This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shapiro, J.
Right arrow Articles by Johnson, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shapiro, J.
Right arrow Articles by Johnson, K. A.

 Previous Article  |  Next Article 

Eukaryotic Cell, September 2005, p. 1591-1594, Vol. 4, No. 9
1535-9778/05/$08.00+0     doi:10.1128/EC.4.9.1591-1594.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Characterization of a Molecular Chaperone Present in the Eukaryotic Flagellum

Jessica Shapiro,{dagger} Jessica Ingram,{ddagger} and Karl A. Johnson*

Department of Biology, Haverford College, Haverford, Pennsylvania 19041

Received 8 April 2005/ Accepted 22 June 2005


arrow
ABSTRACT
 
Chlamydomonas flagella contain a molecular chaperone now identified as HSP70A, a major cytoplasmic isoform. HSP70A synthesis is upregulated by deflagellation, and its distribution in the flagellum overlaps with the IFT kinesin-II motor FLA10. HSP70A may chaperone flagellar proteins during transport, participating in the assembly and maintenance of the flagellum.


arrow
TEXT
 
The multiple compartments of the eukaryotic cell contain Hsp70 molecular chaperones that participate in the folding, targeting, assembly, and maintenance of the proteome (2, 9, 27). We previously found a putative flagellar Hsp70 in the green alga Chlamydomonas reinhardtii (1). Eukaryotic flagella are highly specialized, motile structures thought to contain only proteins directly involved in their assembly and function (6, 10, 17, 21). We identified this flagellar protein as Chlamydomonas HSP70A, a cytoplasmic chaperone, and examined its expression and localization within the context of the flagellum.

Molecular identification of flagellar Hsp70. The flagellar protein recognized by the pan-Hsp70 monoclonal antibody MA3-006 (Affinity BioReagents, Denver, CO) (1) was isolated from the matrix fraction of Chlamydomonas flagella (strain CC-1690; Chlamydomonas Genetics Center, Durham, NC) (26) by binding to ATP-agarose (Sigma, St. Louis, MO) (25), followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Fig. 1). Following tryptic digestion on a blot, matrix-assisted laser desorption-time of flight mass spectrometry (Keck Protein Chemistry Laboratory, University of Massachusetts Medical School, Worcester, MA) uniquely identified the protein as HSP70A (13, 24), matching 9 of 11 peptide masses covering 26.2% of the protein. HSP70A is one of seven Chlamydomonas Hsp70 family members (20) and bears the carboxy-terminal EEVD invariably conserved in cytoplasmic isoforms (8).



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 1. Biochemical purification of flagellar Hsp70. Chlamydomonas flagellar matrix extracts (lanes 1) were incubated with ATP-agarose beads, and the depleted extract (lanes 2) was separated from bound material (lanes 3) by centrifugation; lanes 4 contain a 10-fold-heavier loading of the contents of lanes 3. Panel A shows a silver-stained sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel loaded with equivalent fractions. Panel B shows an immunoblot of a gel identical to that used in panel A, probed with the monoclonal antibody MA3-006 originally used to identify the flagellar chaperone (1).

Regulation of HSP70A during flagellar assembly. Genes encoding flagellar proteins typically are transcriptionally upregulated during organellar assembly (6, 10, 17, 21). Total RNAsamples were isolated (QIAGEN, Valencia, CA) from cells (CC-3941) bearing full-length flagella and cells with half-length, actively regenerating flagella (30 min after pH shock deflagellation). Reverse transcription (RT)-PCR (Titan; Roche, Indianapolis, IN) was performed using mRNA-specific primers (MWG, High Point, NC; for alpha-tubulin, GCCGGTATCCAGGTGGGCAATG and GATCAGCTGCTCGGGGTGGAAC; for beta-tubulin, CTGGAGCGCATCAACGTGTACTTC and CCTGGAAGCCCTGCAGGCAG; for HSP70A, CATACGCGACTATTCTGCCGCTATAC and GGGTTCATAGCGACCTGGTTCTTG; for CRY1, CCCAAGGAGGTGGTGAGCCTG and GATGCCCAGCTCCTTGCACTTC; for CBLP, GGCCAGTTCTGCCTGACTG and CGACCACGATCTGGCGGTTGTC; and for HSP70B, GTGCTGAGAAGGTCGTGGGTATC and CCTCAATCACCCGGTAAGGCAC) in five-cycle increments. Products were sized on agarose gels and documented using an AlphaImager (AlphaInnotech, San Leandro, CA). HSP70A mRNA levels increased strongly during flagellar assembly along with tubulin mRNAs (Fig. 2) (22), while constitutively expressed messages for ribosomal protein S14 (14) and G protein beta subunit-like protein (18) remained unchanged. However, HSP70B mRNAs, encoding a chloroplast-localized isoform (5), were also elevated, suggesting that HSP70A upregulation may be part of a whole-cell stress response to deflagellation (22).



