This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lew, R. R.
Right arrow Articles by Shabala, S. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lew, R. R.
Right arrow Articles by Shabala, S. N.

 Previous Article  |  Next Article 

Eukaryotic Cell, March 2006, p. 480-487, Vol. 5, No. 3
1535-9778/06/$08.00+0     doi:10.1128/EC.5.3.480-487.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Role of a Mitogen-Activated Protein Kinase Cascade in Ion Flux-Mediated Turgor Regulation in Fungi

Roger R. Lew,1,{dagger}* Natalia N. Levina,1 Lana Shabala,2 Marinela I. Anderca,1 and Sergey N. Shabala2,{dagger}

Department of Biology, York University, Toronto, Ontario, Canada,1 School of Agricultural Science, University of Tasmania, Hobart, Australia2

Received 1 October 2005/ Accepted 20 December 2005


arrow
ABSTRACT
 
Fungi normally maintain a high internal hydrostatic pressure (turgor) of about 500 kPa. In response to hyperosmotic shock, there are immediate electrical changes: a transient depolarization (1 to 2 min) followed by a sustained hyperpolarization (5 to 10 min) prior to turgor recovery (10 to 60 min). Using ion-selective vibrating probes, we established that the transient depolarization is due to Ca2+ influx and the sustained hyperpolarization is due to H+ efflux by activation of the plasma membrane H+-ATPase. Protein synthesis is not required for H+-ATPase activation. Net K+ and Cl uptake occurs at the same time as turgor recovery. The magnitude of the ion uptake is more than sufficient to account for the osmotic gradients required for turgor to return to its original level. Two osmotic mutants, os-1 and os-2, homologs of a two-component histidine kinase sensor and the yeast high osmotic glycerol mitogen-activated protein (MAP) kinase, respectively, have lower turgor than the wild type and do not exhibit the sustained hyperpolarization after hyperosmotic treatment. The os-1 mutant does not exhibit all of the wild-type turgor-adaptive ion fluxes (Cl uptake increases, but net K+ flux barely changes and net H+ efflux declines) (os-2 was not examined). Both os mutants are able to regulate turgor but at a lower level than the wild type. Our results demonstrate that a MAP kinase cascade regulates ion transport, activation of the H+-ATPase, and net K+ and Cl uptake during turgor regulation. Other pathways regulating turgor must also exist.


arrow
INTRODUCTION
 
Osmotic shock is a perilous condition for any organism. The shock can be due to either hyperosmotic or hypoosmotic changes in the external environment. Unlike unwalled cells (mostly animal), which must remain isotonic to the external environment, organisms having walled cells can utilize a high internal hydrostatic pressure (turgor) created by trans-plasma membrane osmotic gradients to drive cell expansion during growth (15) and, therefore, may regulate turgor to maintain growth.

We are exploring turgor regulation in walled cells directly using pressure probe measurements of turgor. In two species we have examined, turgor is regulated within 60 min: in roots of the higher plant Arabidopsis thaliana (24) and in hyphae of the fungus Neurospora crassa (15). Prior to significant turgor recovery, both organisms exhibit similar electrical changes to hyperosmotic treatment: a hyperpolarization that is probably caused by activation of the plasma membrane proton pump that plays a role in turgor recovery (24).

Mitogen-activated protein (MAP) kinase cascades contribute to osmotic and/or turgor regulation. In yeast, hyperosmotic shock results in the synthesis and accumulation of glycerol, a response mediated by the HOG (high osmotic glycerol) pathway (reviewed by Mager and Siderius [16]). In N. crassa, the genes from a number of mutants sensitive to high osmolarity have been identified as MAP kinase cascade members. The OS-2 protein is homologous to the yeast HOG, a MAP kinase (31). The OS-4 and OS-5 proteins are homologous to the yeast SSK22 and PBS2 (MAP kinase kinase [MAPKK] and MAP kinase [MAPK] kinases, respectively) (5). In addition to MAP kinase cascade genes homologous to those of the yeast HOG pathway, the os-1 gene (18) encodes a histidine kinase homologous to the yeast SLN1, the osmosensing histidine kinase upstream of the yeast HOG pathway. In wild-type N. crassa, one adaptive response to hyperosmotic conditions is glycerol production (3). The os-1 mutant accumulates lower levels of glycerol (3), as do os-2, os-4, and os-5 mutant strains (4).

Besides osmolyte accumulation, other adaptive mechanisms may exist, such as ion accumulation (15). In N. crassa, the size of the hyphal trunk compartments are large enough to allow direct measurements of ion fluxes using noninvasive ion-selective electrodes (19) to assess the role of ion transport in regulating turgor, which is also directly measurable with a pressure probe (15). We examined turgor regulation, electrical responses, and ion fluxes in N. crassa. We compared the wild type to os-1, the putative osmosensor, to test whether the osmosensor mediates turgor regulation caused by changes in net ion fluxes. Turgor regulation and electrical changes were also examined in the os-2 mutant to determine whether the complete MAP kinase cascade mediates the electrical response to hyperosmotic shock. Our results indicate that a MAP kinase cascade regulates ion transport, activation of the plasma membrane H+-ATPase, and net ion uptake during turgor recovery.


arrow
MATERIALS AND METHODS
 
Strains. Stock cultures of the wild type (strain 74-OR23-1A, FGSC no. 987), os-1 (allele B-135, FGSC no. 951), os-2 (allele UCLA80, FGSC no. 2238), and cut (allele LLM1, FGSC no. 2385) were obtained from the Fungal Genetics Stock Center (School of Biological Sciences, University of Missouri, Kansas City, Missouri) (17). The stock cultures were maintained on Vogel's (plus 1.5% [wt/vol] sucrose and 2.0% [wt/vol] agar) medium (VM) (27) and stored at 4°C in petri dishes sealed with Parafilm.

