluster. (A) Schematic showing the arrangement of copper-repressed genes FRL1, CTR2, and ELI1 in representative fungal genomes where the genes are clustered. The C. immitis genome has what appears to be a transposon insertion between CTR2 and ELI1, as represented in the figure. N. fischeri, A. flavus, A. clavatus, A. terreus, and U. reesii are not included in this diagram because the annotation of these genomes is not complete and the location of exact gene boundaries for the three genes is ambiguous. (B) Fungal phylogenetic tree derived from http://fungal.genome.duke.edu/#phylogeny. Genomes that contain a cluster of the three orthologs are shown in red, genomes that contain orthologs of the three genes that fail to be clustered in the genome are shown in blue, genomes that do not contain orthologs of all three genes are shown in green, and genomes that were not examined are shown in black. S. nodorum and U. reesii contain the genomic cluster but are not depicted in the diagram (see text). A, B, and C denote lineages that are described in the text.


arrow
DISCUSSION
 
Using a shotgun genomic microarray, we identified a conditional promoter (PCRP1) that is sufficient to drive copper-inducible expression of heterologous genes in H. capsulatum. This regulatory sequence is the first inducible promoter that has been characterized for H. capsulatum, and it has already been used successfully for ectopic expression of genes of interest (22). This identification of a conditional promoter complements the previous development of other molecular genetic tools in H. capsulatum such as gene disruption, RNA interference, and insertional mutagenesis (20, 28, 31, 32, 36).

At the time this work was initiated, the H. capsulatum genome was not yet sequenced. As an alternative to cloning H. capsulatum homologs of known conditionally regulated genes in other organisms, we undertook an unbiased search for copper sulfate-regulated genes using a shotgun genomic microarray that represents partial coverage of the H. capsulatum genome (14). Since the use of conditional promoters often requires a significant environmental change (such as a shift to a different carbon source, a change in amino acid composition, or the addition of an inducing compound such as CuSO4), substantial genome-wide changes in gene expression can result. Our gene expression profiling experiments allowed us to identify a concentration of CuSO4 (10 µM) that caused marked induction of CRP1 without large-scale shifts in gene expression for the other genes on the microarray. On the other hand, cells treated with 10 µM CuSO4 for 8 h had a growth defect (Fig. 3B). These data suggest that 1 or 5 µM CuSO4, which also triggers robust induction of lacZ (Fig. 3A), may be better suited for experiments where the CRP1 promoter must be induced for sustained time periods. Additionally, levels of the endogenous CRP1 transcript varied at different time points after copper addition as shown in Fig. 4, although these differences might reflect variables other than promoter activity, such as mRNA stability. Therefore, the ideal concentration to induce a given transcript of interest will likely depend on its half-life and the nature of the assay needed to assess the consequences of its ectopic expression.

We used CuSO4 addition to identify a conditional promoter for H. capsulatum because copper-regulated gene expression has been well characterized in other organisms (10, 17, 18, 23, 24, 27, 33, 41). Another advantage of CuSO4 is that it can be easily added to liquid medium or plates to trigger gene induction. Furthermore, the CRP1 promoter can be induced at 25°C when H. capsulatum is growing in the filamentous form (V. Nguyen and A. Sil, unpublished observations), which means that its utility is not limited to the yeast form of the organism. However, induction of ectopic expression via CuSO4 is not ideal for all scenarios. For example, since mammalian host cells have their own homeostatic mechanisms that regulate intracellular copper concentration, addition of CuSO4 to the media may not induce copper-dependent gene expression in H. capsulatum yeasts that are replicating inside macrophages. Furthermore, there is a low basal level of CRP1 promoter activity even in the absence of exogenous CuSO4 addition (D. Gebhart, unpublished observations); this basal activity may be due to the low levels (10 nM) of copper that are present in HMM. If the CRP1 promoter is used to express a particularly stable transcript, the basal level of CRP1 promoter activity might cause sufficient transcript accumulation under noninducing conditions to interfere with some experimental strategies. Nonetheless, the CRP1 promoter is an effective tool for rapid and facile induction of gene expression in a number of scenarios (22) and is now being used to build libraries of copper-inducible genes for a variety of genetic screens.

In addition to CRP1, our microarray experiments revealed a number of CuSO4-induced and -repressed genes, although the majority of these await annotation. Of note, we observed that several CuSO4-repressed genes were located next to each other in the genome. This genomic cluster of three genes was present in 10 of 33 fungal genomes examined, though the significance of the cluster is unknown. Increasing evidence indicates that the order of genes in eukaryotes is nonrandom, though the precise mechanisms responsible for the generation and retention of genomic clusters are unclear (4, 12, 13, 19, 35). Specifically, linkage of coexpressed genes has been observed (4, 12, 13), leading to the speculation that physical proximity of genes may enhance coordinated gene expression via local changes in chromatin structure. In the case of the H. capsulatum copper-repressed genomic cluster, since the function of the genes is unknown, it is difficult to speculate about possible selective pressures that might favor linkage of these genes. In the future, a comprehensive analysis of gene expression responses to CuSO4 using a whole-genome microarray will allow the identification of the full complement of genes whose expression is affected by CuSO4, as well as a more detailed examination of physical linkage of CuSO4-regulated genes.