View larger version (108K):
[in this window]
[in a new window]
 
FIG. 2. RT-PCR analysis of HSP70A upregulation during flagellar assembly. Total RNA samples isolated from cells bearing full-length flagella (not deflagellated [NDF]) and cells regenerating flagella 30 min after pH shock deflagellation (DF) were subjected to RT-PCR using primers specific for mRNAs encoding (A) alpha tubulin, (B) beta tubulin, (C) cytoplasmic HSP70A, (D) the ribosomal protein S14, (E) a G protein beta subunit-like protein, or (F) chloroplast HSP70B. RT-PCR products were examined at five-cycle intervals, and examples were chosen to accurately compare the kinetics of product formation and, thus, initial mRNA abundances.

Localization of HSP70A. To study the cellular distribution of HSP70A, affinity-purified antipeptide antibodies were generated (Research Genetics, Huntsville, AL) to its unique carboxy terminus (PSGGSGAGPKIEEVD) (13, 24). These antibodies reacted specifically with a 70-kDa protein on immunoblots of total cell protein (TP) and purified flagellar protein (FL) that was also recognized by MA3-006 (1) (Fig. 3). Based upon a yield of 10 µg of flagellar protein per 107 cells (26), flagella contain approximately 10% of the cellular HSP70A pool. In contrast, antibodies to chloroplast-localized HSP70B show a strong reaction to a cell body protein not present in flagella. Recent global characterization of the flagellar proteome by mass spectrometry also identified HSP70A as a Chlamydomonas flagellar protein (G. Pazour, N. Agrin, and G. B. Witman, unpublished data; cited at http://genome.jgi-psf.org/cgi-bin/dispGeneModel?db=chlre2&tid=155023).



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 3. HSP70A is an abundant cytoplasmic protein also present in flagella. Immunoblot analysis of TP (106 cells) and total FL (10 µg) from wild-type cells (WT) and a transformant strain expressing HSP70A::HA (HA) is shown. Panel A is a Coomassie blue-stained gel showing total protein loading. The remaining panels are immunoblots of replicate gels probed with (B) affinity-purified anti-HSP70A carboxy-terminal peptide polyclonal antibodies, (C) the anti-HA epitope monoclonal antibody 12CA5, (D) the broadly cross-reactive pan-Hsp70 monoclonal antibody MA3-006, and (E) an anti-HSP70B carboxy-terminal peptide antiserum (Research Genetics, Huntsville, AL).

In addition, an epitope-tagged HSP70A allele was constructed. Complementary short oligonucleotides (TCGACTACCCCTACGACGTCCCCGACTACGCCGGCGAGGAGGTGGACTAA and TCGATTAGTCCACCTCCTCGCCGGCGTAGTCGGGGACGTCGTAGGGGTAG) encoding a hemagglutinin (HA) epitope (7) and retaining the highly conserved terminal sequence EEVD (8) were synthesized, annealed, and cloned into a SalI site in the HSP70A gene (13, 24) to append the carboxy-terminal sequence YPYDVPDYAGEEVD. This construct was cotransformed into Chlamydomonas cells (CC-2929) (14) with a selectable marker. HSP70A::HA was detected in roughly 10% of transformants by using the anti-HA monoclonal antibody 12CA5 (Roche). Several clones with stable, high levels of expression were characterized. Ectopic expression of HSP70::HA did not have gross effects on either growth or motility. On immunoblots using MA3-006 (which binds an internal sequence unchanged by epitope addition), HSP70A and HSP70A::HA were present at similar levels in transformant total cell protein and flagellar protein samples (Fig. 3). Note that HSP70A and HSP70A::HA can be distinguished immunologically using antipeptide and antiepitope antibodies, respectively, because of the carboxy-terminal placement of the epitope.