The os-1 B135 allele encodes a single amino acid substitution in the protein (18). To confirm that the os-1 mutant exhibited the correct phenotype and had not reverted to wild type, an agar plug of mycelium grown on VM was placed in the center of a 10 cm petri dish containing either VM, VM plus 4% (wt/vol) NaCl, or VM plus the dicarboximide fungicide vinclozolin (50 µg/ml; Supelco, Bellafonte, PA). Growth at 28°C was quantified every few hours by measuring colony diameter. Growth rates of os-1 were about 70% those of the wild type in VM. Unlike the wild type, the os-1 mutant did not grow in 4% NaCl and was insensitive to vinclozolin, confirming the mutant phenotype (18). The os-2 UCLA80 allele encodes a trp to stop codon mutation in the protein kinase domain and is expected to be nonfunctional (31). The os-2 mutant phenotype was tested for growth from an agar plug of mycelium placed in the center of a 10-cm petri dish containing either VM, VM plus 4% (wt/vol) NaCl, or VM plus the phenylpyrrole fungicide fludioxonil (80 µM; Sigma-Aldrich, Oakville, Ontario). The wild type and os-2 had similar growth rates in VM. Unlike the wild type, the os-2 mutant was unable to grow in 4% NaCl and was insensitive to fludioxonil, confirming the mutant phenotype (31).

Culture preparation for experiments. Cultures used for experiments were grown overnight from 3- by 5-mm agar plugs excised from the stock culture and placed on strips (2.5 by 6 cm) of dialysis tubing scratched with fine sandpaper that overlay the VM in petri dishes. The cultures were incubated at 28°C or at room temperature (21 to 24°C) overnight. Ideally, the mycelium had grown about 3 cm. Just before an experiment, the cellophane strip was cut with scissors or a razor blade to a size of about 1 by 3 cm, which included the growing edge of the colony. Care was taken when moving the cellophane to avoid damaging the hyphae. The cellophane strip with mycelium was placed inside the cover of a 30-mm petri dish, immobilized on the bottom with masking tape or a Plexiglas frame, and flooded with 3 ml of buffer solution (BS) containing (mM concentrations indicated in parentheses) KCl (10), CaCl2 (1), MgCl2 (1), sucrose (133), and Mes (10), with pH adjusted to 5.8 with KOH. The dish cover was transferred to the microscope, and hyphae at the growing edge were monitored to assure that hyphal growth had resumed, which it usually did within 15 to 20 min. Then the colony was used for electrophysiological or turgor measurement experiments. The hyphae chosen for impalements were large-trunk hyphae (10- to 20-µm diameter), usually about 0.5 cm behind the growing edge. Hyperosmotic treatment was usually applied by adding 0.5 ml of BS plus 1,000 mM sucrose (about 1,425 mosmol kg–1) to the 3 ml of BS (about 195 mosmol kg–1). The final osmolality of BS after the addition of BS plus 1,000 mM sucrose was about 350 mosmol kg–1, a net increase of 155 mosmol kg–1. Osmolality was measured with a vapor pressure osmometer (Wescor, Inc., Logan, Utah) or a refractometer for fast confirmations.

Turgor pressure measurements. Pressure probe micropipettes were pulled using a two-pull protocol similar to that used for patch pipettes, with a large tip aperture to allow fluid flow (13, 24). The micropipette was mounted in a brass holder containing a pressure transducer (XT-190-300G; Kulite Semiconductor, Leonia, New Jersey) and connected to a micrometer piston by thick-walled Teflon tubing. The piston, tubing, brass holder, and micropipette were filled with low-viscosity silicone oil (polydimethylsiloxane, 1.5 centistokes; Dow Corning, Midland, MI) (14). Care was taken to remove all air bubbles. The micropipette was positioned perpendicular to the hyphal trunk compartment, appressed against the wall, and tapped to force it to enter the cell. Cytoplasm flowed into the micropipette immediately after the impalement. The pressure was adjusted with the piston micrometer to bring the oil meniscus to the micropipette tip, so that the applied pressure is equal to the hyphal turgor. As an internal control, the presence of hyphal flow through septa separating the trunk compartments and/or nonbulging septa confirmed the integrity of the hypha.

During turgor measurements, the silicon oil meniscus was drawn back from the tip and then repositioned at the tip, at which time the pressure was recorded. Moving the meniscus assured that the micropipette tip had not become plugged and was done periodically, usually every 30 to 90 s. Plugging, when it did occur, appeared to be due to cytoplasmic material inside the tip or surrounding the tip. After recording the initial turgor of the hypha for approximately 6 min, 0.5 ml of BS plus 1,000 mM sucrose was added to the dish already containing 3 ml BS, and recording continued from the same cell compartment as long as possible. The hyperosmotic solution was added in a circle around the microscope objective, arrival of the hyperosmotic solution at the hypha being measured could be determined by the refractive change in the medium caused by the high concentration of sucrose. This method of adding solution avoided significant vibration that could cause the micropipette tip to dislodge from the hypha but meant that the BS plus 1,000 mM sucrose was poorly mixed with the BS and took time to equilibrate. In addition to the refractive wave observed as hyperosmotic solution entered the field of view, the decrease in pressure required to bring the oil meniscus to the micropipette tip confirmed that the hypha was being subjected to high external osmolarity.

If the tip of the pressure probe became irreversibly plugged during recording, it was withdrawn from the cell and a new probe was used to impale a new cell compartment. Every attempt was made to impale the same hypha, a few compartments away from the site of the first impalement, if damage caused by withdrawal of the micropipette did not result in cytoplasm loss from adjacent compartments. Otherwise, a different hypha was used.

