Previous Article | Next Article 
Eukaryotic Cell, February 2006, p. 347-358, Vol. 5, No. 2
1535-9778/06/$08.00+0 doi:10.1128/EC.5.2.347-358.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
The Cek1 and Hog1 Mitogen-Activated Protein Kinases Play Complementary Roles in Cell Wall Biogenesis and Chlamydospore Formation in the Fungal Pathogen Candida albicans
B. Eisman,
R. Alonso-Monge,
E. Román,
D. Arana,
C. Nombela, and
J. Pla*
Departamento de Microbiología II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza de Ramón y Cajal s/n, E-28040 Madrid, Spain
Received 23 May 2005/
Accepted 20 November 2005

ABSTRACT
The Hog1 mitogen-activated protein (MAP) kinase mediates an
adaptive response to both osmotic and oxidative stress in the
fungal pathogen
Candida albicans. This protein also participates
in two distinct morphogenetic processes, namely the yeast-to-hypha
transition (as a repressor) and chlamydospore formation (as
an inducer). We show here that repression of filamentous growth
occurs both under serum limitation and under other partially
inducing conditions, such as low temperature, low pH, or nitrogen
starvation. To understand the relationship of the HOG pathway
to other MAP kinase cascades that also play a role in morphological
transitions, we have constructed and characterized a set of
double mutants in which we deleted both the
HOG1 gene and other
signaling elements (the
CST20,
CLA4, and
HST7 kinases, the
CPH1 and
EFG1 transcription factors, and the
CPP1 protein phosphatase).
We also show that Hog1 prevents the yeast-to-hypha switch independent
of all the elements analyzed and that the inability of the
hog1 mutants to form chlamydospores is suppressed when additional
elements of the
CEK1 pathway (
CST20 or
HST7) are altered. Finally,
we report that Hog1 represses the activation of the Cek1 MAP
kinase under basal conditions and that Cek1 activation correlates
with resistance to certain cell wall inhibitors (such as Congo
red), demonstrating a role for this pathway in cell wall biogenesis.

INTRODUCTION
Polymorphism, that is, the ability to acquire different morphologies,
has long been considered a major virulence factor in the human
fungal pathogen
Candida albicans. This fungus is present on
the skin and mucosal surfaces of many organisms, including humans,
acquiring mainly a unicellular yeast-like form, while in infected
tissues, different morphologies (yeast, mycelia, and even chlamydospores)
have been observed (
9,
13). These types of morphologies have
distinct abilities to adhere, proliferate, invade, or escape
phagocytic cells and, therefore, contribute by different degrees
to the pathogenesis of the infection. The transfer from the
yeast form to the filamentous form of growth is induced by certain
chemicals (
14,
18,
20,
48), a temperature close to 37°C
(
30), and a neutral pH (
49), while chlamydospore formation is
induced in vitro under special conditions, such as a low concentration
of glucose, darkness, low temperature (24 to 28°C) and microaerophilia.
The molecular mechanisms involved in the regulation of polymorphism in C. albicans are very complex. Genetic analysis has shown the implication of several genes and regulatory cascades in this process (31, 37, 54, 56). These include, among others, the cyclic AMP (cAMP)-dependent protein kinase pathway and the mitogen-activated protein (MAP) kinase pathway. The cAMP pathway leads to an increase in intracellular cAMP (44) and controls the Efg1 transcription factor (16, 51, 52). C. albicans efg1 mutants are defective in both filamentation and chlamydospore formation (50, 51) and have a reduced virulence in certain models of experimental infection (33). Other pathways involved in filamentation are mediated by MAP kinases and include the Cek1-mediated pathway and the HOG pathway. The Cek1 pathway involves the Cst20 PAK-like protein, the Hst7 MAP kinase kinase (26), the Cek1 MAP kinase (11, 55), and the Cph1 transcription factor (32). Mutants in these genes present defects in hyphal development to a different degree on certain media and have a reduced virulence in animal models. Other elements that have been partially characterized include the CPP1 phosphatase (11) and the PAK-like kinase Cla4 (27, 34). The HOG (high-osmolarity glycerol response) MAP kinase pathway has also been involved in the morphological transition, as deletion of certain elements of the pathway results in enhanced hyphal growth on serum and altered colony morphologies on certain media (1, 4). In addition, hog1 mutants are not able to form chlamydospores (2). In Saccharomyces cerevisiae, a similar situation occurs, and deletion of HOG1 allows an efficient cross talk to the Kss1-mediated pathway and Fus3 mating pathway (40). In the present work, we demonstrate that the enhanced hyphal growth of C. albicans hog1 mutants is independent of the CEK1 pathway and the Efg1 transcription factor while, in close contrast, we show that the role of Hog1 in chlamydospore development is dependent on this pathway. We also propose that resistance of certain mutants of the HOG pathway to chitin-interfering compounds is linked to a hyperactivation of the Cek1 MAP kinase.

MATERIALS AND METHODS
Strains and growth conditions.
Yeast strains are listed in Table
1. For clarity, and unless
otherwise stated, a mutant in a
geneX (
hog1,
cst20, etc.) will
always indicate the homozygous
geneX/
geneX Ura
+ strain. Yeast
strains were grown at 37°C (unless otherwise stated) in
YPD medium (1% yeast extract, 2% glucose, 2% peptone) and SD
minimal medium (2% glucose, 0.67% yeast nitrogen base without
amino acids) with the appropriate auxotrophic requirements (50
µg/ml).
The ability of cells to undergo the yeast-to-hypha transition
was tested using Lee's medium at different pHs (4.3 to 5.8 and
6.7) (
30), SD adjusted to the pHs indicated, fetal bovine serum,
or YPD medium plus fetal bovine serum at 5%. To check the dimorphic
transition, cells were inoculated in prewarmed liquid medium
at 10
5 cells per ml. Growth in liquid medium was estimated as
the absorbance at 600 nm (
A600). Uridine and histidine were
routinely added to liquid and solid media used for phenotypic
assays to minimize the differences between strains. Usually,
overnight cultures were inoculated into fresh medium to an optical
density of 0.1 (measured at 600 nm), and experiments were performed
when cultures reached an optical density of 1 (600 nm) when
exponential-phase cells were required. A 24-h culture was routinely
used in the case of stationary-phase cells.