Though this work focuses on the use of the CRP1 promoter as a molecular genetic tool, it is interesting to speculate on whether the CRP1 gene or other CuSO4-regulated genes might promote the virulence of H. capsulatum in the host. Certainly the control of intracellular copper levels, which is likely to be influenced by Crp1p, is critical to modulate energy generation, iron uptake, protection against oxidative stress, and melanin formation (29), all of which may affect virulence. In the fungal pathogen C. neoformans, activity of the melanin biosynthetic enzyme laccase, which is required for virulence (30), is influenced by copper levels (42). Other data imply a more direct role for copper transporters during infection of the host; for example, clap1, the ortholog of H. capsulatum CRP1 in the phytopathogenic fungus C. lindemuthianum, is required for pathogenesis (25). Similarly, mutation of CtpA, a copper-transporting P-type ATPase in Listeria monocytogenes, results in a marked reduction in host colonization (9). The specific roles of copper and CRP1 in H. capsulatum virulence remain to be explored.


arrow
ACKNOWLEDGMENTS
 
We thank Linda Eissenberg and William Goldman for the generous gift of strains and plasmids. We thank Lena Hwang and Jasper Rine for the lambda library used in this study. We thank the Genome Sequencing Center at Washington University, St. Louis, MO, for useful sequence information. We are grateful to members of the Sil laboratory for helpful comments on the manuscript. Preliminary sequence data for Aspergillus fumigatus was obtained from The Institute for Genomic Research website at http://www.tigr.org.

Sequencing of Aspergillus fumigatus was funded by the National Institute of Allergy and Infectious Diseases, U01 AI 48830, to David Denning and William Nierman, the Wellcome Trust, and Fondo de Investicagiones Sanitarias. This work was supported by the American Cancer Society (RSG-01-039-01-MBC to A.S.), NIH (R01AI066224 to A.S.), the Sandler Program in Basic Sciences, and Howard Hughes Medical Institute Biomedical Research Support Program grant 5300246 to the UCSF School of Medicine.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Microbiology and Immunology, University of California, San Francisco, San Francisco, CA 94143-0414. Phone: (415) 502-1805. Fax: (415) 476-8201. E-mail: sil{at}cgl.ucsf.edu. Back

{dagger} Supplemental material for this article may be found at http://ec.asm.org/. Back

{ddagger} These two authors contributed equally to this work. Back

§ Present address: Department of Organismic & Evolutionary Biology, Harvard University, 26 Oxford St., Cambridge, MA 02138. Back