Electrophysiological measurements. As for pressure measurements, large-trunk hyphae, usually about 0.5 cm behind the growing edge, were selected for impalements. Double-barrel micropipettes (12, 13) were used to allow simultaneous current injection and potential monitoring for current-voltage measurements. Voltage clamping was performed using an operational amplifier configured as a current-voltage converter, controlled by a computer program via a data acquisition hardware unit (Labmaster DMA, Scientific Solutions, Inc., Solon, Ohio). A voltage range of –300 to 0 mV was clamped using a bipolar step protocol of alternating positive- and negative-going voltages to avoid membrane hysteresis. Clamping currents were not corrected for the cable properties of the hypha (7). We measured the cable length constant (20) along the hypha and across one septal pore to be about 200 µm. Cable-corrected currents should be about 20% of the measured clamping current. However, accurate cable correction requires multiple impalements into adjacent hyphal compartments, very technically difficult when hyperosmotic treatments may cause small movements of the hypha, dislodging the micropipette(s).

After impalement and recording of a stable potential for about 4 min from the hypha in 3 ml of BS, 0.5 ml of BS plus 1,000 mM sucrose was added dropwise in a circle surrounding the objective. Observation of a refractive wave soon after addition confirmed the arrival of hyperosmotic solution at the impaled hypha.

Cycloheximide treatments. To test whether hyperosmotically induced hyperpolarization was due to de novo synthesis of plasma membrane H+-ATPase, hyphae were pretreated for 13.5 to 22.2 min by adding a final concentration of 100 µM cycloheximide (Sigma-Aldrich, Oakville, Ontario) from a 20 mM stock (dissolved in 95% [vol/vol] ethanol, then diluted to 17% ethanol with distilled H2O). The hyperosmotic treatment was given by adding 0.5 ml of BS plus 1,000 mM sucrose to the 3 ml BS as described above.

Ion flux measurements. Noninvasive ion-selective microelectrodes were used to measure the diffusive ion gradients at the surface of the hypha, from which the ion flux across the cell membrane can be calculated (19, 26). The instrumentation (the MIFE technique) was developed at the University of Tasmania (Hobart, Australia) (19, 23). As for electrical and pressure measurements, large-trunk hyphae were selected. Care was taken to assure that there was unobstructed access to the hypha, with no other hyphae in the vicinity, to avoid interfering ion fluxes from neighboring hyphae. The BS was modified to maximize signal-to-noise ratios. It usually contained 0.2 mM KCl, 0.1 mM CaCl2, 0.05 mM MgCl2, and 10 mM morpholineethanesulfonic acid, pH adjusted to 5.8 with bis Tris propane. For H+ flux measurements, buffer was omitted from BS. The ion-selective micropipettes were pulled from 1.5-mm outer diameter, 0.86-mm inner-diameter borosilicate glass tubing. The pulled micropipettes were silanized using tributylchlorosilane (catalog no. 90796; Fluka Chemicals, Busch, Switzerland), and then the tips were broken to an outer diameter of 3 to 5 µm. The micropipette tips were filled with liquid ion exchangers after backfilling (for H+, catalog no. 95297; backfill, 15 mM NaCl and 40 mM KH2PO4; for K+, catalog no. 60031; backfill, 200 mM KCl; for Ca2+, catalog no. 21048; backfill, 500 mM CaCl2; for Cl, catalog no. 24902; backfill, 500 mM NaCl; Fluka) (22). Calibrations with standards were performed before and after each measurement, and electrodes exhibiting a non-Nernstian response (<50 mV per decade for monovalents and <25 mV per decade for Ca2+) with a correlation r of <0.999 were discarded. After positioning near the hypha, ion fluxes were recorded by measuring the ion concentration at two excursion points, one near the hypha (about 5 µm) and the other 20 µm away, at a frequency of 0.1 Hz. The sampling rate was 15 Hz. The difference in ion concentration was then used to calculate the ion flux (in units of nmol m–2 sec–1) based on the hyphal dimensions and assuming the concentration gradient was solely diffusive (19, 26). After measuring the ion flux for about 5 min in 3 ml of BS, 0.5 ml of BS plus 1,000 mM sucrose was added. Because vibration was not a concern during the addition of hyperosmotic solution, the media were mixed to assure rapid and complete equilibration. However, the addition of hyperosmotic solution does disturb diffusive gradients near the hypha. After addition of BS in control experiments, it took about 2 min for diffusive gradients to be reestablished (data not shown); thus, ion flux measurements were recommenced 2 to 5 min after hyperosmotic treatment. The modified BS osmolality was in the range of 140 to 170 mosmol kg–1, and the osmolality of the BS plus 1,000 mM sucrose was adjusted to 1,000 to 1,100 mosmol kg–1. The final osmolality was measured after experiments and was between 320 and 370 mosmol kg–1, so the net osmotic change was about 190 mosmol kg–1.

In initial experiments, there was a background K+ efflux (300 nmol m–2 s–1) from the tape used to hold the cellophane securely in the dish. Initial net K+ fluxes were zero when the hyphae were immobilized with a Plexiglas frame. Some of the wild-type data had to be corrected for the background flux that occurred when tape was used.

Reverse transcription (RT)-PCR measurement of gene expression. Cellophane strips overlaid with mycelium were transferred to an empty petri dish and flooded with 15 ml of BS. After 10 min of preconditioning, 2.5 ml of BS plus 1,000 mM sucrose was added to the dish. Mycelia were harvested after 0, 2, 10, 20, and 60 min and ground to a fine powder in liquid nitrogen. In all cases, 300 µg of the frozen mycelia was used to isolate RNA. The 60-min incubations included a control (2.5 ml of BS added to the initial 15 ml) for direct quantitation of gene expression.

Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA) and mRNA enriched with the PolyATract mRNA isolation system IV (Promega, Madison, Wis.). Gene-specific primers Os1-2fwd (ATCACAAATGCAGCAACAGACGGG), Os1-2r (AACTTCTCGTTTGCCTTGACGGC), Os2-2fwd (AATACGTTCACTCCGCCGGTG), and Os2-2rev (AATCGAACTTCTCCTCGGCAACCGG) were designed to produce fragments of 452 bp (os-1) and 562 bp (os-2). A positive control to examine gene expression in a non-MAP kinase cascade gene was provided using beta-tubulin, a 651-bp fragment obtained with the primers NcTUB1f (AACTTACAAGATGGCAGAGC) and NcTUB2r (AAGGGGTCACTACACTGAGGG). For RT-PCR, the QIAGEN OneStep RT-PCR kit (Hilden, Germany) was used with 6 ng/reaction mixture of mRNA, and the number of cycles required was empirically determined to ensure that the PCR was in the log-linear range (28 cycles of 1 min at 94°C, 1 min at 59°C, and 3 min at 72°C). Additional controls without mRNA (water controls) and with mRNA added after the transcription step were carried out in parallel to ensure lack of contamination (results not shown). All of the oligonucleotide primers used in this study were purchased from Operon Biotechnologies, Inc. (Chicago, IL).