Sensitivity to different compounds (oxidative agent, NaCl, sorbitol, Congo red, or calcofluor white) was tested on solid YPD medium. Serially diluted (1/10) cell suspensions were spotted to examine the growth of the different strains. Plates were incubated overnight at 37°C unless otherwise indicated.
Chlamydospore formation was assayed essentially as indicated previously (50). The borders of more than 50 colonies were examined for each strain tested.
Construction of strains.
All strains generated in the present study were obtained by disrupting the HOG1 gene in various single-mutation strains of C. albicans. HOG1 gene disruption was performed as previously reported (46) following the Fonzi and Irwin strategy (17) and using the transformation method developed by Köhler et al. (24). Gene deletion was verified by Southern blotting. Genomic DNA was digested with EcoRI and HpaI, and the probe was obtained by PCR using the primers o-HOG1 ext (GAGTAGTAGTTTTGGATAAATGTA) and HE2r2 (GATTTGCTTCCTGTACTCAACGTT).
The appropriate strains were transformed with the plasmids pRC2312 (7) (as control vector), pRC2312P-H (51) (to overexpress the EFG1 gene), or ACT1p-HOG1-GFP (4) (to overexpress the HOG1 gene).
Protein extracts and immunoblot analysis.
Overnight cultures were refreshed to an optical density of 0.1 (measured at 600 nm), and samples were collected when cultures reached an optical density of 1 (600 nm). Alternatively, cultures in stationary growth phase were refreshed in YPD or YPD plus Congo red, and then samples were taken from the stationary-phase culture and after 1 and 2 h of growth in these conditions. Cell extracts were obtained as previously indicated (36). Equal amounts of proteins were loaded onto each lane, as assessed by 280-nm measurement of the samples and Ponceau red staining of the membranes prior to blocking and detection. Blots were probed with phospho-p42/44 MAP kinase (Thr202/Tyr204) (Cell Signaling Technology, Inc.), ScHog1 polyclonal antibody (Santa Cruz Biotechnology), and Ab-CaCek1 (developed in our lab) and developed according to the manufacturer's conditions using the Hybond ECL kit (Amersham Pharmacia Biotech).
ß-1,3-Glucanase sensitivity assay.
To measure the inhibition of growth caused by Zymolyase, cells from an exponentially growing culture were inoculated to an optical density at 600 nm (OD600) of 0.025 in YPD medium supplemented with different amounts of Zymolyase 100T (ICN Biomedicals, Inc.). The assay was performed in a 96-well plate in duplicate rows and incubated overnight at 37°C. Zymolyase was suspended in Tris-HCl (pH 7.5)/glucose 5%. Growth is depicted as the percentage of growth in YPD supplemented with Zymolyase compared with growth in YPD alone. Graphs represent the means of the results from at least three independent experiments.

RESULTS
hog1 mutants are derepressed in the yeast-to-hypha transition.
We have previously shown that
hog1 mutant cells are derepressed
in hyphal formation when cells are exposed to limiting concentrations
of serum (
1). This result indicated that the threshold level
to activate filamentation in
hog1 mutant cells was lower than
in the wild type. In the present work, we investigated whether
this effect was exclusive to serum or could also be mimicked
by other conditions known to promote morphological transitions
in
C. albicans, such as pH and temperature. When cells were
grown in minimal medium at 37°C, both the wild type and
hog1 mutants were able to induce hyphal growth at pH 6.7; when
the pH was lowered to 4.5, only the
hog1 mutant was able to
form filaments (Fig.
1A). A similar behavior was observed when
cells were grown in liquid Lee's medium (Fig.
1A). A pH below
5 prevented filamentation of the wild-type strain. In contrast,
the
hog1 mutant was able to undergo the morphological transition
at any pH. Finally, the enhanced hyphal formation of the
hog1 mutant was also evident using temperature as an inducer of filamentation.
As shown in Fig.
1B, when cells were grown in 5% serum at low
temperature (24 or 30°C), only the
hog1 mutant displayed
a filamentous phenotype, while the wild-type cells were able
to display only hyphae-like structures at 37°C (Fig.
1B).
We conclude from these observations that the absence of the
Hog1 MAP kinase leads to an enhanced hyphal formation evidenced
under several conditions (low serum concentration, low pH, and
low temperature), and therefore, Hog1 does play a constitutive/basal
role in repressing the morphological transition.
The repression of filamentation mediated by Hog1 is not dependent on the Cek1 MAP kinase.
In
S. cerevisiae, Hog1 prevents cross talk between the HOG and
the pheromone response/invasive growth pathways (
19,
40). We
explore the existence of a similar mechanism in
C. albicans by analyzing (i) the phosphorylation state of the MAP kinases
under different conditions and (ii) the ability to undergo the
yeast-to-hypha transition in response to physiological stimuli.
For the first purpose, antibodies that recognize the TEY motif
of growth MAP kinases (Cek1 and Mkc1) (
4) were used, and whole-cell
extracts obtained from cells obtained under different conditions
were analyzed. Immunodetection studies showed a constitutive
basal activation of Cek1 when exponentially growing cells of
the
hog1 mutant (but not wild type) were used (
4,
38). The levels
of phospho-Cek1 were 2 to 4 times higher in
hog1 cells than
in wild-type strain cells (as determined by autoradiography),
suggesting that the enhanced hyphal growth of
hog1 mutants may
be the result of a constitutive activation of the
CEK1-mediated
pathway. We tested this assumption genetically through the construction
of double
hog1 mutants with other signaling elements. For this
purpose, a
HOG1-hisG-URA3-hisG disruption construction was used
to perform the disruption of the
HOG1 gene in
cla4,
cst20,
hst7,
cpp1,
cph1,
efg, and
cph1 efg1 mutants. We checked the basal
state of Cek1 phosphorylation in the mutant strains generated.
Activation of Cek1 completely disappeared in
hst7; furthermore,
this signal was also absent in
hst7 hog1 mutants (Fig.
2A),
indicating that the Hst7 MAP kinase kinase is required to phosphorylate
the Cek1 MAP kinase (MAPK). In contrast, deletion of
CST20,
CPH1, and
CPP1 had no evident effect on Cek1 phosphorylation.