Immunofluorescent localization (11) of HSP70A confirmed that the chaperone was abundant in cell body cytoplasm and present in flagella (Fig. 4). Within flagella, wild-type HSP70A was distributed in a discontinuous, punctate fashion and concentrated in flagellar tips (Fig. 4). Previous localizations with MA3-006 (1) showed primarily tip labeling; the difference may be due to improvements in imaging technology (push-processed film versus a cooled charge-coupled-device camera) and antibody affinity. HSP70A::HA was distributed along the flagellum like the wild-type protein, although accumulation in the flagellar tip was less evident. Interestingly, in HSP70A::HA, the epitope coincides with a cochaperone binding site (8), implicating regulatory interaction and substrate release in its accumulation in the tip.



View larger version (77K):
[in this window]
[in a new window]
 
FIG. 4. HSP70A is present in both cell bodies and flagella. Immunofluorescent localizations of (A and B) HSP70A in wild-type cells using affinity-purified anti-HSP70A carboxy-terminal peptide rabbit polyclonal antibodies and (C and D) epitope-tagged HSP70A in transformant cells using the anti-HA epitope mouse monoclonal antibody 12CA5 are shown. Both stained the cytoplasm of cell bodies brightly; a discontinuous, punctate signal was also seen along the lengths of the pair of flagella extending from each cell body. (E) Localizations with the antitubulin monoclonal antibody TUB 1A2 (Sigma, St. Louis, MO) showed smooth labeling along flagella, and (F) control experiments from which primary antibodies were omitted showed essentially no labeling. Bar = 10 µm.

Colocalization of HSP70A and the IFT kinesin-II FLA10. The flagellar distribution of HSP70A is very similar to that of the components of the intraflagellar transport (IFT) system (3, 17, 19) responsible for shuttling unassembled axonemal proteins from the cell body to the flagellar tips. Immunofluorescent colocalization (11) of HSP70A (using the rabbit antipeptide antibodies; red channel) and the anterograde IFT kinesin-II FLA10 (using mouse monoclonal antibody K2.4 [Berkeley Antibody Co, Richmond, CA]; green channel) (4, 12, 16) showed similar overlapping but nonidentical distributions (Fig. 5B and C). The overwhelming majority (>90%) of FLA10 concentrations were associated with HSP70A. HSP70A concentrations were rarely observed without an associated FLA10 signal (shown most clearly in the blue colocalization analysis), although the stoichiometry of labeling (indicated by yellow hues in red-green overlays) varied considerably (Fig. 5D and E). This variation suggests that HSP70A is not an integral part of the IFT machinery but is instead carried by IFT as cargo. Despite considerable effort, we have been unable to identify specific HSP70A interactors by cofractionation, native gel electrophoresis, immunoprecipitation, cross-linking, or immunoelectron microscopy approaches, although flagellar Hsp70 was reported to copurify with IFT complexes on sucrose gradients in one study (15; see also reference 4). Within the flagellum, HSP70A may be interacting with many different molecular targets (redistributing as conditions change), which is consistent with the generalist strategy of Hsp70 involvement in protein folding, transport, and repair observed in other systems (2, 9, 27). Hsp70 proteins have also been implicated directly in cargo release from kinesin-driven anterograde fast axonal transport (23), suggesting that HSP70A may assist with both folding and delivery of flagellar proteins. Our molecular identification of this molecular chaperone opens the door to further investigation of its roles in flagellar assembly/disassembly and maintenance.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 5. Immunofluorescent colocalizations of HSP70A and the kinesin-II motor FLA10. Panel A is an immunoblot of TP (106 cell equivalents) and total FL (10 µg) probed with the antikinesin-II monoclonal antibody K2.4 that recognizes the 90-kDa Chlamydomonas IFT kinesin-II Fla10 (4, 12, 16). Panels B and C show cells double labeled with affinity-purified anti-HSP70A carboxy-terminal peptide rabbit polyclonal antibodies (red channel) and the anti-FLA10 mouse monoclonal antibody K2.4 (green channel). Green and red signal overlap is perceived as yellow (the exact hue determined by the green/red ratio). Panels D and E show enlarged views of the boxed areas from panels B and C in which the red, green, and red-green overlay channels are separated for clarity. In addition, colocalization analysis (performed using Image J [http://rsb.info.nih.gov/ij/] and the RG2B plug-in, in which a saturated blue pixel is generated wherever nonzero red and green pixel values coincide) is shown as a measure of coincidence not dependent upon stoichiometry. Bar = 10 µm (B and C) and 20 µm (D and E).