The band sizes for the os-1, os-2, and tubulin bands calculated from molecular markers (0.41, 0.56, and 0.69 kb, respectively) were very similar to the predicted sizes. Quantitation was performed by measuring integrated density of the bands using the public domain ImageJ program (developed at the U.S. National Institutes of Health and available at http://rsb.info.nih.gov/ij/).

Statistical analysis. Data are shown as means ± standard deviations (sample size) unless stated otherwise. Independent two-tailed t tests were performed in either SYSTAT (Systat, Inc.) or Excel (Microsoft).


arrow
RESULTS
 
Initial turgor is different in the os mutants. After flooding the mycelium with BS and growth resumption, the three strains had significantly different turgors. The wild type had the highest turgor (496 ± 87 kPa, n = 26), os-1 had the lowest turgor (302 ± 71 kPa, n = 26), and the os-2 turgor was intermediate (422 ± 64 kPa, n = 32) (Fig. 1). Since the os mutants are unable to grow at high osmolarities, we examined turgor regulation after hyperosmotic treatment.


Figure 1
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Initial turgor in the wild type (WT) and os-1 and os-2 mutants. Two-tailed t test comparisons between the three strains are shown. Data are jittered on the x axis for clarity. The mutant strains exhibited lower turgor, with a ranking of WT > os-2 > os-1. All differences were statistically significant.

The os mutants exhibit turgor recovery. Even though initial turgors were different in os-1 and os-2 compared to the wild type, both of the osmotic mutants did exhibit turgor recovery after hyperosmotic treatment with sucrose (Fig. 2B and C), similar to the wild type (Fig. 2A) (15). The recovery time was similar in all strains; turgor recovered to near initial level within 60 min. Since most phenotype analyses of osmotic mutants have used NaCl to cause hyperosmotic shock, we performed preliminary experiments to show that turgor recovery also occurs after NaCl treatment in the wild type and os-1 (Fig. 2D). We used BS plus 70 mM NaCl (final concentration), which should have an osmolality increase of about 140 mosmol kg–1, similar in magnitude to the hyperosmotic treatment with sucrose. Wild-type turgor recovery was faster in NaCl compared to sucrose, consistent with uptake of the ions from the extracellular medium to counter the high external osmolarity. The time course of os-1 turgor recovery after NaCl treatment was similar to the time course after sucrose treatment.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2. Turgor recovery in the wild type and os-1 and os-2 mutants. Lines show individual experiments; filled symbols show averages. The data for turgor recovery in the wild type (A) are redrawn from Lew et al. (15) with permission of the publisher and involved an osmolality increase of 250 mosmol kg–1. Hyperosmotic treatments for os-1 (B) and os-2 (C) were an increase of 155 mosmol kg–1; both osmotic mutants were capable of turgor recovery within a time frame similar to that for the wild type (60 to 90 min). Turgor recovery experiments when NaCl (BS plus 70 mM NaCl) was used as the osmoticum rather than sucrose are shown in panel D. Circles, wild type; triangles, os-1. Note the different time scale. Wild-type turgor recovery was faster after NaCl treatment.

Rather than taking up sucrose directly, N. crassa relies upon an extracellular invertase and diffusional hexose uptake through a neutral carrier or active uptake through a H+/hexose symport (2). The mechanism underlying turgor recovery after sucrose addition could involve ion transport or osmotic production. If ionic influxes are required, it is expected they will affect the electrical properties of the hyphae, both potential and conductance.

Wild-type hyperpolarization is absent in the os mutants. The electrical differences between the wild type, os-1, and os-2 are shown in Fig. 3 and 4. In all three strains, hyperosmotic treatment caused a transient depolarization. In the wild type, the transient depolarization was followed by a sustained hyperpolarization to a value about 40 mV more negative than the initial potential (Fig. 3A). In os-1, the potential does not repolarize completely after the transient depolarization (Fig. 3B), while the potential repolarized to the initial potential in os-2, an intermediate response between those of the wild type and os-1 (Fig. 3C). The differences in the final potentials of the wild type and the os mutants were statistically significant (Fig. 4). Thus, the wild-type hyperpolarization is absent in the os-1 and os-2 mutants. Hyperosmotically induced conductance changes were similar between the wild type and os-1, with the exception of a large outward current in the wild type at positive potentials during hyperpolarization which was consistent with increased H+-ATPase activity (Fig. 3A, B). The os-2 conductances before and after hyperosmotic treatment were much larger than those of either the wild type or os-1 (Fig. 3C).


