This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, S. V.
Right arrow Articles by Williams, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, S. V.
Right arrow Articles by Williams, N.

 Previous Article  |  Next Article 

Eukaryotic Cell, January 2006, p. 45-53, Vol. 5, No. 1
1535-9778/06/$08.00+0     doi:10.1128/EC.5.1.45-53.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

ATP Synthase Is Responsible for Maintaining Mitochondrial Membrane Potential in Bloodstream Form Trypanosoma brucei

Silvia V. Brown, Paul Hosking, Jinlei Li, and Noreen Williams*

Department of Microbiology and Immunology and Witebsky Center for Microbial Pathogenesis and Immunology, 253 Biomedical Research Building, University at Buffalo, Buffalo, New York 14214

Received 25 July 2005/ Accepted 4 November 2005


arrow
ABSTRACT
 
The mitochondrion of Trypanosoma brucei bloodstream form maintains a membrane potential, although it lacks cytochromes and several Krebs cycle enzymes. At this stage, the ATP synthase is present at reduced, although significant, levels. To test whether the ATP synthase at this stage is important for maintaining the mitochondrial membrane potential, we used RNA interference (RNAi) to knock down the levels of the ATP synthase by targeting the F1-ATPase {alpha} and ß subunits. RNAi-induced cells grew significantly slower than uninduced cells but were not morphologically altered. RNAi of the ß subunit decreased the mRNA and protein levels for the ß subunit, as well as the mRNA and protein levels of the {alpha} subunit. Similarly, RNAi of {alpha} subunit decreased the {alpha} subunit transcript and protein levels, as well as the ß-subunit transcript and protein levels. In contrast, {alpha} and ß RNAi knockdown resulted in a 60% increase in the F0 complex subunit 9 protein levels without a significant change in the steady-state transcript levels of this subunit. The F0-32-kDa subunit protein expression, however, remained stable throughout induction of RNAi for {alpha} or ß subunits. Oligomycin-sensitive ATP hydrolytic and synthetic activities were decreased by 43 and 44%, respectively. Significantly, the mitochondrial membrane potential of {alpha} and ß RNAi cells was decreased compared to wild-type cells, as detected by MitoTracker Red CMXRos fluorescence microscopy and flow cytometry. These results support the role of the ATP synthase in the maintenance of the mitochondrial membrane potential in bloodstream form T. brucei.


arrow
INTRODUCTION
 
The mitochondrial ATP synthase couples the electrochemical proton gradient to the synthesis or hydrolysis of ATP (5, 11, 26, 39). The ATP synthase is composed of the soluble F1 moiety, which contains the catalytic sites and the membrane-bound F0 moiety, which is involved in proton translocation. The F1 moiety of the mitochondrial ATP synthase is highly conserved and is composed of five subunits present in a stoichiometry of {alpha}3ß3{gamma}1{delta}1{varepsilon}1. The F0 moiety in Escherichia coli is composed of three subunits, a1b2c10-14, but in eukaryotes its subunit composition increases in complexity to include up to eight additional subunit types (5, 22, 26). The Trypanosoma brucei mitochondrial ATP synthase has been isolated and characterized. The molecular composition of the enzyme complex is similar to that of other eukaryotic mitochondrial ATP synthases (43). Both functional assays and analysis of protein levels indicate that the complex is developmentally regulated through the life cycle of the organism (7, 41, 42).

A striking feature of T. brucei is its ability to adapt to diverse environments encountered through the stages of its life cycle (21, 34). In the tsetse fly, the mitochondrion of the procyclic trypanosomes is fully developed with many cristae, a complete respiratory chain, Krebs cycle enzymes, and abundant levels of mitochondrial ATP synthase. In contrast, the sparse and tubular mitochondrion of the early (slender) mammalian bloodstream trypanosomes lacks a functional respiratory chain, and energy production at this stage occurs via glycolysis. Although the expression of some mitochondrial components is upregulated in late (stumpy) bloodstream form trypanosomes, oxidative phosphorylation does not occur until the parasite transforms into the procyclic stage in the midgut of the tsetse fly (9, 17, 24, 29) Despite the absence of cytochrome mediated electron transport coupled to ATP production, a mitochondrial membrane potential in bloodstream forms exists and has been found to be comparable to that in mitochondria of procyclic trypanosomes (18, 20, 33). In the bloodstream stage, electrons flow from ubiquinol to the trypanosome alternative oxidase, but this electron flow is not coupled to ATP production and does not generate a membrane potential (8, 20).

The ATP synthase, in contrast to the cytochromes, can be detected in all life cycle stages but is most abundant during the procyclic stage, where it functions in ATP generation through oxidative phosphorylation (2, 42). We and others have hypothesized that the ATP synthase in bloodstream form trypanosomes is responsible for the generation of the mitochondrial membrane potential by hydrolyzing ATP generated by substrate level phosphorylation (2, 20, 42). The mechanism by which this reversible enzyme switches from the ATP synthetic to the ATP hydrolytic activity is still not well understood, but in E. coli, yeast, and mammalian cells it has been suggested to be a response to the proton motive force and the ADP/ATP balance. ATP hydrolytic activity, therefore, predominates at high ATP levels and low membrane potential, forcing the reverse pumping of protons to generate a membrane potential (28, 35, 38). The membrane potential of the bloodstream form is presumably essential for the transport of ions and nutrients, as well as for the import of nuclearly encoded proteins required as the bloodstream trypanosomes transform to the procyclic form (19, 20). To test this hypothesis, we have used RNA interference (RNAi) to decrease the levels of the ATP synthase in bloodstream form trypanosomes by targeting the F1 {alpha} or ß subunits, which together comprise the catalytic site of the ATP synthase. Our results indicate that the decrease in expression of the {alpha} or ß subunits is reflected in a significantly decrease in the oligomycin-sensitive activities of this enzyme and results in a parallel decrease in the mitochondrial membrane potential of bloodstream trypanosomes. These results support the role of the ATP synthase in the maintenance of the membrane potential in bloodstream trypanosomes.


arrow
MATERIALS AND METHODS
 
pZJM-SB RNAi vector. A 289-bp fragment from nucleotides 171 to 460 of the ß subunit gene was amplified by PCR from the ATP synthase ß subunit cDNA clone (4) with the forward primer containing an XhoI site (underlined), 5'-GCC TCG AGG ACT GCC CTT GAC GTT GTT GAC AAA CT-3', and the reverse primer containing a HindIII site (underlined), 5'-GCA AGC TTC CTG GTC CGC AAG CTT GGG AGC CAC GG-3'. The 289-bp fragment was ligated into the XhoI/HindIII sites between two head to head T7 promoters of the pZJM vector (37) to generate the pZJM-SubunitBeta (pZJM-SB) construct.