arrow
ACKNOWLEDGMENTS
 
We thank Christoph Beck, Paul Lefebvre, and Elizabeth Harris for sharing Chlamydomonas strains and plasmids, John Leszyk for assistance with the matrix-assisted laser desorption-time of flight analysis, Marina del Rios for help with Chlamydomonas transformation, Geraldine Sheir-Neiss for technical assistance, John Butler for laboratory support, several reviewers for their constructive comments, and Wayne Rasband and Christopher Philip Mauer for making available the ImageJ program and RG2B colocalization plug-in, respectively.

This work was supported by a fellowship (to J.S.) from the Howard Hughes Institute for Undergraduate Biological Sciences Medical Research Program (to Haverford College), the Haverford College Provost's Office, and NSF MCB-9506236 and MCB-9982733 (to K.A.J.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biology, Haverford College, 370 Lancaster Ave., Haverford, PA 19041. Phone: (610) 896-1306. Fax: (610) 896-4963. E-mail: kjohnson{at}haverford.edu. Back

{dagger} Present address: Stanford University, Department of Genetics, Stanford, CA 94305. Back

{ddagger} Present address: New England Biolabs, Inc., Beverly, MA 01915. Back


arrow
REFERENCES
 
    1
  1. Bloch, M. A., and K. A. Johnson. 1995. Identification of a molecular chaperone in the eukaryotic flagellum and its localization to the site of microtubule assembly. J. Cell Sci. 108:3541-3545.[Abstract]
  2. 2
  3. Bukau, B., and A. L. Horwich. 1998. The Hsp70 and Hsp60 chaperone machines. Cell 92:351-366.[CrossRef][Medline]
  4. 3
  5. Cole, D. G. 2003. The intraflagellar transport machinery of Chlamydomonas reinhardtii. Traffic 4:435-442.[CrossRef][Medline]
  6. 4
  7. Cole, D. G., D. R. Diener, A. L. Himelblau, P. L. Beech, J. C. Fuster, and J. L. Rosenbaum. 1998. Chlamydomonas kinesin-II-dependent intraflagellar transport (IFT): IFT particles contain proteins required for ciliary assembly in Caenorhabditis elegans sensory neurons. J. Cell Biol. 141:993-1008.[Abstract/Free Full Text]
  8. 5
  9. Drzymalla, C., M. Schroda, and C. F. Beck. 1996. Light-inducible gene HSP70B encodes a chloroplast-localized heat shock protein in Chlamydomonas reinhardtii. Plant Mol. Biol. 31:1185-1194.[CrossRef][Medline]
  10. 6
  11. Dutcher, S. K. 1995. Flagellar assembly in two hundred and fifty easy-to-follow steps. Trends Genet. 11:398-404.[CrossRef][Medline]
  12. 7
  13. Field, J., J.-I. Nikawa, D. Broek, B. MacDonald, L. Rodgers, I. A. Wilson, R. A. Lerner, and M. Wigler. 1988. Purification of a RAS-responsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8:2159-2165.[Abstract/Free Full Text]
  14. 8
  15. Freeman, B. C., M. P. Myers, R. Schumacher, and R. I. Morimoto. 1995. Identification of a regulatory motif in Hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J. 14:2281-2292.[Medline]
  16. 9
  17. Frydman, J. 2001. Folding of newly translated proteins in vivo: the role of molecular chaperones. Annu. Rev. Biochem. 70:603-647.[CrossRef][Medline]
  18. 10
  19. Johnson, K. 1995. Keeping the beat: form meets function in the Chlamydomonas flagellum. Bioessays 17:847-855.[CrossRef]
  20. 11
  21. Johnson, K. A. 1998. The axonemal microtubules of the Chlamydomonas flagellum differ in tubulin isoform content. J. Cell Sci. 111:313-320.[Abstract]
  22. 12