Figure 3
View larger version (36K):
[in this window]
[in a new window]
 
FIG. 3. Electrical responses of the wild type (WT) (A) and os-1 (B) and os-2 (C) mutants to hyperosmotic treatment. (Left panels) The membrane potential, from impalement to removal of the micropipette from the hypha, is shown. Hyperosmotic treatment (an increase of 155 mosmol kg–1) was applied as marked by the addition of 0.5 ml BS plus 1,000 mM sucrose to 3 ml BS. After hyperosmotic treatment, the plasma membrane potential undergoes a transient depolarization, followed by a prolonged hyperpolarization in the wild type (A). In os-1 (B), the transient depolarization occurs, but the prolonged hyperpolarization does not. os-2 (C) exhibits a response intermediate between those of os-1 and the wild type. (Right panels) Current-voltage relations are shown for the WT (average of 16 experiments) and os-1 (9 experiments) and os-2 (9 experiments) mutants. The curves are the averages of current-voltage measurements (shown by vertical bars on the membrane potential trace) prior to the hyperosmotic treatment (initial), during the transient depolarized state, and during the final repolarized state, as marked. During the transient depolarization, the current-voltage relation shifts to depolarized potentials during the transient depolarization, but conductance remains the same. During repolarization, the WT conductance decreased at negative potentials and recovered completely at positive voltages. The recovery of the outward current at positive voltages, indicative of positive ion flux out of the cell, is consistent with activation of the plasma membrane proton pump. These changes during repolarization are not observed in os-1, which exhibited a lower conductance at positive voltages compared to the initial current-voltage relation. os-2 had consistently high conductances initially, during the transient depolarization, and during the repolarization.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. Summary of electrical changes in the wild type (WT) compared to the os-1 (A) and os-2 (B) mutants. Because measurements are done on individual hyphal trunk compartments, the WT and the os-1 or os-2 measurements were intermixed for each experimental run. A sample size of 9 was chosen for each set of measurements. P values were obtained from independent two-tailed t tests and are shown for initial potentials, the transient depolarization after hyperosmotic treatment, the final potential, and the difference between the final and initial potentials (all in units of millivolts). Data are jittered on the x axes for clarity. Note that WT hyperpolarizes within about 5 min of hyperosmotic treatment. The hyperpolarization precedes the onset of turgor regulation and is not observed in either the os-1 or os-2 mutant.

To ensure that the absence of hyperpolarization in the os-1 and os-2 mutants was due to a nonfunctional MAP kinase cascade rather than a pleiotropic consequence of osmotic sensitivity, we compared the electrical responses of the wild type with another osmotic mutant, cut (29). Like the os mutants, the cut mutant is unable to grow on VM plus 4% NaCl (data not shown) (29), but it is not a member of the MAP kinase cascade family (29). In an experimental run comparing the wild type and cut, the cut mutant exhibited electrical responses to hyperosmotic treatment that were very similar to those of the wild type (both the transient depolarization and the sustained hyperpolarization). The hyperpolarization observed in cut (–13 ± 28 mV, n = 11) was statistically the same as that in the wild type (–15 ± 35 mV, n = 11) (P = 0.926). Therefore, the hyperpolarization induced by hyperosmotic treatment appears to be mediated by the MAP kinase cascade, either by activating the H+-ATPase directly or by inducing expression of the H+-ATPase gene.

Protein synthesis is not required for the wild-type hyperpolarization. To determine whether the hyperpolarization caused by hyperosmotic treatment in the wild type was due to de novo synthesis of the plasma membrane H+-ATPase, hyphae were preincubated with 100 µM cycloheximide for 13.5 to 22.2 min, followed by hyperosmotic treatment. Cycloheximide at 100 µM is reported to inhibit protein synthesis in N. crassa immediately (9). Tenfold-lower concentrations are reported to inhibit the induction of galactose transport under starvation conditions (21) and protein synthesis and conidial germination (8). Our treatment protocol is similar to that used to examine glucose activation of the H+-ATPase in Fusarium oxysporum (70 µM and 10 min preincubation) (1).

The initial potential in cycloheximide was –138 ± 7 mV (n = 5), which is significantly lower than that in the untreated wild type (–160 ± 15 mV, n = 18) (P = 0.007). After hyperosmotic treatment and transient depolarization (–78 ± 38 mV, n = 5), 4/5 hyphae exhibited a sustained hyperpolarization similar to that of the wild type (–171 ± 15 mV [n = 4] compared to –188 ± 24 mV [n = 18], respectively). Even including the depolarized outlier, the average change from the initial potential (–21 ± 27, n = 5) is not significantly different from the wild-type change (–29 ± 22, n = 18) (P = 0.596). Therefore, the sustained hyperpolarization in response to hyperosmotic stress in the wild type does not appear to require protein synthesis. H+-ATPase activation is the probable cause of the hyperpolarization, an explanation that can be confirmed with ion-selective probe measurements of H+ efflux. The ion-selective probe technique can also reveal the role of other fluxes in turgor recovery.

H+, K+, Cl, and Ca2+ fluxes explain turgor recovery in the wild type but not in os-1. Net fluxes of ions prior to hyperosmotic treatment were compared to those after treatment. A modified BS solution with lower K+, Ca2+, Mg2+, and Cl was used to maximize the signal-to-noise ratio of the ion flux measurements. The os-1 mutant was examined in detail, since it exhibits the lowest turgor and most significant electrical difference compared to the wild type (Fig. 5).


Figure 5
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 5. Ion fluxes in response to hyperosmotic treatment in the wild type (circles) and os-1 mutant (triangles). Data are shown as means ± standard errors for 0.5-min intervals (before) and 1-min intervals (after hyperosmotic treatment) (sample size was 6 or 7). Negative values represent ion efflux from the trunk hyphal compartment; positive values represent ion uptake into the hyphal compartment. (A) H+ efflux is observed in both the wild type and os-1. After hyperosmotic treatment, H+ efflux increases in the wild type but declines in os-1. (B) K+ uptake occurs in the wild type after hyperosmotic treatment but not in os-1. (C) Cl uptake is induced in both the wild type and os-1 after hyperosmotic treatment. (D) There is a transient Ca2+ uptake in both the wild type and os-1 after hyperosmotic treatment, with a time course similar to the transient depolarization in the membrane potential (Fig. 3).

In unbuffered BS, net H+ flux was outward (net efflux of about 400 to 500 nmol m–2 s–1) in both the wild type and os-1, resulting in net acidification of the external medium over time. After hyperosmotic treatment, the wild-type net H+ efflux increased, while the os-1 net H+ efflux declined (Fig. 5A). The onset of the increased H+ efflux in the wild type (3 to 5 min) is similar to the onset of the membrane potential hyperpolarization (3 to 4 min). Thus, H+-ATPase activation is the likely cause of both responses.