pLewLoop-SA vector. The pLewLoop-SA vector produced a double-stranded RNA as a stem-loop construct to target the ATP synthase {alpha} subunit and was constructed as described by Wang et al. (37). Briefly, a 445-bp fragment from nucleotides 169 to 614 was amplified by PCR from the ATPase {alpha} subunit cDNA clone (4) by using the primer CAAGCTTGGGCGACGCGTCGATCGATGGCACCATTGCCAC containing the HindIII and MluI linkers (underlined), respectively, and the reverse primer GCTCTAGAGCAAATTAATTCACGTTGACC containing the XbaI linker (underlined). This product was first ligated into pCRIITopo (Invitrogen), liberated by XbaI/HindIII digestion, and ligated into the NheI/HindIII sites of pJM326 vector. The construct was then digested with HindIII/XbaI to liberate an ~1,000-bp fragment containing the target gene and the ~550-bp stuffer fragment. The pLew100 vector was then digested with XbaI/MluI to release the luciferase reporter. The same ATPase {alpha} subunit fragment was amplified by PCR and digested with XbaI/MluI, followed by ligation into the prepared pLew100 vector to generate the pLewLoop-SubunitAlpha (pLewLoop-SA) construct. The resulting stem-loop plasmid contains two copies of the {alpha} subunit fragment in opposite orientation separated by the stuffer fragment.

Cell growth, transfection, and RNAi induction. Bloodstream T. brucei single marker strain, BSSM (a gift from George Cross, Rockefeller University), henceforth referred to as wild type, was grown in HMI-9 medium supplemented with 10% fetal bovine serum (15). This cell line previously engineered to express T7 polymerase and the tetracycline repressor allows the regulatable expression of double-stranded RNA (dsRNA) from the T7 promoters. Parasites were cultured in the presence of G418 (2.5 µg/ml) to maintain the T7 polymerase and the tetracycline repressor constructs. For transfection, 108 mid-log-phase cells were washed once with 1 ml of Cytomix (31) and resuspended in 0.5 ml of Cytomix containing 10 µg of either the NotI-linearized pZJM-SB construct or the EcoRV-linearized pLewLoop-SA vector to target the rRNA gene spacer region by homologous recombination. Transfections were performed in 4-mm cuvettes by using a BTX electroporator (ECM 630) with peak discharge at 1.6 kV in resistance timing mode R2 (25 {Omega}) at a capacitance of 50 µF. Immediately after transfection, cells were transferred into 10 ml of fresh medium supplemented with 10% fetal bovine serum. After 1 day, selection of stable transformants was achieved by the addition of phleomycin (2.5 µg/ml) (37). Clonal cell lines of the pLewLoop-SA were generated by extreme dilution. Extreme dilution was also attempted to generate clonal cell lines of the pZJM-SB but were not successful (36).

To induce RNAi expression, cells growing at mid-log phase were diluted to 3 x 105 cells/ml, cultured in the medium described above supplemented with 1.0 µg of tetracycline/ml, and maintained at a density of less than 5 x 106 cells/ml throughout the induction. Growth curves were determined as the product of cell density and total dilution. The morphology of the cells was examined by microscopic analysis at the end of all experiments to determine the extent of viability, mobility, and morphology. For Giemsa-Wright-stained cells, micrographs were collected by using a Nikon Microphot-FXA microscope equipped with a Nikon FX-35DX camera.

Reverse transcription-PCR (RT-PCR) analysis. Total RNA was isolated from 5 x 106 cell aliquots collected for samples of ATPase ß-subunit RNAi inductions on days 0, 2, and 4 postinduction and days 0, 2, 3, and 4 postinduction of ATPase {alpha}-subunit RNAi. Total RNA was extracted TRIzol Reagent (Invitrogen) according to the manufacturer's protocol. Total RNA was treated with DNase I and reverse transcribed by using the Thermoscript RT-PCR system (Invitrogen). The cDNA pool was used as the template to amplify the {alpha} and ß subunits by PCR. Amplification of the ATP synthase {alpha} subunit was performed with the miniexon primer and NW73 (reverse primer to the NW72), and amplification the ß subunit was performed with miniexon primer (NW25) and an internal primer, (NW 90R), which amplifies the transcript, as previously described (4). Amplification of Subunit 9 was performed with the miniexon primer and an internal primer (NW89) (6). The ß-actin transcript was amplified with primers (NW77 forward and NW78 reverse) (27), and the RNA-binding protein p34 and p37 transcripts were amplified with the miniexon primer and the reverse primer JZ2R (44). The latter two were amplified from the same cDNA pool as internal controls for transcripts whose stability should not be affected by the expression of {alpha}- or ß-subunit dsRNA. The PCR products were analyzed by agarose gel electrophoresis, followed by ethidium bromide staining. RT-PCR results for each subunit were quantified by densitometric analysis with a GS-700 imaging densitometer in combination with the Multi-Analyst software (Bio-Rad) with the corresponding day 0 set at 100% reference. Quantitative results were derived from a minimum of three independent experiments.

Western blot analysis of RNAi cells. Bloodstream RNAi cell cultures were induced and harvested as described above. For protein samples, 5 x 106 cells were collected per time point. Whole-cell extract from half the sample (2.5 x 106 cells) was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by Western blot analysis with antibodies directed against the T. brucei complete F1 complex, ß subunit, subunit 9, and the F0 complex as previously described (4, 6, 43). An aliquot of equal cell number was used for Western blot analysis probed with a monoclonal antibody against ß-tubulin (Chemicon International) as a loading control. Western blot results for each subunit were quantified by densitometric analysis as described above, and the corresponding day 0 was used as the 100% reference. Quantitative results are derived from a minimum of three independent experiments.

Determination of ATPase and ATP synthase activity. An enhanced mitochondrial fraction was prepared from 3 to 5 x 109 wild type, day 4-induced ß-subunit RNAi cell lines, and day 3-induced {alpha}-subunit RNAi, as previously described (43). The ATPase activity was determined spectrophotometrically at 340 nm by using a coupled enzyme assay, with 100 µg of protein by the method of Pullman as previously described (43). To determine the specificity of the ATPase activity, oligomycin (5 µg/mg of protein) was added to the mitochondria and preincubated for 45 min prior to the assay. The ATP synthetic activity was determined spectrophotometrically at 340 nm by the method of Pullman and Racker, as previously described (43).