arrow
REFERENCES
 
    1
  1. Arnaud, M. B., M. C. Costanzo, M. S. Skrzypek, G. Binkley, C. Lane, S. R. Miyasato, and G. Sherlock. 2005. The Candida Genome Database (CGD), a community resource for Candida albicans gene and protein information. Nucleic Acids Res. 33:D358-D363.[Abstract/Free Full Text]
  2. 2
  3. Borghouts, C., C. Q. Scheckhuber, O. Stephan, and H. D. Osiewacz. 2002. Copper homeostasis and aging in the fungal model system Podospora anserina: differential expression of PaCtr3 encoding a copper transporter. Int. J. Biochem. Cell Biol. 34:1355-1371.[CrossRef][Medline]
  4. 3
  5. Bullock, W. E. 1993. Interactions between human phagocytic cells and Histoplasma capsulatum. Arch. Med. Res. 24:219-223.[Medline]
  6. 4
  7. Cohen, B. A., R. D. Mitra, J. D. Hughes, and G. M. Church. 2000. A computational analysis of whole-genome expression data reveals chromosomal domains of gene expression. Nat. Genet. 26:183-186.[CrossRef][Medline]
  8. 5
  9. DeRisi, J. L., V. R. Iyer, and P. O. Brown. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278:680-686.[Abstract/Free Full Text]
  10. 6
  11. Eisen, M. B., P. T. Spellman, P. O. Brown, and D. Botstein. 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. USA 95:14863-14868.[Abstract/Free Full Text]
  12. 7
  13. Eissenberg, L. G., and W. E. Goldman. 1991. Histoplasma variation and adaptive strategies for parasitism: new perspectives on histoplasmosis. Clin. Microbiol. Rev. 4:411-421.[Abstract/Free Full Text]
  14. 8
  15. Eissenberg, L. G., and W. E. Goldman. 1994. The interplay between Histoplasma capsulatum and its host cells. Balliere's Clin. Infect. Dis. 1:265-283.
  16. 9
  17. Francis, M. S., and C. J. Thomas. 1997. Mutants in the CtpA copper transporting P-type ATPase reduce virulence of Listeria monocytogenes. Microb. Pathog. 22:67-78.[CrossRef][Medline]
  18. 10
  19. Gross, C., M. Kelleher, V. R. Iyer, P. O. Brown, and D. R. Winge. 2000. Identification of the copper regulon in Saccharomyces cerevisiae by DNA microarrays. J. Biol. Chem. 275:32310-32316.[Abstract/Free Full Text]
  20. 11
  21. Hammacott, J. E., P. H. Williams, and A. M. Cashmore. 2000. Candida albicans CFL1 encodes a functional ferric reductase activity that can rescue a Saccharomyces cerevisiae fre1 mutant. Microbiology 146(Pt. 4):869-876.[Abstract/Free Full Text]
  22. 12
  23. Hurst, L. D., C. Pal, and M. J. Lercher. 2004. The evolutionary dynamics of eukaryotic gene order. Nat. Rev. Genet. 5:299-310.[CrossRef][Medline]
  24. 13
  25. Hurst, L. D., E. J. Williams, and C. Pal. 2002. Natural selection promotes the conservation of linkage of co-expressed genes. Trends Genet. 18:604-606.[CrossRef][Medline]
  26. 14
  27. Hwang, L., D. Hocking-Murray, A. K. Bahrami, M. Andersson, J. Rine, and A. Sil. 2003. Identifying phase-specific genes in the fungal pathogen Histoplasma capsulatum using a genomic shotgun microarray. Mol. Biol. Cell 14:2314-2326.[Abstract/Free Full Text]
  28. 15
  29. Ivey, F. D., D. M. Magee, M. D. Woitaske, S. A. Johnston, and R. A. Cox. 2003. Identification of a protective antigen of Coccidioides immitis by expression library immunization. Vaccine 21:4359-4367.[CrossRef][Medline]
  30. 16
  31. Kugler, S., B. Young, V. L. Miller, and W. E. Goldman. 2000. Monitoring phase-specific gene expression in Histoplasma capsulatum with telomeric GFP fusion plasmids. Cell. Microbiol. 2:537-547.[CrossRef][Medline]
  32. 17
  33. Labbe, S., and D. J. Thiele. 1999. Copper ion inducible and repressible promoter systems in yeast. Methods Enzymol. 306:145-153.[Medline]
  34. 18
  35. Labbe, S., and D. J. Thiele. 1999. Pipes and wiring: the regulation of copper uptake and distribution in yeast. Trends Microbiol. 7:500-505.[CrossRef][Medline]
  36. 19
  37. Lee, J. M., and E. L. Sonnhammer. 2003. Genomic gene clustering analysis of pathways in eukaryotes. Genome Res. 13:875-882.[Abstract/Free Full Text]
  38. 20
  39. Magrini, V., and W. E. Goldman. 2001. Molecular mycology: a genetic toolbox for Histoplasma capsulatum. Trends Microbiol. 9:541-546.[CrossRef][Medline]
  40. 21
  41. Newman, S. L. 1999. Macrophages in host defense against Histoplasma capsulatum. Trends Microbiol. 7:67-71.[CrossRef][Medline]
  42. 22
  43. Nittler, M. P., D. Hocking-Murray, C. K. Foo, and A. Sil. 2005. Identification of Histoplasma capsulatum transcripts induced in response to reactive nitrogen species. Mol. Biol. Cell 16:4792-4813.[Abstract/Free Full Text]
  44. 23
  45. O'Halloran, T. V. 1993. Transition metals in control of gene expression. Science 261:715-725.[Abstract/Free Full Text]