In the wild type, net K+ flux shifted to an uptake of about 400 nmol m–2 s–1 within 5 to 10 min after hyperosmotic treatment. This was at a time when turgor was beginning to recover and the membrane potential had hyperpolarized. In the os-1 mutant, K+ flux barely changed from a net flux of zero (Fig. 5B).

Cl uptake (400 to 800 nmol m–2 s–1) occurred within 5 min of the hyperosmotic treatment. The net uptake was observed in both the wild type and the os-1 mutant (Fig. 5C).

There was a transient uptake of Ca2+ in both the wild type and os-1 that was observed immediately (within 1 min) after hyperosmotic treatment, tapering to zero net flux within 5 to 10 min (Fig. 5D). No Ca2+ transient was observed in control experiments when BS was added to the BS solution. The time course of the Ca2+ transient uptake (Fig. 5D) was similar to the transient depolarization (Fig. 3).

The net changes in K+ (400 nmol m–2 s–1) and Cl (600 nmol m–2 s–1) uptake are in the range appropriate for osmotic adjustment required to recover initial turgor. Typical dimensions of a hyphal compartment are 15-µm diameter and 100-µm length, so the surface area is 5.1 x 10–9 m–2 and the volume is 1.8 x 10–11 liters. If the net uptake of K+ and Cl across the plasma membrane is about 1 µmol m–2 s–1, K+ and Cl accumulation in the cell will cause a concentration increase of 17.2 mM min–1, or as much as 1,000 mM in the 60 min required for complete turgor recovery. Thus, ion uptake alone is more than sufficient to account for turgor recovery in the wild type but does not account for turgor recovery in os-1, which does not exhibit K+ influx and must rely upon an alternative pathway.

Increased os-1 and os-2 gene expression is observed only in the os-1 and os-2 mutants. Induction of a MAP kinase cascade transduction pathway can result in increased expression of the MAP kinase cascade genes (28). In contrast with the expectation that members of the osmoresponse transduction pathway would be expressed upon osmotic treatment, gene expression of os-1 and os-2, as well as that of beta-tubulin, exhibited a modest increase in expression in the os-1 and os-2 mutants but not in the wild type (Fig. 6).


Figure 6
View larger version (41K):
[in this window]
[in a new window]
 
FIG. 6. Osmotic effects on os-1, os-2, and tubulin gene expression. RT-PCR was used to examine the effect of osmotic treatment on gene expression in the wild type and the os-1 and os-2 mutant strains. The mycelia were preincubated in 15 ml BS and then treated by adding either 2.5 ml BS (control) or 2.5 ml BS plus 1,000 mM sucrose (osmotic, a net increase of 155 mosmol kg–1). In the wild type, gene expression decreased (os-1 and tubulin, 0.73- and 0.47-fold, respectively) or remained the same (os-2, 1.11-fold) relative to the control. In the os mutants, gene expression remained the same or increased slightly (ranging from 1.11- to 2.41-fold), suggesting that an alternative pathway is affecting gene expression. Similar results were observed in 0- to 60-min time courses.


arrow
DISCUSSION
 
Walled cells such as fungi normally maintain a high internal hydrostatic pressure that can be used to drive cell expansion (15). Direct turgor measurements reveal a significant difference between the wild type and the os-1 and os-2 mutants that lack a complete MAP kinase cascade pathway. The wild-type turgor measurements, 496 ± 87 kPa (n = 26), are very similar to turgors measured by Lew et al. (15): 476 ± 124 kPa (n = 65). In the two osmotic mutants, turgor is significantly lower, and os-1 turgor is significantly lower than the turgor of os-2 (Fig. 1). Even though the os-1 and os-2 mutants are unable to grow at high osmolarity, they are still able to regulate turgor. Therefore, in the absence of a functional MAP kinase cascade, the turgor poise is lower and may be insufficient to maintain turgor when the mutants are subjected to high external osmolarity. The results are consistent with a MAP kinase cascade regulating turgor, but other signal transduction systems must also contribute to turgor regulation. A similar conclusion was reached by Furukawa et al. (6) in an analysis of the Aspergillus nidulans HOG pathway. In N. crassa, in addition to glycerol production as in yeast (3, 5), the MAP kinase cascade regulates turgor (Fig. 2) by activating ion transport, based on our electrical (Fig. 3, 4) and ion flux measurements (Fig. 5).

As reported previously (15), the wild type (and the osmotic mutant cut, which is unrelated to the MAP kinase cascade) exhibits a transient depolarization followed by a sustained hyperpolarization. The transient depolarization was observed in both os mutants, but the hyperpolarization was not (Fig. 3). Unlike os-1, os-2 exhibited an intermediate return to the initial potential, an intermediate response similar to its intermediate turgor magnitude in BS. It is possible that there are multiple pathways after the os-1 step. That is, MAPKK and MAPK kinases may activate other targets besides MAP kinase (the OS-2 protein). This would explain the intermediate response of the os-2 mutant between those of the wild type and the os-1 mutant. On the basis of ion flux measurements, the transient depolarization observed in the wild type and the os mutants can be attributed to Ca2+ influx into the cell (Fig. 5). Stretch-activated Ca2+-permeable channels have been identified in N. crassa (10), although one would expect them to be activated by a hypoosmotic shock that would swell the hypha rather than a hyperosmotic shock that causes cell shrinkage unless they are mechano-sensitive, responding to either tensile or compressive forces on the membrane. Other Ca2+ channels have not been characterized for N. crassa, although genomic analysis does identify a number of putative Ca2+ channels (30). N. crassa has homologs of the yeast Cch1p, Mid1p, and Yvc1p Ca2+-permeable channels (30) and two IP3-activated Ca2+ channels (25). Thus, the cause of the hyperosmotically induced transient Ca2+ influx is not known, but it is probably due to a Ca2+ channel in the plasma membrane.