Single mutants (
cla4,
cst20,
cph1, and
cpp1) displayed a phosphorylation
of Cek1 similar to that of the wild type (Fig.
2A), and the
deletion of the
HOG1 gene in these backgrounds also showed an
increased phospho-Cek1 similar to the
hog1 single mutant. These
immunodetection assays also revealed a significant and reproducible
reduction in the amount of Cek1 protein in
cla4 extracts; remarkably,
the Cek1 protein level is restored in the
cla4 hog1 double mutant.
The increased activation of Cek1 is not exclusive to
hog1 mutants,
as it was recently reported in other mutants of the HOG pathway,
such as the
ssk1 mutant (
45) and the
pbs2 mutant (
4). We conclude
from these observations that the HOG pathway represses the activation
of the
CEK1-mediated pathway.
To determine if the enhanced hyphal formation of the
hog1 mutant
correlated with Cek1 phosphorylation, we performed specific
filamentation assays. The ability of these strains to form filaments
was tested using a subinducing serum concentration (5%) and
incubation at 30°C. These conditions were chosen because
they allowed us to clearly discern between the behavior of
hog1 and wild-type strains. Assays in liquid media revealed that
all strains tested grew as yeast cells when grown in YPD medium,
but under 100% serum, they all formed filaments (Fig.
2B). This
result contrasts with previous published data showing that
cla4 mutants were unable to form filaments (
28); in our laboratory,
cla4 cells were able to form filaments when grown in 100% serum.
However, under limiting serum concentrations, all of the mutant
strains lacking the
HOG1 gene were able to form true filaments
(Fig.
2B), including those where the phosphorylation of Cek1
was not detected, such as the
hst7 hog1 mutant. These data indicate
that the hyperfilamentous phenotype is not due to activation
of
CEK1-mediated pathway in
C. albicans.
The role of the Cph1 and Efg1 transcription factors, implicated in the morphological transition, was also analyzed in relation to the HOG1 gene. The double cph1 efg1 mutant was unable to form filaments under any laboratory conditions (although hyphal forms have been isolated in vivo from the throat of gnotobiotic piglets) (43); nevertheless, the disruption of the HOG1 gene in this background resulted in the characteristic derepressed phenotype of hog1 mutants (Fig. 3). The cph1 hog1 and efg1 hog1 double mutants also displayed an enhanced ability to form true filaments. These data suggest that Hog1 is a dominant repressor of filamentation, probably acting through other transcription factors.
Blockage of the CEK1-mediated pathway suppresses the defect in chlamydospore formation of hog1 mutants.
Given that the
CEK1-mediated pathway has been implicated in
the dimorphic transition and that there is cross talk with the
HOG1 pathway, we aimed to determine its role in chlamydospore
formation. When single mutants
cla4,
cst20,
hst7,
cek1,
cph1,
and
cpp1 were analyzed, they were all found to form a similar
abundance of these structures to a similar degree of maturity
in comparison to wild-type cells. The behavior of
cpp1 mutants
has also been recently reported (
47). Interestingly, the analysis
of double mutants implicated the Cek1 pathway in chlamydospore
formation, since the double
hog1 cst20,
hog1 hst7, and
hog1 cpp1 mutants were able to form such structures. In contrast,
deletion of the
HOG1 gene in a
cla4 mutant generated a
hog1 phenotype, that is, the inability to form chlamydospores (Fig.
4). This result indicates that the mechanism inhibiting the
formation of chlamydospores in
hog1 cells is
CST20,
HST7, and
CPP1 dependent.
The epistatic relationship between Hog1 and Efg1 was also analyzed
using this approach. Both
efg1 and
hog1 mutants have been shown
to block this process. The double
efg1 hog1 (as well as a
cph1 efg1 hog1 mutant) was unable to form chlamydospores. Overexpression
of the
EFG1 gene under the control of
PCK1 promoter in the double
efg1 hog1 (as well as in a
hog1 mutant) did not suppress the
hog1 phenotype (Fig.
5). Furthermore, overexpression of the
HOG1 gene under the control of the strong constitutive
ACT1 promoter did not restore this capacity in the double mutant
(
efg1 hog1) (not shown). Both results suggest that chlamydospore
formation could be controlled by two independent pathways, one
mediated by Efg1 and the other by Hog1.
The role of Hog1 in mediating resistance to osmotic and oxidative stresses is independent of Cek1.
The HOG pathway is required for the adaptation of cells to oxidative
and osmotic stresses (
1) in
C. albicans (
46). The role of
CLA4 and other elements of the putative
CEK1-mediated pathway in
response to osmotic and oxidative stress has not been reported
previously. None of the
cek1,
hst7,
cst20,
cla4,
cph1,
efg1,
or
cph1 efg1 mutants displayed sensitivity to osmotic stress
(Fig.
6) or to oxidants (data not shown) compared to wild-type
cells. In addition, the single
cla4,
cst20, and
hst7 mutations
did not impair the signaling to other MAPKs (Hog1 and Mkc1)
in response to NaCl or H
2O
2 (data not shown). Furthermore, combining
these mutations in a
hog1 background did not aggravate the susceptibility
of the
hog1 mutant to both osmotic (NaCl and sorbitol) or oxidative
(H
2O
2 and menadione) stress. Those results suggest that the
role of the HOG pathway in the response to stress is at least
partially independent of Cla4, Cst20, Hst7, Cpp1, Cph1, and
Efg1.
Congo red resistance is dependent on Cek1 activation.
The Cek1 MAP kinase is involved in the biogenesis of the cell
wall, since mutants defective in this MAP kinase, and other
elements that mediate its activation, show sensitivity to certain
cell wall assembly inhibitors such as Congo red and calcofluor
white (
45). As
hog1 mutants also present cell wall alterations
(
1) and constitutively activate the Cek1 MAP kinase (
4,
45),
we reasoned that both phenomena could be linked. This hypothesis
was genetically tested by performing assays of sensitivity to
Congo red and calcofluor white on solid media. As shown in Fig.
7, the
cst20,
cla4,
hst7,
cek1,
cph1, and
efg1 mutant strains
showed impaired growth in the presence of these compounds, while
a
cpp1 mutant displayed a phenotype close to that of the wild-type
strain. Deletion of
HOG1 in these strains resulted in two different
phenotypes (Fig.