Fluorescent microscopic detection of mitochondrial membrane potential. The membrane potential-dependent stain MitoTracker Red CMXRos (Molecular Probes) was used to assess the mitochondrial membrane potential in bloodstream form trypanosomes. A total of 5 x 106 wild type, day 4-induced ß RNAi, and day 3-induced {alpha} RNAi cells were incubated in HMI-9 media containing a 0.1 µM final concentration of MitoTracker Red CMXRos dissolved in dimethyl sulfoxide for 20 min in a 37°C, 5% CO2 gas incubator. The cells were sedimented and washed in 150 mM NaCl-20 mM phosphate (pH 7.4; PBS) and then incubated in HMI-9 without dye for 30 min. Cells were sedimented, washed with PBS, and fixed with 4% paraformaldehyde in PBS for 10 min at 4°C. After another wash in PBS, the cells were loaded on slides and mounted with Cytoseal 60 mounting media (32). In parallel experiments, cells were treated with 100 µM CCCP (carbonyl cyanide m-chlorophenylhydrazone; Sigma) and incubated for 15 min in a 37°C, 5% CO2 incubator, either before or after the addition of MitoTracker Red CMXRos, and cells were sedimented and resuspended in fresh HMI-9 medium after treatment with the uncoupler. Images were captured with a Bio-Rad MRC 1024 confocal microscope on a Nikon optiphot with absorption at 578 nm, emission at 599 nm and using identical exposures for all samples. For the nonclonal ß RNAi population, cell counts from an average of 400 counts per sample were scored on the basis of fluorescence intensity. Cells showing intensity similar to that of the wild type were scored as high, and cells showing fluorescence intensity similar to CCCP treated samples were scored as low. Counts were determined for RNAi-induced cells from at least three independent inductions.

Fluorescent activated cell sorting (FACS). Wild-type bloodstream form cells, uninduced cells, and induced {alpha} and ß RNAi cells were sedimented, resuspended in HMI-9 medium at 2.5 x 106/ml, and incubated in HMI-9 medium containing 2.5 µM MitoTracker Red CMXRos (Molecular Probes) for 30 min at 37°C and 5% CO2. Staining of the {alpha} RNAi cells was decreased to 1 µM MitoTracker with similar results. In parallel experiments, cells were treated with 50 µM CCCP (Sigma) and incubated for 15 min in a 37°C-5% CO2 incubator, either before or after the addition of MitoTracker Red CMXRos, and cells were sedimented and resuspended in fresh HMI-9 medium after treatment with the uncoupler. Cells were washed with 2x volume of PBS and sedimented, and the pellet was resuspended in 1 ml of PBS. Changes in mitochondrial fluorescence intensity were analyzed with a FACSCalibur (Becton Dickinson) analytical flow cytometer using absorption at 578 nm and emission at 599 nm. CellQuest software (Becton Dickinson) was used to analyze the results.


arrow
RESULTS
 
Expression of {alpha}- and ß-subunit dsRNAi in the bloodstream stage resulted in a change in cell growth. RNAi was used to knock down the ATP synthase {alpha} and ß subunits in order to study the function of the mitochondrial ATP synthase in the bloodstream stages of T. brucei. The RNAi of the ATP synthase ß subunit was mediated by the dsRNA construct, pZJM-SB, which contains a 289-bp fragment of the ATP synthase ß-subunit coding region. This vector allows the regulatable expression of dsRNA of the ß-subunit fragment from opposing T7 promoters in cell lines previously engineered to express the T7 polymerase and the tetracycline repressor. The RNAi of the ATP synthase {alpha} subunit was mediated by a tetracycline-induced stem-loop construct (pLewLoop-SA), containing a 445-bp fragment of the {alpha}-subunit coding region. Clonal cell lines of bloodstream trypanosomes transfected with the {alpha}-subunit stem-loop construct (pLewLoop-SA) were established by limiting dilution. Although several attempts were made to develop clonal cell lines of the pZJM-SB expressing ß RNAi, no viable lines could be maintained. We believe that expression of dsRNA without induction in pZJM (30, 37) acted to select against the establishment of a cell line capable of a more complete knock down. Thus, two nonclonal ß-subunit RNAi cell lines that showed a substantial decrease in the ß-subunit protein, relative to the uninduced, were used to monitor effects of RNAi expression of the ß subunit.

The pZJM-SB cell lines were induced for the expression of ß-subunit RNAi for up to 6 days and showed a 50% decrease and a lag in cell growth compared to wild-type and uninduced cells starting at day 3 postinduction (Fig. 1A). Similarly, cell lines expressing {alpha}-subunit RNAi induced with tetracycline for up to 6 days showed a decrease in cell grown of ~50% starting at day 3 postinduction compared to wild-type and uninduced cells (Fig. 1B). Despite a decrease in the rate of cell growth, microscopic analysis of the {alpha} and ß RNAi induced cell lines did not show significant changes in motility or morphology. We also obtained an {alpha} stem-loop clone (pLewloop-SA clone 11) in which induction with tetracycline resulted in cell death within 24 h of induction (Fig. 1C). This phenotype, however, could not be maintained in continued culture. Both cell lines were monitored for effects on the transcript and protein expression for 4 days after induction. Induction of the ß-subunit RNAi resulted in a 50% decrease in the ß-subunit transcript (Fig. 2A) and protein expression (Fig. 3A) on day 4 postinduction. Induction of the {alpha}-subunit RNAi resulted in a 50% decrease in the {alpha}-subunit transcript (Fig. 2B) by day 3 and protein (Fig. 3B) by day 2 postinduction. By day 3 postinduction, the {alpha} clone showed 90% decrease in protein expression and began to recover by day 4 (Fig. 3B) Thus, in all subsequent experiments the pZJM-SB cells were induced for 4 days for ß RNAi and the pLewloop-SA cells were induced for 3 days for {alpha} RNAi, with cell densities maintained at less than 5 x 106. These results indicated that a decrease in the levels of the ATP synthase {alpha} and ß subunits was limiting for cell proliferation after day 3 of tetracycline addition. After this lag in cell growth, the cells began to recover, as is often seen in T. brucei RNAi cell lines (13, 14, 40), but did not reach wild-type or uninduced levels during the days observed (Fig. 1A and B). This suggests that the ATP synthase plays an important role in the growth and proliferation of the bloodstream form trypanosomes. Moreover, attempts to differentiate the pZJM-SB cells into the procyclic stage resulted in multinucleation, aggregation, and cell death (data not shown). This latter result suggests that ß RNAi-induced cells are already weakened, such that they are unable to keep up with the cellular demands required for differentiation to the procyclic stage. Moreover, since the ATP synthase is required for metabolism in procyclic trypanosomes, even the reduced content of ATP synthase may be too low to allow sufficient energy generation for cell survival.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. RNAi knockdown of the ATP synthase {alpha} and ß subunits results in a decrease in cell growth. The effect of decreased {alpha} or ß expression on cell growth was determined after induction of RNAi with 1 µM tetracycline compared to uninduced and wild-type cells. (A) Effect of subunit ß RNAi induction on cell growth. (B and C) {alpha} subunit clones 8 and 11, respectively, showing the effects of the subunit {alpha} RNAi expression on cell growth. Growth curves were determined as the product of cell density and total dilution.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2. RNAi knockdown of the ATP synthase {alpha} and ß subunits affects the steady-state transcript expression of ATP synthase complex subunits. RNA extracted from 5 x 106 cells of RNAi-induced cells from each day 0, day 2, day 3, and day 4 postinduction and used in RT-PCR to analyze the steady-state transcript levels of the F1 complex {alpha} and ß subunits and the F0 complex subunit 9, using the respective internal subunit primers with the miniexon primer. (A) Effect of ß RNAi induction on the steady-state transcript levels of ATP synthase subunits ß, {alpha}, and 9. (B) Effect of {alpha} RNAi induction on steady-state transcript levels of ATP synthase subunits {alpha}, ß, and 9. Day 0 was set as the 100% reference point. Actin was used as the control.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 3. RNAi knockdown of the ATP synthase {alpha} and ß subunits affects the steady-state protein expression of ATP synthase complex subunits. Steady-state protein levels of the F1 complex {alpha} and ß subunits and the F0 complex subunits 9 and the 32 kDa, were analyzed by using Western blots of total protein from 2.5 x 106 cells from each day 0, day 2, day 3, and day 4 postinduction. The ß subunit was detected with anti-ß subunit antibodies, the {alpha} subunit was detected with anti-F1 complex antibodies, subunit 9 was detected with anti-subunit 9 antibodies, and the 32-kDa subunit was detected with anti-F0 complex antibodies. The levels of ß-tubulin expression were used as the loading control. (A) Effect of ß RNAi on the steady-state protein levels of ATP synthase {alpha}, ß, S9, and F0 complex 32-kDa subunits. (B) Effect of {alpha} RNAi on the steady-state protein levels of ATP synthase {alpha}, ß, S9, and F0 complex 32-kDa subunits. Day 0 was set as the 100% reference point. ß-Tubulin was used as the control.