The hyperpolarization implicates the H+-ATPase. This is corroborated directly by the hyperosmotically induced H+ efflux, which has a time course very similar to the hyperpolarization (Fig. 2, 5). Inhibiting protein synthesis does not affect the hyperpolarization, so the H+-ATPase is activated directly, probably via phosphorylation. Elevated cytoplasmic Ca2+ is also reported to cause hyperpolarization in N. crassa by activating the H+-ATPase (11), but Ca2+ influx cannot be implicated in the electrical response to hyperosmotic shock because the os-1 has a transient Ca2+ influx but does not hyperpolarize.

Turgor recovery can be explained completely by the changes in net ion flux in the wild type: a MAP kinase cascade mediates turgor regulation by regulating ion fluxes, including the activity of the plasma membrane H+-ATPase and K+ uptake. The fact that turgor recovery is also observed in the two os mutants, although they maintain a lower turgor than the wild type, is a clear indication that other signaling pathways are present, acting in concert to maintain turgor during cellular growth. This conclusion is corroborated by the fact that os-1 and os-2 gene expression is stimulated by osmotic treatment only in the os-1 and os-2 mutants, consistent with regulation by alternative osmoresponse pathway(s) (Fig. 6). The absence of osmotically induced expression of os-1 and os-4 was noted by Youssar et al. (29). Expression of cut, which encodes a member of the haloacid dehydrogenase family that may function as a phosphatase, is induced by hyperosmotic treatment (29). Alternative osmoresponse pathway(s) may involve Ca2+, given the presence of transient Ca2+ influx in the wild type and the os-1 mutant, but this possibility awaits further research.


arrow
ACKNOWLEDGMENTS
 
In addition to support from a collaborative Australian Research Council International Linkage grant (to S.N.S. and R.R.L.), this research was supported by grants from the Natural Sciences and Engineering Research Council of Canada (to R.R.L.) and the Australian Research Council (to S.N.S.). Support for the MIFE facility was provided by the Australian Food Safety Centre of Excellence.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, York University, 4700 Keele Street, Toronto, Ontario M3J 1P3, Canada. Phone: (416) 736-5243. Fax: (416) 736-5698. E-mail: planters{at}yorku.ca. Back

{dagger} R.R.L. and S.N.S. contributed equally to the research through a collaborative Australian Research Council International Linkage grant. Back