7). An
hst7 hog1 mutant showed an
hst7 phenotype;
therefore, the lack of the
HOG1 gene did not improve the growth
in the presence of cell wall-disturbing agents, which clearly
correlated with the absence of Cek1 activation. However, in
cst20,
cla4, and
cph1 mutants, the absence of the
HOG1 gene
enhanced growth in the presence of Congo red and calcofluor
white, consistent with the fact that these mutants displayed
Cek1 phosphorylation levels similar to those of the
hog1 mutant
(Fig.
2A).
The role of the Cph1 and Efg1 transcription factors was also
analyzed. As mentioned above, the sensitivity of the
cph1 mutant
to cell wall-interfering agents is reversed to resistance when
HOG1 gene is lacking (Fig.
7). This effect does not occur in
the case of
efg1, since both
efg1 and
efg1 hog1 mutants display
an increased sensitivity to Congo red and calcofluor white,
suggesting a possible epistatic relationship between Hog1 and
Efg1. Remarkably, the double
cph1 efg1 mutant was resistant
to these compounds, arguing for the implication of both transcription
factors in the architecture of the cell wall. This result suggests
a different mechanism for both proteins in the biogenesis of
the cell wall. Deletion of the
HOG1 gene in a
cph1 efg1 background
did not significantly alter the resistant phenotype of the double
cph1 efg1 mutant.
Recently, Cek1 activation has been shown to correlate with cellular growth and/or the transition from stationary to exponential phase (45). Congo red inhibits the growth of C. albicans in a dose-dependent manner in liquid cultures. We therefore tried to correlate both phenomena (Cek1 activation and growth in optical density) using a compound that had a different effect on wild-type and hog1 mutants. Cells were allowed to enter stationary phase and were then diluted in media containing different amounts of Congo red. Samples were taken at 1 and 2 h and processed for Western blot analyses. As shown in Fig. 8, levels of activated Cek1 were found to be inversely dependent on Congo red concentration, consistent with the inhibition of growth caused by this compound. In addition, Cek1 phosphorylation was always higher in the hog1 strain versus the wild-type strain (independent of time of sample withdrawal), and finally, it appeared earlier in this mutant at the same concentration (see, for example, lanes at 1 h). As shown in the growth curves, hog1 mutant cells suffered a less pronounced growth delay in the presence of Congo red than the wild-type strain (Fig. 8B).
Previous studies have revealed that mutants in the HOG pathway
(both in
C. albicans and
S. cerevisiae) are sensitive to Zymolyase,
a ß-1,3-glucanase-enriched enzyme preparation (
3,
4,
23). To characterize in more detail the relationship between
the cell wall composition/architecture and the Cek1- and Hog1-MAPK
pathways, we performed the following assay. Cells were grown
overnight in YPD medium supplemented with different amounts
of Zymolyase, and cell growth was quantified by the final OD
reached.
cst20,
hst7,
cek1, and
cph1 mutants were found to be
more sensitive to Zymolyase than the wild type. The deletion
of the
HOG1 gene in
hst7 and
cph1 mutants slightly aggravated
the Zymolyase-sensitive phenotype (Fig.
9); however, the
cst20 hog1 double mutant displayed an increase in the resistance to
glucanase. In agreement with the phenotype observed on Congo
red and calcofluor white plates, a
cpp1 mutant was not sensitive
to ß-1,3-glucanase.
efg1 and
cph1 efg1 mutants showed
similar sensitivities to Zymolyase but a lower sensitivity than
cph1 mutants; deletion of
HOG1 aggravated these phenotypes to
a sensitivity similar to that of the
hog1 mutant. This observation
suggests that Hog1 plays a role in glucan assembly/regulation
independent of Efg1 and Cph1.
Deletion of
CLA4 rendered cells drastically sensitive to cell
wall-interfering compounds, and further deletion of the
HOG1 gene slightly improved growth in the presence of these compounds
(still far beyond the levels attained in the
hog1 mutant), suggesting
that Cla4 and Hog1 contribute independently to cell wall biogenesis
(Fig.
7). This idea was reinforced when the susceptibility to
glucanase was tested. A
cla4 mutant was as resistant as the
wild-type strain, while the double
cla4 hog1 mutant displayed
the sensitive phenotype characteristic of
hog1 mutants (Fig.
9).

DISCUSSION
The aim of the current work was to investigate the relationship
between the HOG and the Cek1-mediated MAPK pathways. Both routes
have been implicated in important cellular functions such as
morphogenesis and cell wall construction. The data obtained
is this work are summarized in the model shown in Fig.
10.
In
S. cerevisiae, a genetic interaction between both routes
has been described previously (
15,
40). When cells are exposed
to osmotic stress, in the absence of either the
HOG1 or
PBS2 gene, cells display an invasive growth on solid media,
shmoo projection, and expression of mating type-specific genes, and
these phenotypes are dependent on the transmission of the signal
through Sho1 to Ste20 and Ste11 and Ste7-Kss1. We demonstrate
that, in
C. albicans, the mechanism of cross talk is different.
In this organism, deletion of some of the predicted elements
of the pathway (
CST20,
HST7,
CEK1, and
CPH1) generate mutants
that show defects on certain solid media that induce morphological
transitions, although they retain the ability to form filaments
on serum. In addition
hog1 and
pbs2 mutants display an enhanced
ability to form filaments (
1,
4) independent of the stimuli
(either pH, temperature, or serum concentration) tested (Fig.
1). This occurs even in the absence of osmotic stress, suggesting
that the activation of Hog1 does not have an effect on filamentation.
However, genetic analysis of double mutants in the HOG and
CEK1-mediated
pathways show that the derepressed behavior of
hog1 cells is
not mediated by the Cek1 pathway, since the
hog1 hyperfilamentous
phenotype is dominant when the Cek1 pathway is impaired (Fig.
2 and
3). A similar situation is observed when the
HOG1 gene
is deleted in concert with the
EFG1 and
CPH1 genes (Fig.
2 and
3). Deletion of
EFG1 and
CPH1 renders cells unable to form filaments
under most laboratory conditions tested, although not in vivo
(
43). The triple deletion mutant
cph1 efg1 hog1 was able to
form filaments under subinducing conditions, similar to
hog1.