Expression of {alpha}- and ß-subunit RNAi resulted in a significant change of the mRNA and protein steady-state levels of ATP synthase subunits. Cells induced for 4 days for ß and 3 days subunit {alpha} RNAi were analyzed by RT-PCR and Western blot to determine the effect on their respective ATP synthase subunit steady-state transcript and protein levels. RNAi knockdown of the ß subunit resulted in a 50% decrease in ß-subunit mRNA steady-state levels by day 2 and a 73% decrease by day 4 postinduction relative to the uninduced day 0 levels (Fig. 2A). RNAi knockdown of the ß subunit also decreased the steady-state transcript levels of the {alpha} subunit by 65% on day 2 and by 58% on day 4 postinduction. RNAi induction of the {alpha} subunit decreased the {alpha}-subunit mRNA steady-state levels by 50% on day 3 and was further decreased to by 80% on day 4 postinduction relative to the uninduced day 0 levels (Fig. 2B). RNAi knockdown of the {alpha} subunit also decreased the ß-subunit steady-state transcript levels, similar to the effect of ß RNAi on the {alpha} subunit. It is not surprising that ß RNAi knockdown has an effect on the {alpha} subunit of the ATP synthase and vice versa, since these two subunits are highly homologous. The 289-bp fragment used in the pZJM-SB vector shares 45% identity to the same region of the {alpha} subunit, and the {alpha} subunit 445-bp fragment used in the pLewloop-SA stem-loop construct shares 45% identity to the same region of the ß subunit. To determine whether this effect was due to sequence homology or if this was a global effect on the ATP synthase, we examined other subunits of the complex. The steady-state mRNA levels of the ATPase F0 complex subunit 9 (S9) decreased only by 10% on day 2 and by 15% on day 4 postinduction upon ß RNAi knockdown. Similarly, steady-state mRNA levels of the ATPase F0 complex S9 remained relatively stable upon {alpha} RNAi induction. The actin (Fig. 2) and p34/p37 (data not shown) control levels remained constant throughout induction of either {alpha} or ß RNAi (Fig. 2).

The effect of {alpha} and ß RNAi induction on the steady protein levels of the ATP synthase complex subunits was monitored by Western blot analysis with the antibodies specific for T. brucei subunits. ß RNAi knockdown resulted in a 47% decrease in the steady-state protein level for the F1 complex ß subunit on day 2 and a 54% decrease on day 4 postinduction relative to day 0 (Fig. 3A). The steady-state protein levels of the F1 complex {alpha} subunit were significantly decreased by 63% on day 2 and 84% on day 4 postinduction. Similarly, RNAi knockdown of the {alpha} subunit resulted a 65% decrease in the ATP synthase F1 complex {alpha} subunit and a similar 60% decrease of the ß subunit by day 3 postinduction. Surprisingly, knockdown of either the {alpha} or ß subunits resulted in a significant increase of the steady-state protein of the F0 complex subunit 9. Upon RNAi of the ß subunit, the steady-state protein levels of the F0 complex subunit 9 was significantly increased by 87% on day 2 and by 61% on day 4 postinduction. These results were paralleled upon RNAi induction of the {alpha} subunit (Fig. 3). The inverse effect of F1 complex {alpha} or ß subunit knockdown on the F0 complex subunit 9 was highest on day 2 postinduction (87% increase), suggesting that as {alpha}- or ß-subunit transcript levels were targeted by RNAi, the subunit 9 transcript stability and/or protein stability increased, leading to an increase in the overall level of expression of this subunit. This effect peaked on day 2 and decreased on day 4 (61% increase) as the cells began to recover (Fig. 1). In contrast, knockdown of the {alpha} or ß subunits did not significantly change the steady-state levels of the F0 complex 32-kDa subunit (Fig. 3).

RNAi of the {alpha} or ß subunit resulted in a decrease in oligomycin-sensitive ATP hydrolytic and ATP synthetic activities. Previous work from this laboratory measured ATP hydrolytic and ATP synthetic activities in an enhanced mitochondrial fraction from bloodstream cells. In the results reported here, 42% of the ATP hydrolytic and 49% of the ATP synthetic activity of wild-type mitochondria was sensitive to inhibition by oligomycin, similar to that previously reported (43). The mitochondrial fraction from cells induced for ß RNAi showed a 43% decrease in ATP hydrolytic activity and a 44% decrease in ATP synthetic activity, relative to the wild-type controls. The sensitivity to oligomycin from ß RNAi-induced cells was 54% for ATP hydrolytic activity (Table 1) and 40% for ATP synthetic activity (Table 2) compared to RNAi cells. ATP hydrolytic and synthetic activities were similarly affected by RNAi knockdown of the ATPase {alpha} subunit (data not shown). This suggests that the ATP synthase complexes that form after {alpha} or ß RNAi knockdown are fully functional and show similar oligomycin sensitivity to that of wild type.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Mitochondrial ATP hydrolysis activitya


View this table:
[in this window]
[in a new window]
 