arrow
REFERENCES
 
    1
  1. Brandao, R. L., I. M. Castro, J. B. Passos, J. R. Nicoli, and J. M. Thevelein. 1992. Glucose-induced activation of the plasma membrane H+-ATPase in Fusarium oxysporum. J. Gen. Microbiol. 138:1579-1586.
  2. 2
  3. Davis, R. H. 2000. Neurospora. Contributions of a model organism, p. 95-97. Oxford University Press, Oxford, England.
  4. 3
  5. Ellis, S. W., M. Grindle, and D. H. Lewis. 1991. Effect of osmotic stress on yield and polyol content of dicoarboximide-sensitive and -resistant strains of Neurospora crassa. Mycol. Res. 95:457-464.
  6. 4
  7. Fujimura, M., N. Ochiai, A. Ichiishi, R. Usami, and I. Yamaguchi. 2000. Sensitivity to phenylpyrrole fungicides and abnormal glycerol accumulation in os and cut mutant strains of Neurospora crassa. J. Pestic. Sci. (Nihon Noyaku Gakkaishi) 25:31-36.
  8. 5
  9. Fujimura, M., N. Ochiai, M. Oshima, T. Motoyama, A. Ichiishi, R. Usami, K. Horikoshi, and I. Yamaguchi. 2003. Putative homologs of SSK22 MAPKK kinase and PBS2 MAPK kinase of Saccharomyces cerevisiae encoded by os-4 and os-5 genes for osmotic sensitivity and fungicide resistance in Neurospora crassa. Biosci. Biotechnol. Biochem. 67:186-191.[CrossRef][Medline]
  10. 6
  11. Furukawa, K., Y. Hoshi, T. Maeda, T. Nakajima, and K. Abe. 2005. Aspergillus nidulans HOG pathway is activated only by two-component signalling pathway in response to osmotic stress. Mol. Microbiol. 56:1246-1261.[CrossRef][Medline]
  12. 7
  13. Gradmann, D., U.-P. Hansen, W. S. Long, C. L. Slayman, and J. Warncke. 1978. Current-voltage relationships for the plasma membrane and its principal electrogenic pump in Neurospora crassa. I. Steady-state conditions. J. Membr. Biol. 39:333-367.[CrossRef][Medline]
  14. 8
  15. Hitchcock, S. E., and V. W. Cochrane. 1969. Effect of cycloheximide and actinomycin D on germinating conidia. Neurospora Newsl. 15:18.
  16. 9
  17. Kappy, M. S., and R. L. Metzenberg. 1967. Multiple alterations in metabolite uptake in a mutant of Neurospora crassa. J. Bacteriol. 94:1629-1637.[Abstract/Free Full Text]
  18. 10
  19. Levina, N. N., R. R. Lew, G. J. Hyde, and I. B. Heath. 1995. The roles of calcium ions and plasma membrane ion channels in hyphal tip growth of Neurospora crassa. J. Cell Sci. 108:3405-3417.[Abstract]
  20. 11
  21. Lew, R. R. 1989. Calcium activates an electrogenic proton pump in Neurospora plasma membrane. Plant Physiol. 91:213-316.[Abstract/Free Full Text]
  22. 12
  23. Lew, R. R. 1991. Electrogenic properties of growing Arabidopsis root hairs: the plasma membrane proton pump and potassium channels. Plant Physiol. 97:1527-1534.[Abstract/Free Full Text]
  24. 13
  25. Lew, R. R. 1996. Pressure regulation of the electrical properties of growing Arabidopsis thaliana L. root hairs. Plant Physiol. 112:1089-1100.[Abstract]
  26. 14
  27. Lew, R. R. 2005. Mass flow and pressure-driven hyphal extension in Neurospora crassa. Microbiology 151:2685-2692.[Abstract/Free Full Text]
  28. 15
  29. Lew, R. R., N. N. Levina, S. K. Walker, and A. Garrill. 2004. Turgor regulation of hyphal organisms. Fungal Genet. Biol. 41:1007-1015.[CrossRef][Medline]
  30. 16
  31. Mager, W. H., and M. Siderius. 2002. Novel insights into the osmotic stress response of yeast. FEMS Yeast Res. 2:252-257.
  32. 17
  33. McCluskey, K. 2003. The Fungal Genetics Stock Center: from molds to molecules. Adv. Appl. Microbiol. 52:245-262.[CrossRef][Medline]
  34. 18
  35. Miller, T. K., S. Renault, and C. P. Selitrennikoff. 2002. Molecular dissection of alleles of the osmotic-1 locus of Neurospora crassa. Fungal Genet. Biol. 35:147-155.[CrossRef][Medline]
  36. 19
  37. Newman, I. A. 2001. Ion transport in roots: measurement of fluxes using ion-selective microelectrodes to characterize transporter function. Plant Cell Environ. 24:1-14.[CrossRef][Medline]
  38. 20
  39. Rall, W. 1977. Core conductor theory and cable properties of neurons, p. 39-97. In E. R. Kandel (ed.), Handbook of physiology, vol. 1. American Physiological Society, Bethesda, Md.
  40. 21
  41. Rand, J. B., and E. L. Tatum. 1980. Characterization and regulation of galactose transport in Neurospora crassa. J. Bacteriol. 141:707-714.[Abstract/Free Full Text]
  42. 22
  43. Shabala, S., and L. Shabala. 2002. Kinetics of net H+, Ca2+, K+, Na+, NH4+, and Cl fluxes associated with post-chilling recovery of plasma membrane transporters in Zea mays leaf and root tissues. Physiol. Plant 114:47-56.[CrossRef][Medline]
  44. 23
  45. Shabala, S. N., I. A. Newman, and J. Morris. 1997. Oscillations in H+ and Ca2+ ion fluxes around the elongation region of corn roots and effects of external pH. Plant Physiol. 113:111-118.[Abstract]
  46. 24
  47. Shabala, S. N., and R. R. Lew. 2002. Turgor regulation in osmotically stressed Arabidopsis thaliana epidermal root cells: direct support for the role of inorganic ion uptake as revealed by concurrent flux and cell turgor measurements. Plant Physiol. 129:290-299.[Abstract/Free Full Text]
  48. 25
  49. Silverman-Gavrila, L. B., and R. R. Lew. 2002. An IP3-activated Ca2+ channel regulates fungal tip growth. J. Cell Sci. 115:5013-5025.
  50. 26
  51. Smith, P. J. S., K. Hammar, D. M. Porterfield, R. H. Sanger, and J. R. Trimarchi. 1999. Self-referencing, non-invasive, ion selective electrode for single cell detection of trans-plasma membrane calcium flux. Microsc. Res. Tech. 48:398-417.
  52. 27
  53. Vogel, H. J. 1956. A convenient growth medium for Neurospora. Microb. Genet. Bull. 13:42-46.
  54. 28
  55. Yamamoto, Y. Y., M. Matsui, and X.-W. Deng. 1998. Positive feedback in plant signaling pathways. Trends Plant Sci. 3:374-375.[CrossRef]
  56. 29
  57. Youssar, L., T. J. Schmidhauser, and J. Avalos. 2005. The Neurospora crassa gene responsible for the cut and ovc phenotypes encodes a protein of the haloacid dehalogenase family. Mol. Microbiol. 55:828-838.[CrossRef][Medline]
  58. 30
  59. Zelter, A., M. Bencina, B. J. Bowman, O. Yarden, and N. D. Read. 2004. A comparative genome analysis of the calcium signaling machinery in Neurospora crassa, Magnaporthe grisea, and Saccharomyces cerevisiae. Fungal Genet. Biol. 41:827-841.[CrossRef][Medline]
  60. 31
  61. Zhang, Y., R. Lamm, C. Pillonel, S. Lam, and J.-R. Xu. 2002. Osmoregulation and fungicide resistance: the Neurospora crassa os-2 gene encodes a HOG1 mitogen-activated protein kinase homologue. Appl. Environ. Microbiol. 68:532-538.[Abstract/Free Full Text]


Eukaryotic Cell, March 2006, p. 480-487, Vol. 5, No. 3
1535-9778/06/$08.00+0     doi:10.1128/EC.5.3.480-487.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lew, R. R., Nasserifar, S. (2009). Transient responses during hyperosmotic shock in the filamentous fungus Neurospora crassa. Microbiology 155: 903-911 [Abstract] [Full Text]  
  • Lew, R. R., Abbas, Z., Anderca, M. I., Free, S. J. (2008). Phenotype of a Mechanosensitive Channel Mutant, mid-1, in a Filamentous Fungus, Neurospora crassa. Eukaryot Cell 7: 647-655 [Abstract] [Full Text]  
  • Lew, R. R. (2007). Ionic currents and ion fluxes in Neurospora crassa hyphae. J Exp Bot 0: erm204v1-erm204 [Abstract] [Full Text]  
  • Jones, C. A., Greer-Phillips, S. E., Borkovich, K. A. (2007). The Response Regulator RRG-1 Functions Upstream of a Mitogen-activated Protein Kinase Pathway Impacting Asexual Development, Female Fertility, Osmotic Stress, and Fungicide Resistance in Neurospora crassa. Mol. Biol. Cell 18: 2123-2136 [Abstract] [Full Text]  
  • Lew, R. R., Levina, N. N. (2007). Turgor regulation in the osmosensitive cut mutant of Neurospora crassa. Microbiology 153: 1530-1537 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lew, R. R.
Right arrow Articles by Shabala, S. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lew, R. R.
Right arrow Articles by Shabala, S. N.