These data indicate that the
HOG1 gene might carry out its repressing
effect on additional elements, not Efg1 or Cph1. Potential candidates
include
RBF1 (
21) or
TUP1, which have not been accommodated
in any signaling pathway mediated by MAP kinases. Deletion of
these genes led to enhanced (
RBF1) (
22) or even constitutive
(
TUP1) (
5,
6) hyphal growth. The Tup1 protein is a strong candidate,
as the Ssn6-Tup1 repressor has been involved in
S. cerevisiae in the induction of certain
HOG1-dependent genes (
35); Hog1
could signal environmental changes to Tup1 in
C. albicans and
consequently relieve the repression of certain filamentation-responsive
genes.
We have also shown that the HOG pathway is involved in the formation of chlamydospores, a process that occurs under defined environmental conditions, such as low temperature, oxygen concentration, and rich media. It can also occur, apparently, in vivo, as chlamydospore-like cells were isolated from the gastrointestinal tract of cyclophosphamide-treated mice (9). It has been suggested that chlamydospores are resistant forms, since they displayed a thickened cell wall which could protect against environmental challenges. Moreover, most of the C. albicans clinical isolates are able to induce the formation of chlamydospores, arguing for an important role of chlamydospores in C. albicans biology. Both the EFG1 and HOG1 genes are essential in the formation of chlamydospores (2, 50), involving a MAPK signal transduction pathway and the cAMP pathway in this process. We present data suggesting that both proteins, Hog1 and Efg1, act independently, since overexpression of the EFG1 gene did not restore the ability to form chlamydospores in the hog1 mutant, and similarly, overexpression of HOG1 gene does not restore the formation of chlamydospores in the efg1 mutant. The reasons for the inability of hog1 mutants to form chlamydospores are not yet known (2). One possible explanation could be oxidative stress: chlamydospore formation is favored under microaerophilia and absence of light, a result that suggests that reactive oxygen species impair this process. The absence of Hog1-dependent defense mechanisms in hog1 mutants could generate a higher concentration of reactive oxygen species and, therefore, the inability to form chlamydospores. An additional and alternative explanation could be a repressive role of the Cek1 pathway in chlamydospore formation, as this pathway is constitutively active in hog1 mutants (Fig. 2) and pbs2 mutants (4). This suggests that a coordinate balance between both pathways is necessary to generate such structures. In a recent study, a number of different genes have been reported to be required for chlamydospore formation, such as SUV3, SCH9, and ISW2, which are involved in mitochondrial function, glycogen accumulation, and chromatin remodeling, respectively (39). It is reasonable to assume that the expression of some of these genes may be dependent on HOG1 and/or CEK1. It must be stated, however, that the effect of the Cek1 pathway seems to be independent of oxidative stress, since Cek1 pathway mutants do not show altered sensitivity to oxidants nor increase the sensitivity of hog1 cells to these compounds (data not shown).
The results presented in this work also show that hog1 mutants display increased resistance to certain cell wall inhibitory compounds, such as Congo red and calcofluor white, indicating its relationship with cell wall biogenesis. We propose that Cek1 activation is responsible for this effect, as evidenced by biochemical and genetic analyses. The failure to activate Cek1 (as occurs in hog1 hst7 cells) would suppress the resistance phenotype in hog1 mutants, while deletion of the CPP1 phosphatase gene or the CST20 PAK gene would have minor effects according to the activation pattern determined by Western blot analyses. However, the stimuli (either extra- or intracellular) involved in Cek1 activation remains unclear. In S. cerevisiae, Kss1 (a Cek1 homologue) participates in the SVG (sterile vegetative growth) pathway, which is involved in cell wall biogenesis (12, 29). Defects in protein glycosylation cause its constitutive and SHO1-dependent activation. Cek1 activation could be triggered in response to those physiological situations that require active cell wall remodeling, such as exit from the stationary phase and entrance to the exponential phase of growth, and this sensing mechanism is fully functional in hog1 mutants (Fig. 2 and 8), despite its derepressed behavior on Cek1 activation. The stimuli that could lead to an activation of Cek1 are not yet clear, as recent data (38) indicate that Cek1 is activated in response to Zymolyase, a ß-glucanase-enriched enzymatic preparation. Furthermore, Zymolyase, as well as Congo red, also activates the cell integrity Mkc1 MAP kinase, similar to what is observed in S. cerevisiae for the Slt2 protein (36).
Interestingly, cst20 and the cst20 hog1 mutants activate Cek1 similar to the wild-type and hog1 mutant strains, respectively, indicating that Cst20 is not the only mediator of Cek1 activation. In C. albicans, the PAK Cla4 protein is a putative transduction element that has been reported to be involved in morphogenesis and virulence in this fungus (28, 41). Our results, as revealed by the pattern of MAPK activation, chlamydospore formation, cell wall resistance phenotypes, and filament formation, suggest that Cla4 is not a member of the pathway mediated by Cek1 or that there is redundancy at this level. Other elements implicated in the transmission of the signal at the level of Cst20, such as Cdc42 (53) or Ste50, could play a role in this process (42).
Unfortunately, the construction of the double hog1 cek1 mutant was not possible despite continued genetic attempts (data not shown), suggesting either synthetic lethality or that the mutant is strongly counterselected under the normal experimental conditions of isolation. Since a hst7 hog1 mutant is viable and a BLAST analysis reveals no functional homologue to Hst7 in the C. albicans genome, one possible explanation for lethality could invoke a downstream mediator of Hst7. Cek2 is a candidate for such a role, since this MAP kinase has been shown to complement the mating deficiency defect of a fus3 kss1 mutant in S. cerevisiae and a C. albicans cek1 cek2 mutant is also mating deficient (8). Whether Cek2 is functionally redundant to Cek1 in nonmating functions (such as chlamydospore formation or filamentation) is, however, open to speculation, since it is also possible that other downstream mediators compensate for the absence of Cek1.
In conclusion, the data obtained in this work indicate that the Hog1 and the Cek1-mediated pathways play independent roles in processes such as filamentation and osmotic/oxidative stress resistance but play complementary roles in cell wall biogenesis and chlamydospore formation in C. albicans. Further work will be aimed toward the definition of the elements of the HOG pathway responsible for Cek1-mediated signaling.