TABLE 2. Mitochondrial ATP synthase activitya

{alpha}- or ß-subunit RNAi knockdown affects the mitochondrial membrane potential of bloodstream T. brucei. To determine whether knock down of the {alpha} or ß subunits affects the mitochondrial membrane potential, we used the mitochondrial membrane potential-sensitive dye MitoTracker Red CMXRos to stain the mitochondria of wild type and induced cells with or without treatment with the respiratory uncoupler CCCP (32). The uptake of the MitoTracker Red CMXRos stain is dependent on mitochondrial membrane potential (23); in T. brucei cells a single MitoTracker-stained mitochondrion spans the length of the entire cell (10). Fluorescence microscopic analysis of the ß RNAi-induced cells showed a population of cells showing different degrees of intensity of the MitoTracker fluorescent staining compared to wild-type cells (Fig. 4A and C). These cells were largely of two groups showing intense MitoTracker staining similar to those in the wild-type cells (Fig. 4A and C) or showing decreased staining similar to wild-type or ß RNAi cells pretreated with the uncoupler CCCP (Fig. 4C, arrowhead). Cells treated with the uncoupler CCCP before or after staining with the MitoTracker Red showed equal intensity of staining. In cells induced for ß RNAi, 60% of the cell population showed low fluorescence intensity, whereas 40% showed fluorescent intensity similar to wild type (Fig. 4G), indicating that ß RNAi in this nonclonal cell line leads to a decrease in the mitochondrial membrane potential of the RNAi targeted cells within this cell population. Cells induced for {alpha} RNAi expression showed a decrease in fluorescence similar to that seen for cells expressing ß RNAi. For cells expressing {alpha} RNAi, two cell lines were followed; clone 8 showed a mixed population of cells showing various degrees of fluorescent intensity similar to what was seen in the ß RNAi nonclonal cell population (Fig. 4E, the arrowhead indicates a cell of lower intensity). Treatment with the uncoupler CCCP also resulted in a decrease in the mitochondrion membrane potential of this cell population (Fig. 4F).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. RNAi knockdown of the ATP synthase {alpha} and ß subunit affects the mitochondrial membrane potential. For each cell line, 5 x 106 cells were stained with 0.1 µM MitoTracker Red CMXRos. Cells treated with CCCP were either treated with 50 mM CCCP for 15 min before or after staining with MitoTracker Red CMXRos, fixed with 4% paraformaldehyde, and analyzed by using confocal microscopy. (A) Wild-type bloodstream form cells; (B) wild-type cells treated with CCCP; (C) ß RNAi-induced cells (the arrowhead shows cells with low fluorescent intensity); (D) ß RNAi-induced cells treated with CCCP; (E) {alpha} RNAi-induced cells stained with MitoTracker; (F) {alpha} RNAi-induced cells treated with CCCP. (G) Quantitative analysis of ß RNAi-induced cells scored on the basis of relative fluorescence intensity.

Quantitative analysis of the {alpha} and ß RNAi effect on the mitochondrial membrane potential by FACS. To further quantify the effect of {alpha} and ß RNAi knockdown on the mitochondrial membrane potential, uptake of the MitoTracker Red CMXRos dye was analyzed by flow cytometry. Flow cytometry of the ß RNAi-induced cells showed a consistent decrease in fluorescent intensity compared to the wild-type cells high threshold, as indicated by a leftward shift in the fluorescence intensity of the RNAi cells (Fig. 5A, B, C, and D, red trace) (16). Significantly, the fluorescent trace of the ß RNAi cells showed a double peak, one of higher fluorescent intensity (Fig. 5B, peak 1, red trace) and one of lower fluorescent intensity which predominantly overlapped with the CCCP-treated peak (Fig. 5B, peak 2 of red trace and green trace). Each of the double peaks represents 50% of the cell population based on the area under the curve. All of the cells treated with the uncoupler CCCP lose their mitochondrion membrane potential and thus show a decrease in the fluorescence intensity as seen in both CCCP-treated wild-type and ß RNAi cells (Fig. 5A to D, green trace). In all cell lines, after treatment with CCCP the cells retained a low level of nonspecific fluorescence higher than the unstained background levels (Fig. 5A to D, blue shaded peak), parallel to the results obtained by fluorescence microscopy (Fig. 4B, D, and F). These results confirmed the results seen with fluorescence microscopy (Fig. 4E), which showed that 60% of the RNAi induced cell population has lower fluorescence intensity due to a decrease in the mitochondrial membrane potential. Flow cytometry of {alpha}-subunit RNAi induced cell lines also showed a consistent decrease in the relative fluorescence intensity. The pLewloop-SA clone 8 showed a shifted peak of decreased fluorescence intensity (Fig. 5C). Flow cytometry of clone 11, which showed the most severe growth phenotype, showed a single peak of decreased fluorescence intensity (Fig. 5D). In both cases, treatment with CCCP resulted in the further decrease in fluorescence intensity, reflecting the decrease in mitochondrial membrane potential.



View larger version (24K):
[in this window]
[in a new window]
 
FIG. 5. FACS analysis of the effect of {alpha} and ß RNAi knockdown on the mitochondrial membrane potential. Analysis of 2.5 x 106 cells/ml each of wild type (WT) and RNAi-induced cells stained with a 2.5 µM concentration of the membrane potential sensitive MitoTracker Red is shown. CMXRos (red trace of each panel) and treated with 50 µM CCCP prior to MitoTracker staining (green trace of each panel) were analyzed with the FACSCalibur flow cytometer to monitor the changes in fluorescence intensity. The y axis of the graphs represents the total cell counts (x10) per sample, and the x axis indicates the relative fluorescence intensity of the samples. (A) Relative fluorescence intensity of wild-type stained cells. (B) Relative fluorescence intensity of ß RNAi-induced cells. Arrows point to peak 1 (high fluorescence) and peak 2 (low fluorescence) of the ß RNAi cells. (C) Relative fluorescence intensity of {alpha} RNAi-induced cells from clone 8. (D) Relative fluorescence intensity of {alpha} RNAi-induced cells from clone 11. Blue shaded peak, background intensity.


arrow
DISCUSSION
 
The mitochondrial ATP synthase is a reversible enzyme with both hydrolytic and synthetic activities. In most organisms and in procyclic trypanosomes, the proton motive force generated by the electron transport chain is coupled to the synthesis of ATP via the mitochondrial ATP synthase (oxidative phosphorylation). Changes in the T. brucei mitochondrial structure and function throughout the stages of its life cycle have been well documented (9, 24, 29, 41, 42). The mitochondrion of the procyclic form trypanosome is fully developed with many tubular cristae. A fully functional respiratory chain is present, the ATP synthase is abundant, and ATP is generated by oxidative phosphorylation. The mitochondrion of the early bloodstream form, however, is tubular and contains few cristae, and the electron transport chain and several Krebs cycle enzymes are missing. The levels of ATP synthase are also substantially reduced at this stage, and ATP synthesis is achieved solely via glycolysis.

Differentiation into the late bloodstream form is accompanied by the upregulation of these mitochondrial components, pre-adapting the trypanosome to transition to the tsetse fly. Interestingly, in early bloodstream form trypanosomes where the cytochromes are completely absent, the ATP synthase is still present, although at somewhat decreased levels. In fact, the ATP synthase can be detected in all stages of the life cycle of T. brucei (3, 42), indicating that it may have a unique role in this organism's ability to function in the bloodstream of its host. Despite the changes that have been observed in the mitochondrion of the bloodstream forms, the membrane potential is maintained at levels comparable to those found in the procyclic form (20). In the bloodstream form, electron flow is accomplished via the glycerol-3-phosphate shuttle to the trypanosome alternative oxidase but is not coupled to ATP production and does not generate a membrane potential (2, 8, 20). Therefore, it has been hypothesized that the ATP synthase in the bloodstream form acts in reverse as an ATP hydrolase to generate the proton motive force at the expense of ATP derived through substrate level phosphorylation (19, 20).