  23. Kozminski, K. G., P. L. Beech, and J. L. Rosenbaum. 1995. The Chlamydomonas kinesin-like protein FLA10 is involved in motility associated with the flagellar membrane. J. Cell Biol. 131:1517-1527.[Abstract/Free Full Text]
  24. 13
  25. Muller, F. W., G. L. Igloi, and C. F. Beck. 1992. Structure of a gene encoding heat-shock protein HSP70 from the unicellular alga Chlamydomonas reinhardtii. Gene 111:165-173.[CrossRef][Medline]
  26. 14
  27. Nelson, J. A. E., P. B. Savereide, and P. A. Lefebvre. 1994. The CRY1 gene in Chlamydomonas reinhardtii: structure and use as a dominant selectable marker for nuclear transformation. Mol. Cell. Biol. 14:4011-4019.[Abstract/Free Full Text]
  28. 15
  29. Piperno, G., and K. Mead. 1997. Transport of a novel complex in the cytoplasmic matrix of Chlamydomonas flagella. Proc. Natl. Acad. Sci. USA 94:4457-4462.[Abstract/Free Full Text]
  30. 16
  31. Porter, M. E., R. Bower, J. A. Knott, P. Byrd, and W. Dentler. 1999. Cytoplasmic dynein heavy chain 1b is required for flagellar assembly in Chlamydomonas. Mol. Biol. Cell 10:693-712.[Abstract/Free Full Text]
  32. 17
  33. Rosenbaum, J. L., and G. B. Witman. 2002. Intraflagellar transport. Nat. Rev. Mol. Cell Biol. 3:813-825.[CrossRef][Medline]
  34. 18
  35. Schloss, J. A. 1990. A Chlamydomonas gene encodes a G protein beta subunit-like polypeptide. Mol. Gen. Genet. 221:443-452.[Medline]
  36. 19
  37. Scholey, J. M. 2003. Intraflagellar transport. Annu. Rev. Cell Dev. Biol. 19:423-443.[CrossRef][Medline]
  38. 20
  39. Schroda, M. 2004. The Chlamydomonas genome reveals its secrets: chaperone genes and the potential roles of their gene products in the chloroplast. Photosynth. Res. 82:221-240.
  40. 21
  41. Silflow, C. D., and P. A. Lefebvre. 2001. Assembly and motility of eukaryotic cilia and flagella. Lessons from Chlamydomonas reinhardtii. Plant Physiol. 127:1500-1507.[Free Full Text]
  42. 22
  43. Stolc, V., M. P. Samanta, W. Tongprasit, and W. F. Marshall. 2005. Genome-wide transcriptional analysis of flagellar regeneration in Chlamydomonas reinhardtii identifies orthologs of ciliary disease genes. Proc. Natl. Acad. Sci. USA 102:3703-3707.[Abstract/Free Full Text]
  44. 23
  45. Tsai, M. Y., G. Morfini, G. Szebenyi, and S. T. Brady. 2000. Release of kinesin from vesicles by hsc70 and regulation of fast axonal transport. Mol. Biol. Cell 11:2161-2173.[Abstract/Free Full Text]
  46. 24
  47. von Gromoff, E. D., U. Treier, and C. F. Beck. 1989. Three light-inducible heat shock genes of Chlamydomonas reinhardtii. Mol. Cell. Biol. 9:3911-3918.[Abstract/Free Full Text]
  48. 25
  49. Welch, W. J., and J. R. Feramisco. 1985. Rapid purification of mammalian 70,000-dalton stress proteins: affinity of the proteins for nucleotides. Mol. Cell. Biol. 5:1229-1237.[Abstract/Free Full Text]
  50. 26
  51. Witman, G. B. 1986. Isolation of Chlamydomonas flagella and flagellar axonemes. Methods Enzymol. 134:280-290.[Medline]
  52. 27
  53. Young, J. C., J. M. Barral, and F. Ulrich Hartl. 2003. More than folding: localized functions of cytosolic chaperones. Trends Biochem. Sci. 28:541-547.[CrossRef][Medline]


Eukaryotic Cell, September 2005, p. 1591-1594, Vol. 4, No. 9
1535-9778/05/$08.00+0     doi:10.1128/EC.4.9.1591-1594.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shapiro, J.
Right arrow Articles by Johnson, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shapiro, J.
Right arrow Articles by Johnson, K. A.