ACKNOWLEDGMENTS
We thank Alistair J. P. Brown, G. R. Fink, and M. Whiteway for
generously providing strains.
R.A.-M. is a recipient of the Ramón y Cajal Program. E.R. and D.A. hold fellowships associated with the projects 2RO1 AI043465-05 A2 (NIH) and BIOTEC0992-2003 (MEC), respectively. This work was supported by grant BIOTEC0992-2003.

FOOTNOTES
* Corresponding author. Mailing address: Departamento de Microbiología II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza de Ramón y Cajal s/n, E-28040 Madrid, Spain. Phone: 34 91 3941617. Fax: 34 91 3941745. E-mail:
jesuspla{at}farm.ucm.es.


REFERENCES
1 - Alonso-Monge, R., F. Navarro-García, G. Molero, R. Diez-Orejas, M. Gustin, J. Pla, M. Sánchez, and C. Nombela. 1999. Role of the mitogen-activated protein kinase Hog1p in morphogenesis and virulence of Candida albicans. J. Bacteriol. 181:3058-3068.[Abstract/Free Full Text]
2 - Alonso-Monge, R., F. Navarro-García, E. Roman, A. I. Negredo, B. Eisman, C. Nombela, and J. Pla. 2003. The Hog1 mitogen-activated protein kinase is essential in the oxidative stress response and chlamydospore formation in Candida albicans. Eukaryot. Cell 2:351-361.[Abstract/Free Full Text]
3 - Alonso-Monge, R., E. Real, I. Wojda, J. P. Bebelman, W. H. Mager, and M. Siderius. 2001. Hyperosmotic stress response and regulation of cell wall integrity in Saccharomyces cerevisiae share common functional aspects. Mol. Microbiol. 41:717-730.[CrossRef][Medline]
4 - Arana, D. M., C. Nombela, R. Alonso-Monge, and J. Pla. 2005. The Pbs2 MAP kinase kinase is essential for the oxidative-stress response in the fungal pathogen Candida albicans. Microbiology 151:1033-1049.[Abstract/Free Full Text]
5 - Braun, B. R., W. S. Head, M. X. Wang, and A. D. Johnson. 2000. Identification and characterization of TUP1-regulated genes in Candida albicans. Genetics 156:31-44.[Abstract/Free Full Text]
6 - Braun, B. R., and A. D. Johnson. 1997. Control of filament formation in Candida albicans by the transcriptional repressor TUP1. Science 277:105-109.[Abstract/Free Full Text]
7 - Cannon, R. D., H. F. Jenkinson, and M. G. Shepherd. 1992. Cloning and expression of Candida albicans ADE2 and proteinase genes on a replicative plasmid in C. albicans and in Saccharomyces cerevisiae. Mol. Gen. Genet. 235:453-457.[CrossRef][Medline]
8 - Chen, J., J. Chen, S. Lane, and H. Liu. 2002. A conserved mitogen-activated protein kinase pathway is required for mating in Candida albicans. Mol. Microbiol. 46:1335-1344.[CrossRef][Medline]
9 - Cole, G. T., K. R. Seshan, M. Phaneuf, and K. T. Lynn. 1991. Chlamydospore-like cells of Candida albicans in the gastrointestinal tract of infected, immunocompromised mice. Can. J. Microbiol. 37:637-646.[Medline]
10 - Csank, C., C. Makris, S. Meloche, K. Schröppel, M. Röllinghoff, D. Dignard, D. Y. Thomas, and M. Whiteway. 1997. Derepressed hyphal growth and reduced virulence in a VH1 family-related protein phosphatase mutant of the human pathogen Candida albicans. Mol. Biol. Cell 8:2539-2551.[Abstract/Free Full Text]
11 - Csank, C., K. Schröppel, E. Leberer, D. Harcus, O. Mohamed, S. Meloche, D. Y. Thomas, and M. Whiteway. 1998. Roles of the Candida albicans mitogen-activated protein kinase homolog, Cek1p, in hyphal development and systemic candidiasis. Infect. Immun. 66:2713-2721.[Abstract/Free Full Text]
12 - Cullen, P. J., J. Schultz, J. Horecka, B. J. Stevenson, Y. Jigami, and G. F. Sprague, Jr. 2000. Defects in protein glycosylation cause SHO1-dependent activation of a STE12 signaling pathway in yeast. Genetics 155:1005-1018.[Abstract/Free Full Text]
13 - Cutler, J. E. 1991. Putative virulence factors of Candida albicans. Annu. Rev. Microbiol. 45:187-218.[CrossRef][Medline]
14 - Dabrowa, N., and D. H. Howard. 1981. Proline uptake in Candida albicans. J. Gen. Microbiol. 127:391-397.[Abstract/Free Full Text]
15 - Davenport, K. R., M. Sohaskey, Y. Kamada, D. E. Levin, and M. C. Gustin. 1995. A second osmosensing signal transduction pathway in yeast. Hypotonic shock activates the PKC1 protein kinase-regulated cell integrity pathway. J. Biol. Chem. 270:30157-30161.[Abstract/Free Full Text]
16 - Ernst, J. F. 2000. Transcription factors in Candida albicansenvironmental control of morphogenesis. Microbiology 146:1763-1774.[Free Full Text]
17 - Fonzi, W. A., and M. Y. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728.[Abstract]
18 - Gow, N. A., and G. W. Gooday. 1982. Growth kinetics and morphology of colonies of the filamentous form of Candida albicans. J. Gen. Microbiol. 128:2187-2194.[Abstract/Free Full Text]
19 - Hall, J. P., V. Cherkasova, E. A. Elion, M. C. Gustin, and E. Winter. 1996. The osmoregulatory pathway represses mating pathway activity in Saccharomyces cerevisiae: isolation of a FUS3 mutant that is insensitive to the repression mechanism. Mol. Cell. Biol. 16:6715-6723.[Abstract]
20 - Hudson, D. A., Q. L. Sciascia, R. J. Sanders, G. E. Norris, P. J. Edwards, P. A. Sullivan, and P. C. Farley. 2004. Identification of the dialysable serum inducer of germ-tube formation in Candida albicans. Microbiology 150:3041-3049.[Abstract/Free Full Text]