To test this hypothesis, we used RNAi to knock down the ATP synthase by targeting the expression of the {alpha} and ß subunits which comprise the catalytic site of the ATP synthase. Nonclonal cell lines expressing ß RNAi were recovered after phleomycin selection and subsequently characterized for the reduction of the mRNA and protein expression for the ß subunit by using RT-PCR and Western blot analyses, respectively. Knockdown of the catalytic ß subunit also significantly reduced the levels of the F1-ATPase {alpha}-subunit transcript and protein levels (Fig. 2 and 3). Similarly, when the ATPase {alpha} subunit is targeted by RNAi, the steady-state transcript and protein levels of the ß subunit are also decreased. RNAi knockdown of the {alpha} or ß subunit may directly knock down the expression of the ß or {alpha} subunit, respectively, due to the high degree of homology shared between these two genes. The nucleic acid sequences of {alpha} and ß subunits are 50% identical overall; the region used to construct the RNAi vectors shows 45% identity to the same region of the other subunit. It is also possible that the decrease in the ß or {alpha} subunits may be due to differences in the stability of the subunit protein due to the loss of the partner subunit to form the {alpha}3ß3 catalytic core of the enzyme.

RNAi knockdown of the {alpha} or ß subunit did not affect the steady-state transcript levels of the F0 complex subunit 9. Surprisingly, the steady-state protein levels of this subunit are increased in induced cells, suggesting a possible effect on the posttranscriptional regulation of this subunit. The results shown here support our previous results in which the difference in stability of subunit 9 transcript was not proportional to its steady-state protein level, suggesting further posttranscriptional regulation of this protein (3). However, not all ATP synthase subunits were affected since the protein levels of the T. brucei F0-32-kDa subunit did not change when either the {alpha} or ß subunit were knocked down. Taken together, these results suggest that a common transacting regulatory factor of some of the ATP synthase genes may help to enhance stability of some but not all ATP synthase subunits at the transcriptional level, thus contributing to the coordination of gene expression. When the levels of the {alpha} and ß transcripts are decreased, as is the case in both the {alpha} and ß RNAi cells, this common regulatory factor would presumably be available in higher amounts to further enhance the stability of the subunit 9 transcript and or protein, leading to increased abundance of this protein. We are continuing to examine the mechanism of gene expression that controls the expression of the ATP synthase complex. Thus far, we have identified a common 13-nucleotide AG-rich element found in the 3' untranslated region of these three genes which may help direct regulation of gene expression of this complex (3).

RNAi knockdown of the {alpha} or ß subunit resulted in ca. 50% decrease in catalytically active ATP synthase complex formed (Tables 1 and 2). The ATP synthase complex that assembled after {alpha} or ß RNAi induction functioned similarly to the wild type, showing ATP hydrolytic and synthetic oligomycin-sensitive activities similar to those previously reported (43). The levels of catalytically active complexes formed paralleled the amount of either subunit present after RNAi knockdown. In yeast and mammalian cells, assembly of the ATP synthase complex has been shown to be dependent on the concentration of either {alpha} or ß subunit; therefore, a decrease in the {alpha} or ß subunit leads to a decrease in overall complex formation. In contrast, the loss of other subunits ({gamma}, {delta}, and {varepsilon}) results in the formation of partial complexes. The F1 and F0 complexes appear to form independently of each other. However, if the F0 complex forms in the absence of F1, it does not appear to be proton permeable (18). This may account for our observation that in the {alpha} and ß RNAi-induced cell lines, the F0 proteins are either unaffected (32-kDa protein) or are increased, as was seen for subunit 9.

The effect of ATP synthase depletion on the mitochondrial membrane potential was determined by using MitoTracker Red CMXRos. The MitoTracker probes are similar to rhodamine-123 in their selective sequestration in active mitochondria. Rhodamine-123 has been previously used to stain T. brucei mitochondria; however, rhodamine-123-stained cells cannot be fixed, making it more difficult to obtain microscopic images (1, 12). The MitoTracker probes have the advantage of being retained in the mitochondria after fixation and permeabilization of the cells (32). Moreover, the MitoTracker Red CMXRos probe has also been shown to be selectively retained based on mitochondrion membrane potential (23). The membrane potential of the RNAi-induced cells was substantially diminished when the {alpha}- or ß-subunit expression was decreased, similar to what was seen in cells treated with the uncoupler CCCP. Knockdowns of other mitochondrial complex subunits in the procyclic stage have shown a similar decrease in the mitochondrial membrane potential (16). These effects resulted in a decrease in the growth rate compared to the uninduced and wild-type controls. In T. brucei, as in other organisms, a proton-motive force has been shown to be required for the import of nuclearly encoded mitochondrial proteins and tRNA (25). In these {alpha} and ß RNAi cells where reduced levels of the ATP synthase resulted in a decrease in membrane potential, the cells were likely decreased in the ability maintain functional requirements for differentiation, leading to a decrease in growth rate. Cellular differentiation requires upregulation of mitochondrial function and hence increased import of the nuclear encoded components into the mitochondria. Thus, the failure of these cells to be transformed to the procyclic stage was likely due to the inability of these cells to keep up with the cellular requirements for differentiation due to reduced functional mitochondria. These results support the hypothesis that the ATP synthase is responsible in part or in whole for the maintenance of membrane potential in bloodstream form trypanosomes.


arrow
ACKNOWLEDGMENTS
 
We thank Shelby Bidwell for generating the pZJM-SB construct, Chioma Okeoma for generating the pLewloop-SA clones, Wade Sigurson for expert assistance in the confocal microscopy, George Cross for providing the bloodstream form single marker BSSM cell line, Akhil Vaidya and Michael Mather for helpful assistance in the mitochondrial membrane potential assays, and William T. Ruyechan for critical reading of the manuscript and helpful scientific discussion.