  46. 24
  47. Ory, J. J., C. L. Griffith, and T. L. Doering. 2004. An efficiently regulated promoter system for Cryptococcus neoformans utilizing the CTR4 promoter. Yeast 21:919-926.[CrossRef][Medline]
  48. 25
  49. Parisot, D., M. Dufresne, C. Veneault, R. Lauge, and T. Langin. 2002. clap1, a gene encoding a copper-transporting ATPase involved in the process of infection by the phytopathogenic fungus Colletotrichum lindemuthianum. Mol. Genet. Genomics 268:139-151.[CrossRef][Medline]
  50. 26
  51. Patel, J. B., J. W. Batanghari, and W. E. Goldman. 1998. Probing the yeast phase-specific expression of the CBP1 gene in Histoplasma capsulatum. J. Bacteriol. 180:1786-1792.[Abstract/Free Full Text]
  52. 27
  53. Quinn, J. M., J. Kropat, and S. Merchant. 2003. Copper response element and Crr1-dependent Ni2+-responsive promoter for induced, reversible gene expression in Chlamydomonas reinhardtii. Eukaryot. Cell 2:995-1002.[Abstract/Free Full Text]
  54. 28
  55. Rappleye, C. A., J. T. Engle, and W. E. Goldman. 2004. RNA interference in Histoplasma capsulatum demonstrates a role for alpha-(1,3)-glucan in virulence. Mol. Microbiol. 53:153-165.[CrossRef][Medline]
  56. 29
  57. Rees, E. M., and D. J. Thiele. 2004. From aging to virulence: forging connections through the study of copper homeostasis in eukaryotic microorganisms. Curr. Opin. Microbiol. 7:175-184.[CrossRef][Medline]
  58. 30
  59. Salas, S. D., J. E. Bennett, K. J. Kwon-Chung, J. R. Perfect, and P. R. Williamson. 1996. Effect of the laccase gene CNLAC1, on virulence of Cryptococcus neoformans. J. Exp. Med. 184:377-386.[Abstract/Free Full Text]
  60. 31
  61. Sebghati, T. S., J. T. Engle, and W. E. Goldman. 2000. Intracellular parasitism by Histoplasma capsulatum: fungal virulence and calcium dependence. Science 290:1368-1372.[Abstract/Free Full Text]
  62. 32
  63. Sullivan, T. D., P. J. Rooney, and B. S. Klein. 2002. Agrobacterium tumefaciens integrates transfer DNA into single chromosomal sites of dimorphic fungi and yields homokaryotic progeny from multinucleate yeast. Eukaryot. Cell 1:895-905.[Abstract/Free Full Text]
  64. 33
  65. Thiele, D. J. 1992. Metal-regulated transcription in eukaryotes. Nucleic Acids Res. 20:1183-1191.[Free Full Text]
  66. 34
  67. Weissman, Z., I. Berdicevsky, B. Z. Cavari, and D. Kornitzer. 2000. The high copper tolerance of Candida albicans is mediated by a P-type ATPase. Proc. Natl. Acad. Sci. USA 97:3520-3525.[Abstract/Free Full Text]
  68. 35
  69. Wong, S., and K. H. Wolfe. 2005. Birth of a metabolic gene cluster in yeast by adaptive gene relocation. Nat. Genet. 37:777-782.[CrossRef][Medline]
  70. 36
  71. Woods, J. P. 2002. Histoplasma capsulatum molecular genetics, pathogenesis, and responsiveness to its environment. Fungal Genet. Biol. 35:81-97.[CrossRef][Medline]
  72. 37
  73. Woods, J. P. 2003. Knocking on the right door and making a comfortable home: Histoplasma capsulatum intracellular pathogenesis. Curr. Opin. Microbiol. 6:327-331.[CrossRef][Medline]
  74. 38
  75. Woods, J. P., and W. E. Goldman. 1992. In vivo generation of linear plasmids with addition of telomeric sequences by Histoplasma capsulatum. Mol. Microbiol. 6:3603-3610.[Medline]
  76. 39
  77. Woods, J. P., E. L. Heinecke, and W. E. Goldman. 1998. Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum. Infect. Immun. 66:1697-1707.[Abstract/Free Full Text]
  78. 40
  79. Worsham, P. L., and W. E. Goldman. 1988. Quantitative plating of Histoplasma capsulatum without addition of conditioned medium or siderophores. J. Med. Vet. Mycol. 26:137-143.[Medline]
  80. 41
  81. Yamamoto, K., and A. Ishihama. 2005. Transcriptional response of Escherichia coli to external copper. Mol. Microbiol. 56:215-227.[CrossRef][Medline]
  82. 42
  83. Zhu, X., J. Gibbons, S. Zhang, and P. R. Williamson. 2003. Copper-mediated reversal of defective laccase in a {Delta}vph1 avirulent mutant of Cryptococcus neoformans. Mol. Microbiol. 47:1007-1014.[CrossRef][Medline]


Eukaryotic Cell, June 2006, p. 935-944, Vol. 5, No. 6
1535-9778/06/$08.00+0     doi:10.1128/EC.00028-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Nguyen, V. Q., Sil, A. (2008). Temperature-induced switch to the pathogenic yeast form of Histoplasma capsulatum requires Ryp1, a conserved transcriptional regulator. Proc. Natl. Acad. Sci. USA 105: 4880-4885 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gebhart, D.
Right arrow Articles by Sil, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gebhart, D.
Right arrow Articles by Sil, A.