21 - Ishii, N., M. Yamamoto, H. W. Lahm, S. Iizumi, F. Yoshihara, H. Nakayama, M. Arisawa, and Y. Aoki. 1997. A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans. Microbiology 143:417-427.[Abstract/Free Full Text]
22 - Ishii, N., M. Yamamoto, F. Yoshihara, M. Arisawa, and Y. Aoki. 1997. Biochemical and genetic characterization of Rbf1p, a putative transcription factor of Candida albicans. Microbiology 143:429-435.[Abstract/Free Full Text]
23 - Kapteyn, J. C., B. Ter Riet, E. Vink, S. Blad, H. De Nobel, E. H. van den, and F. M. Klis. 2001. Low external pH induces HOG1-dependent changes in the organization of the Saccharomyces cerevisiae cell wall. Mol. Microbiol. 39:469-480.[CrossRef][Medline]
24 - Köhler, G. A., T. C. White, and N. Agabian. 1997. Overexpression of a cloned IMP dehydrogenase gene of Candida albicans confers resistance to the specific inhibitor mycophenolic acid. J. Bacteriol. 179:2331-2338.[Abstract/Free Full Text]
25 - Köhler, J., and G. R. Fink. 1996. Candida albicans strains heterozygous and homozygous for mutations in mitogen-activated protein kinase signaling components have defects in hyphal development. Proc. Natl. Acad. Sci. USA 93:13223-13228.[Abstract/Free Full Text]
26 - Leberer, E., D. Harcus, I. D. Broadbent, K. L. Clark, D. Dignard, K. Ziegelbauer, A. Schmidt, N. A. R. Gow, A. J. P. Brown, and D. Y. Thomas. 1996. Signal transduction through homologs of the Ste20p and Ste7p protein kinases can trigger hyphal formation in the pathogenic fungus Candida albicans. Proc. Natl. Acad. Sci. USA 93:13217-13222.[Abstract/Free Full Text]
27 - Leberer, E., C. Wu, T. Leeuw, A. Fourest-Lieuvin, J. E. Segall, and D. Y. Thomas. 1997. Functional characterization of the Cdc42p binding domain of yeast Ste20p protein kinase. EMBO J. 16:83-97.[CrossRef][Medline]
28 - Leberer, E., K. Ziegelbauer, A. Schmidt, D. Harcus, D. Dignard, J. Ash, L. Johnson, and D. Y. Thomas. 1997. Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p. Curr. Biol. 7:539-546.[CrossRef][Medline]
29 - Lee, B. N., and E. A. Elion. 1999. The MAPKKK Ste11 regulates vegetative growth through a kinase cascade of shared signaling components. Proc. Natl. Acad. Sci. USA 96:12679-12684.[Abstract/Free Full Text]
30 - Lee, K. L., H. R. Buckley, and C. C. Campbell. 1975. An amino acid liquid synthetic medium for the development of mycelial and yeast forms of Candida albicans. J. Med. Vet. Mycol. 13:148-153.[CrossRef]
31 - Liu, H. 2001. Transcriptional control of dimorphism in Candida albicans. Curr. Opin. Microbiol. 4:728-735.[CrossRef][Medline]
32 - Liu, H., J. Köhler, and G. R. Fink. 1994. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 266:1723-1726.[Abstract/Free Full Text]
33 - Lo, H. J., J. R. Kohler, B. DiDomenico, D. Loebenberg, A. Cacciapuoti, and G. R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949.[CrossRef][Medline]
34 - Marcil, A., D. Harcus, D. Y. Thomas, and M. Whiteway. 2002. Candida albicans killing by RAW 264.7 mouse macrophage cells: effects of Candida genotype, infection ratios, and gamma interferon treatment. Infect. Immun. 70:6319-6329.[Abstract/Free Full Text]
35 - Márquez, J. A., A. Pascual-Ahuir, M. Proft, and R. Serrano. 1998. The Ssn6-Tup1 repressor complex of Saccharomyces cerevisiae is involved in the osmotic induction of HOG-dependent and -independent genes. EMBO J. 17:2543-2553.[CrossRef][Medline]
36 - Martin, H., J. M. Rodriguez-Pachon, C. Ruiz, C. Nombela, and M. Molina. 2000. Regulatory mechanisms for modulation of signaling through the cell integrity Slt2-mediated pathway in Saccharomyces cerevisiae. J. Biol. Chem. 275:1511-1519.[Abstract/Free Full Text]
37 - Molero, G., R. Diez-Orejas, F. Navarro-García, L. Monteoliva, J. Pla, C. Gil, M. Sanchez-Perez, and C. Nombela. 1998. Candida albicans: genetics, dimorphism and pathogenicity. Int. Microbiol. 1:95-106.[Medline]
38 - Navarro-Garcia, F., B. Eisman, S. M. Fiuza, C. Nombela, and J. Pla. 2005. The MAP kinase Mkc1p is activated under different stress conditions in Candida albicans. Microbiology 151:2737-2749.[Abstract/Free Full Text]
39 - Nobile, C. J., V. M. Bruno, M. L. Richard, D. A. Davis, and A. P. Mitchell. 2003. Genetic control of chlamydospore formation in Candida albicans. Microbiology 149:3629-3637.[Abstract/Free Full Text]
40 - O'Rourke, S. M., and I. Herskowitz. 1998. The Hog1 MAPK prevents cross talk between the HOG and pheromone response MAPK pathways in Saccharomyces cerevisiae. Genes Dev. 12:2874-2886.[Abstract/Free Full Text]
41 - Phan, Q. T., P. H. Belanger, and S. G. Filler. 2000. Role of hyphal formation in interactions of Candida albicans with endothelial cells. Infect. Immun. 68:3485-3490.[Abstract/Free Full Text]
42 - Ramezani-Rad, M. 2003. The role of adaptor protein Ste50-dependent regulation of the MAPKKK Ste11 in multiple signalling pathways of yeast. Curr. Genet. 43:161-170.[Medline]