This study was supported by an NIH grant AI-48845 to N.W.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 253 Biomedical Research Building, Department of Microbiology, University at Buffalo, Buffalo, NY 14214. Phone: (716) 829-2279. Fax: (716) 829-2158. E-mail: nw1{at}acsu.buffalo.edu. Back


arrow
REFERENCES
 
    1
  1. Bienen, E. J., M. Saric, G. Pollakis, R. W. Grady, and A. B. Clarkson, Jr. 1991. Mitochondrial development in Trypanosoma brucei brucei transitional bloodstream forms. Mol. Biochem. Parasitol. 45:185-192.[CrossRef][Medline]
  2. 2
  3. Bienen, E. J., and M. K. Shaw. 1991. Differential expression of the oligomycin-sensitive ATPase in bloodstream forms of Trypanosoma brucei brucei. Mol. Biochem. Parasitol. 48:59-66.[CrossRef][Medline]
  4. 3
  5. Brown, B., S. V., T. B. Chi, and N. Williams. 2001. The Trypanosoma brucei mitochondrial ATP synthase is developmentally regulated at the level of transcript stability. Mol. Biochem. Parasitol. 115:177-187.[CrossRef][Medline]
  6. 4
  7. Brown, B., S. V., A. Stanislawski, Q. L. Perry, and N. Williams. 2001. Cloning and characterization of the subunits comprising the catalytic core of the Trypanosoma brucei mitochondrial ATP synthase. Mol. Biochem. Parasitol. 113:289-301.[CrossRef][Medline]
  8. 5
  9. Capaldi, R. A. 2002. Mechanism of the F1F0-type ATP synthase, a biological rotary motor. Trends Biochem. Sci. 27:154-160.[CrossRef][Medline]
  10. 6
  11. Chi, T. B., S. V. Brown, and N. Williams. 1998. Subunit 9 of the mitochondrial ATP synthase of Trypanosoma brucei is nuclearly encoded and developmentally regulated. Mol. Biochem. Parasitol. 92:29-38.[CrossRef][Medline]
  12. 7
  13. Chi, T. B., S. Y. Choi, and N. Williams. 1996. The ATP synthase of Trypanosoma brucei is developmentally regulated by an inhibitor peptide. Arch. Biochem. Biophys. 333:291-297.[CrossRef][Medline]
  14. 8
  15. Clarkson, A. B., Jr., E. J. Bienen, G. Pollakis, and R. W. Grady. 1989. Respiration of bloodstream forms of the parasite Trypanosoma brucei brucei is dependent on a plant-like alternative oxidase. J. Biol. Chem. 264:17770-17776.[Abstract/Free Full Text]
  16. 9
  17. Clayton, C. E., and P. Michels. 1996. Metabolic compartmentation in African trypanosomes. Parasitol. Today 12:465-471.[CrossRef][Medline]
  18. 10
  19. Coustou, V., S. Besteiro, L. Riviere, M. Biran, N. Biteau, J.-M. Franconi, M. Boshart, T. Baltz, and F. Bringaud. 2005. A mitochondrial NADH-dependent fumarate reductase involved in the production of succinate excreted by procyclic Trypanosoma brucei. J. Biol. Chem. 280:16559-16570.[Abstract/Free Full Text]
  20. 11
  21. Cross, R. L., and V. Muller. 2004. The evolution of A-, F-, and V-type ATP synthases and ATPases: reversals in function and changes in the H+/ATP coupling ratio. FEBS Lett. 576:1-4.[CrossRef][Medline]
  22. 12
  23. Divo, A. A., C. L. Patton, and A. C. Sartorelli. 1993. Evaluation of Rhodamine 123 as a probe for monitoring mitochondrial function in Trypanosoma brucei spp. J. Eukaryot. Microbiol. 40:329-335.[Medline]
  24. 13
  25. Drozdz, M., S. S. Palazzo, R. Salavati, J. O'Rear, C. Clayton, and K. Stuart. 2002. TbMP81 is required for RNA editing in Trypanosoma brucei. EMBO J. 21:1791-1799.[CrossRef][Medline]
  26. 14
  27. Faruya, T., P. Kessler, A. Jardim, A. Schnaufer, C. Crudder, and M. Parsons. 2002. Glucose is toxic to glycosome-deficient trypanosomes. Proc. Natl. Acad. Sci. USA 99:14177-14182.[Abstract/Free Full Text]
  28. 15
  29. Hirumi, H., and K. Hirumi. 1989. Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J. Parasitol. 75:985-989.[CrossRef][Medline]
  30. 16
  31. Horvath, A., E. Horakova, P. Dunajcikova, Z. Verner, E. Pravdova, I. Slapetova, L. Cuninkova, and J. Lukes. 2005. Downregulation of the nuclear-encoded subunits of the complexes III and IV disrupts their respective complexes but not complex I in procyclic Trypanosoma brucei. Mol. Microbiol. 58:116-130.[CrossRef][Medline]
  32. 17
  33. Michelotti, E. F., and S. L. Hajduk. 1987. Developmental regulation of trypanosome mitochondrial gene expression. J. Biol. Chem. 262:927-932.[Abstract/Free Full Text]
  34. 18
  35. Mueller, D. 2000. Partial assembly of the yeast mitochondrial ATP synthase. J. Bioenerg. Biomembr. 32:391-400.[CrossRef][Medline]
  36. 19
  37. Nolan, D. P., and H. P. Voorheis. 1991. Bioenergetic studies of bloodstream forms of Trypanosoma brucei electrical H+ gradients. Biochem. Soc. Trans. 18:735-739.
  38. 20
  39. Nolan, D. P., and H. P. Voorheis. 1992. The mitochondrion in bloodstream forms of Trypanosoma brucei is energized by the electrogenic pumping of protons catalyzed by the F1F0-ATPase. Eur. J. Biochem. 209:207-216.[Medline]
  40. 21
  41. Opperdoes, F. R. 1987. Compartmentation of carbohydrate metabolism in trypanosomes. Annu. Rev. Microbiol. 41:127-151.[CrossRef][Medline]
  42. 22
  43. Pedersen, P. L., and L. M. Amzel. 1993. ATP synthases: structure, reaction center, mechanism, and regulation of one of nature's most unique machines. J. Biol. Chem. 268:9937-9940.[Free Full Text]
  44. 23
  45. Pendergrass, W., N. Wolf, and M. Poot. 2004. Efficacy of MitoTracker Green and CMXrosamine to measure changes in mitochondrial membrane potentials in living cells and tissues. Cytometry 61A:162-169.[Medline]
  46. 24
  47. Priest, J. W., and S. L. Hajduk. 1994. Developmental regulation of mitochondrial biogenesis in Trypanosoma brucei. J. Bioenerg. Biomembr. 26:179-191.[CrossRef][Medline]
  48. 25
  49. Priest, J. W., and S. L. Hajduk. 1996. In vitro import of the Rieske iron-sulfur protein by trypanosome mitochondria. J. Biol. Chem. 271:20060-20069.[Abstract/Free Full Text]
  50. 26
  51. Senior, A. E., S. Nadanaciva, and J. Weber. 2002. The molecular mechanism of ATP synthesis by F1F0-ATP synthase. Biochim. et Biophys. Acta 1553:188-211.[Medline]
  52. 27
  53. Stojdl, D. F., and M. W. Clarke. 1996. Trypanosoma brucei: analysis of cytoplasmic Ca2+ during differentiation of bloodstream stages in vitro. Exp. Parasitol. 83:134-146.[CrossRef][Medline]
  54. 28
  55. Suzuki, T., T. Murakami, R. Iino, J. Suzuki, S. Ono, Y. Shirakihara, and M. Yoshida. 2003. F1F0-ATPase/synthase is geared to the synthesis mode by conformational rearrangement of the {varepsilon} subunit in response to proton motive force and ADP/ATP balance. J. Biol. Chem. 278:46840-46846.[Abstract/Free Full Text]
  56. 29
  57. Tielens, A. G., and J. J. van Hellemond. 1998. Differences in energy metabolism between Trypanosomatidae. Parasitol. Today 14:265-271.[CrossRef][Medline]
  58. 30
  59. Ullu, E., A. Djikeng, H. Shi, and C. Tschudi. 2002. RNA interference: advances and questions. Phil. Trans. R. Soc. Lond. B 357:65-70.[Abstract/Free Full Text]
  60. 31
  61. van den Hoff, M. J. B., A. F. M. Moorman, and W. H. Lamers. 1992. Electroporation in "intracellular" buffer increases cell survival. Nucleic Acids Res. 20:2902.[Free Full Text]
  62. 32
  63. Vassella, E., K. Straesser, and M. Boshart. 1997. A mitochondrion-specific dye for multicolour fluorescent imaging of Trypanosoma brucei. Mol. Biochem. Parasitol. 90:381-385.[CrossRef][Medline]
  64. 33
  65. Vercesi, A. E., R. Docampo, and S. N. Moreno. 1992. Energization-dependent Ca2+ accumulation in Trypanosoma brucei bloodstream and procyclic trypomastigotes mitochondria. Mol. Biochem. Parasitol. 56:251-257.[CrossRef][Medline]
  66. 34
  67. Vickerman, K. 1985. Developmental cycles and biology of pathogenic trypanosomes. Br. Med. Bull. 41:105-114.[Abstract/Free Full Text]
  68. 35
  69. Vinogradov, A. D. 2000. Steady-state and pre-steady-state kinetics of the mitochondrial F1F0ATPase: is ATP synthase a reversible molecular machine. J. Exp. Biol. 203:41-49.[Abstract]
  70. 36
  71. Wang, Z., M. E. Drew, J. C. Morris, and P. T. Englund. 2002. Asymmetrical division of the kinetoplast DNA network of the trypanosome. EMBO J. 21:4998-5005.[CrossRef][Medline]
  72. 37
  73. Wang, Z., J. C. Morris, M. E. Drew, and P. T. Englund. 2000. Inhibition of Trypanosoma brucei gene expression by RNA interference using an integratable vector with opposing T7 promoters. J. Biol. Chem. 275:40174-40179.[Abstract/Free Full Text]
  74. 38
  75. Weber, J., and A. E. Senior. 2000. ATP synthase: what we know about ATP hydrolysis and what we do not know about ATP synthesis. Biochim. Biophys. Acta 1458:300-309.[Medline]
  76. 39
  77. Weber, J., and A. E. Senior. 2003. ATP synthesis driven by proton transport in F1F0-ATP synthase. FEBS Lett. 545:61-70.[CrossRef][Medline]
  78. 40
  79. Wilkinson, S. R., D. Horn, S. R. Prathalingam, and J. M. Kelly. 2003. RNA interference identifies two hydroperoxide metabolizing enzymes that are essential to the bloodstream form of the African trypanosome. J. Biol. Chem. 278:31640-31646.[Abstract/Free Full Text]
  80. 41
  81. Williams, N. 1994. The mitochondrial ATP synthase of Trypanosoma brucei: structure and regulation. J. Bioenerg. Biomembr. 26:173-178.[CrossRef][Medline]
  82. 42
  83. Williams, N., S. Y. Choi, W. T. Ruyechan, and P. H. Frank. 1991. The mitochondrial ATP synthase of Trypanosoma brucei: developmental regulation through the life cycle. Arch. Biochem. Biophys. 288:509-515.[CrossRef][Medline]
  84. 43
  85. Williams, N., and P. H. Frank. 1990. The mitochondrial ATP synthase of Trypanosoma brucei: isolation and characterization of the intact F1 moiety. Mol. Biochem. Parasitol. 43:125-132.[CrossRef][Medline]
  86. 44
  87. Zhang, J., and N. Williams. 1997. Purification, cloning, and expression of two closely related Trypanosoma brucei nucleic acid binding proteins. Mol. Biochem. Parasitol. 87:145-158.[CrossRef][Medline]


Eukaryotic Cell, January 2006, p. 45-53, Vol. 5, No. 1
1535-9778/06/$08.00+0     doi:10.1128/EC.5.1.45-53.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Fisk, J. C., Presnyak, V., Ammerman, M. L., Read, L. K. (2009). Distinct and Overlapping Functions of MRP1/2 and RBP16 in Mitochondrial RNA Metabolism. Mol. Cell. Biol. 29: 5214-5225 [Abstract] [Full Text]  
  • Singha, U. K., Sharma, S., Chaudhuri, M. (2009). Downregulation of Mitochondrial Porin Inhibits Cell Growth and Alters Respiratory Phenotype in Trypanosoma brucei. Eukaryot Cell 8: 1418-1428 [Abstract] [Full Text]  
  • Nakamura, K., Nemani, V. M., Wallender, E. K., Kaehlcke, K., Ott, M., Edwards, R. H. (2008). Optical Reporters for the Conformation of {alpha}-Synuclein Reveal a Specific Interaction with Mitochondria. J. Neurosci. 28: 12305-12317 [Abstract] [Full Text]  
  • Coustou, V., Biran, M., Breton, M., Guegan, F., Riviere, L., Plazolles, N., Nolan, D., Barrett, M. P., Franconi, J.-M., Bringaud, F. (2008). Glucose-induced Remodeling of Intermediary and Energy Metabolism in Procyclic Trypanosoma brucei. J. Biol. Chem. 283: 16342-16354 [Abstract] [Full Text]  
  • Lanteri, C. A., Tidwell, R. R., Meshnick, S. R. (2008). The Mitochondrion Is a Site of Trypanocidal Action of the Aromatic Diamidine DB75 in Bloodstream Forms of Trypanosoma brucei. Antimicrob. Agents Chemother. 52: 875-882 [Abstract] [Full Text]  
  • Lai, D.-H., Hashimi, H., Lun, Z.-R., Ayala, F. J., Lukes, J. (2008). Adaptations of Trypanosoma brucei to gradual loss of kinetoplast DNA: Trypanosoma equiperdum and Trypanosoma evansi are petite mutants of T. brucei. Proc. Natl. Acad. Sci. USA 105: 1999-2004 [Abstract] [Full Text]  
  • Stephens, J. L., Lee, S. H., Paul, K. S., Englund, P. T. (2007). Mitochondrial Fatty Acid Synthesis in Trypanosoma brucei. J. Biol. Chem. 282: 4427-4436 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brown, S. V.
Right arrow Articles by Williams, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brown, S. V.
Right arrow Articles by Williams, N.