43 - Riggle, P. J., K. A. Andrutis, X. Chen, S. R. Tzipori, and C. A. Kumamoto. 1999. Invasive lesions containing filamentous forms produced by a Candida albicans mutant that is defective in filamentous growth in culture. Infect. Immun. 67:3649-3652.[Abstract/Free Full Text]
44 - Rocha, C. R., K. Schroppel, D. Harcus, A. Marcil, D. Dignard, B. N. Taylor, D. Y. Thomas, M. Whiteway, and E. Leberer. 2001. Signaling through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic fungus Candida albicans. Mol. Biol. Cell 12:3631-3643.[Abstract/Free Full Text]
45 - Román, E., C. Nombela, and J. Pla. 2005. The Sho1 protein links oxidative stress with morphogenesis and cell wall biosynthesis in the fungal pathogen Candida albicans. Mol. Cell. Biol. 25:10611-10627.[Abstract/Free Full Text]
46 - San José, C., R. Alonso-Monge, R. M. Pérez-Díaz, J. Pla, and C. Nombela. 1996. The mitogen-activated protein kinase homolog HOG1 gene controls glycerol accumulation in the pathogenic fungus Candida albicans. J. Bacteriol. 178:5850-5852.[Abstract/Free Full Text]
47 - Schroppel, K., K. Sprosser, M. Whiteway, D. Y. Thomas, M. Rollinghoff, and C. Csank. 2000. Repression of hyphal proteinase expression by the mitogen-activated protein (MAP) kinase phosphatase Cpp1p of Candida albicans is independent of the MAP kinase Cek1p. Infect. Immun. 68:7159-7161.[Abstract/Free Full Text]
48 - Simonetti, N., V. Strippoli, and A. Cassone. 1974. Yeast-mycelial conversion induced by N-acetyl-D-glucosamine in Candida albicans. Nature 250:344-346.[CrossRef][Medline]
49 - Soll, D. R., M. Stasi, and G. Bedell. 1978. Regulation of nuclear migration and division during pseudo-mycelium outgrowth in the dimorphic yeast Candida albicans. Exp. Cell Res. 116:207-215.[CrossRef][Medline]
50 - Sonneborn, A., D. P. Bockmuhl, and J. F. Ernst. 1999. Chlamydospore formation in Candida albicans requires the Efg1p morphogenetic regulator. Infect. Immun. 67:5514-5517.[Abstract/Free Full Text]
51 - Stoldt, V. R., A. Sonneborn, C. E. Leuker, and J. F. Ernst. 1997. Efg1p, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO J. 16:1982-1991.[CrossRef][Medline]
52 - Tebarth, B., T. Doedt, S. Krishnamurthy, M. Weide, F. Monterola, A. Dominguez, and J. F. Ernst. 2003. Adaptation of the Efg1p morphogenetic pathway in Candida albicans by negative autoregulation and PKA-dependent repression of the EFG1 gene. J. Mol. Biol. 329:949-962.[CrossRef][Medline]
53 - Ushinsky, S. C., D. Harcus, J. Ash, D. Dignard, A. Marcil, J. Morchhauser, D. Y. Thomas, M. Whiteway, and E. Leberer. 2002. CDC42 is required for polarized growth in human pathogen Candida albicans. Eukaryot. Cell 1:95-104.[Abstract/Free Full Text]
54 - Whiteway, M. 2000. Transcriptional control of cell type and morphogenesis in Candida albicans. Curr. Opin. Microbiol. 3:582-588.[CrossRef][Medline]
55 - Whiteway, M., D. Dignard, and D. Y. Thomas. 1992. Dominant negative selection of heterologous genes: isolation of Candida albicans genes that interfere with Saccharomyces cerevisiae mating factor-induced cell cycle arrest. Proc. Natl. Acad. Sci. USA 89:9410-9414.[Abstract/Free Full Text]
56 - Whiteway, M., and U. Oberholzer. 2004. Candida morphogenesis and host-pathogen interactions. Curr. Opin. Microbiol. 7:350-357.[CrossRef][Medline]
Eukaryotic Cell, February 2006, p. 347-358, Vol. 5, No. 2
1535-9778/06/$08.00+0 doi:10.1128/EC.5.2.347-358.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
This article has been cited by other articles:
-
Bahn, Y.-S.
(2008). Master and Commander in Fungal Pathogens: the Two-Component System and the HOG Signaling Pathway. Eukaryot Cell
7: 2017-2036
[Full Text]
-
Rauceo, J. M., Blankenship, J. R., Fanning, S., Hamaker, J. J., Deneault, J.-S., Smith, F. J., Nantel, A., Mitchell, A. P.
(2008). Regulation of the Candida albicans Cell Wall Damage Response by Transcription Factor Sko1 and PAS Kinase Psk1. Mol. Biol. Cell
19: 2741-2751
[Abstract]
[Full Text]
-
Cheetham, J., Smith, D. A., da Silva Dantas, A., Doris, K. S., Patterson, M. J., Bruce, C. R., Quinn, J.
(2007). A Single MAPKKK Regulates the Hog1 MAPK Pathway in the Pathogenic Fungus Candida albicans. Mol. Biol. Cell
18: 4603-4614
[Abstract]
[Full Text]
-
Vylkova, S., Jang, W. S., Li, W., Nayyar, N., Edgerton, M.
(2007). Histatin 5 Initiates Osmotic Stress Response in Candida albicans via Activation of the Hog1 Mitogen-Activated Protein Kinase Pathway. Eukaryot Cell
6: 1876-1888
[Abstract]
[Full Text]
-
Zhao, X., Mehrabi, R., Xu, J.-R.
(2007). Mitogen-Activated Protein Kinase Pathways and Fungal Pathogenesis. Eukaryot Cell
6: 1701-1714
[Full Text]
-
Biswas, S., Van Dijck, P., Datta, A.
(2007). Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans. Microbiol. Mol. Biol. Rev.
71: 348-376
[Abstract]
[Full Text]
-
Segmuller, N., Ellendorf, U., Tudzynski, B., Tudzynski, P.
(2007). BcSAK1, a Stress-Activated Mitogen-Activated Protein Kinase, Is Involved in Vegetative Differentiation and Pathogenicity in Botrytis cinerea. Eukaryot Cell
6: 211-221
[Abstract]
[Full Text]
-
Monge, R. A., Roman, E., Nombela, C., Pla, J.
(2006). The MAP kinase signal transduction network in Candida albicans.. Microbiology
152: 905-912
[Abstract]
[Full Text]