Eukaryotic Cell, August 2005, p. 1493-1502, Vol. 4, No. 8
1535-9778/05/$08.00+0 doi:10.1128/EC.4.8.1493-1502.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Clarissa J. Nobile,1,2
Vincent M. Bruno,1,3 and
Aaron P. Mitchell1*
Department of Microbiology, Columbia University, New York, New York 10032,1 Biological Sciences Program, Department of Biological Sciences, Columbia University, New York, New York 10027,2 Program in Cellular, Molecular, and Biophysical Studies, Columbia University, New York, New York 100323
Received 4 June 2004/ Accepted 17 June 2005
|
|
|---|
|
|
|---|
The human fungal pathogen Candida albicans can populate and penetrate surfaces. The ability to penetrate a surface has long been appreciated as a key virulence trait (14, 38), because the commensal C. albicans cells of mucosal and intestinal surfaces can serve as the source for invasive infection (45, 53). However, the ability of C. albicans to populate a surface and produce a biofilm is also a virulence trait (9, 29). Medical implants such as vascular catheters are significant risk factors for C. albicans infection, and biofilms have been observed on device surfaces after removal from patients (29). Indeed, one form of Candida infection, called thrush or oropharyngeal candidiasis, is a dense fungal mat adhering to the oral mucosal surface. Therefore, thrush may be considered an infecting biofilm. Thus, the ability of C. albicans to form a biofilm has a profound impact on its ability to cause disease.
Biofilms of C. albicans have been characterized in considerable detail. They are composed of a mixture of cell types, including yeast, pseudohyphal, and hyphal cells, and include an extracellular matrix comprising polysaccharide and protein (9, 31). Like bacterial biofilms, C. albicans biofilms are much more resistant than free-living planktonic cells to many antimicrobial drugs (18, 42, 43). This biofilm-specific cell property provides a very clear link to virulence and has prompted much recent interest in C. albicans biofilm structure, physiology, and regulation.
C. albicans biofilm development occurs in three phases, as observed with in vitro models (4, 9). During the early phase, yeast cells adhere to the surface of the support and begin to divide and form a layer of microcolonies. During the intermediate phase, continued yeast cell growth is accompanied by extracellular material production and initial differentiation to produce elongated pseudohyphae and hyphae. Finally, a maturation phase occurs, in which the amount of extracellular material increases, and the network of pseudohyphae and hyphae embedded in this matrix grows in parallel to assemble a biofilm of at least 200 µm in depth. The precise kinetics and sequence of events depend upon the substrate and biofilm growth medium (4, 17, 42), as well as the C. albicans strain (22, 33, 47).
A few genes that govern biofilm formation have been characterized. Ramage et al. have shown that the hyphal regulatory gene EFG1 is required for normal biofilm growth (1, 44). Reduced hypha production by the efg1/efg1 mutant and the more extreme efg1/efg1 cph1/cph1 mutant (34, 36) certainly contributes to the biofilm defect, but the mutants also appeared to adhere poorly to the substrate (1, 44). Similarly, the presence of the quorum-sensing molecule farnesol, an inhibitor of hypha formation, inhibits biofilm formation (30). The general amino acid control regulatory gene GCN4 is also required for full biofilm biomass production, though the gcn4/gcn4 mutant does not display a qualitative developmental defect (11). GCN4 is required for hypha formation under some growth conditions (51) but apparently not in the context of a biofilm. Finally, a contact-activated protein kinase, Mkc1p, is required for biofilm development (32), thus suggesting that C. albicans may respond uniquely to surface contact during biofilm formation.
The understanding of bacterial biofilms has advanced enormously in recent years (6, 16, 41). A substantial contribution to this understanding has come from the identification and analysis of biofilm-defective mutants. Such studies have defined roles for adherence, motility, and extracellular matrix materials in bacterial biofilm development (6, 41). We describe here the results of a screen for C. albicans mutants defective in biofilm formation. Genetic characterization of random mutants has been a challenge with this organism because it is an asexual diploid. However, the C. albicans genomic sequence has provided a platform for molecular gene disruption technologies that cause partial or complete gene function defects (2). Here we used a collection of insertion mutations in 197 different open reading frames (ORF) (3, 8, 40) to identify biofilm-defective mutants. Our results permit the genetic definition of two different blocks in biofilm development, which (as we discuss) might correspond to two temporal stages in the development of wild-type biofilms. Analysis of mixed biofilms comprising both wild-type and mutant cells indicates that the mutants described here have defects in hypha formation in the context of a biofilm.
|
|
|---|
imm434/ura3::
imm434 arg4::hisG/arg4::hisG his1::hisG/his1::hisG [54]). The His homozygous insertion mutant strains, created in this lab by random transposon mutagenesis with the UAU1 cassette, have been described previously (8). We used two different reference strains (Table 1) for comparison to mutants. DAY286 is an Arg+ Ura+ His derivative of strain BWP17 and was used for comparison to Arg+ Ura+ His mutant strains. DAY185 is an Arg+ Ura+ His+ derivative of strain BWP17 and was used for comparison to Arg+ Ura+ His+ mutant strains. |
View this table: [in a new window] |
TABLE 1. C. albicans strains
|
These media followed standard recipes (7). Biofilms were cultured in SD medium plus 50 mM glucose (50 mM dextrose, 6.7% yeast nitrogen base plus ammonium sulfate, and the necessary auxotrophic supplements [17]) or, when noted, in Spider medium (1% Difco nutrient broth, 1% mannitol, 0.2% dibasic potassium phosphate, and auxotrophic supplements if necessary [35]).
Biofilm growth.
Squares of silicone (1.5 cm by 1.5 cm) were cut from silicone sheets (Cardiovascular Instrument Corp.), washed in water, and autoclaved. Prior to inoculation, the squares were incubated with bovine serum (B-9433; Sigma) overnight and then washed once in phosphate-buffered saline (PBS) immediately before inoculation. Strains were grown overnight in yeast extract-peptone-dextrose at 37°C and diluted in SD medium plus 50 mM glucose to an optical density at 600 nm (OD600) of 1.0 or in Spider medium to an OD600 of 0.5. Inoculation was accomplished by adding 2 ml of this cell suspension to a silicone square in a 12-well plate and incubating at 37°C for 90 min with gentle agitation (
150 rpm). After this adherence step, each square was washed with PBS and 2 ml of fresh medium was added. Biofilms were grown for 60 h at 37°C with gentle agitation.
For the mutant screen, two independent isolates of each insertion mutant were tested. For biomass dry mass determinations, each biofilm was removed from the substrate by vortexing the silicone square in PBS and then filtering the cell suspension on preweighed filter paper. The filtrate and filter were dried at 75°C overnight and then weighed. The average dry biomass was calculated from six independent samples.
Reconstitution of wild-type alleles. The ORF affected by each insertion was identified through sequence determination and BLASTN searches (8) to the Candida albicans genome database (http://www-sequence.stanford.edu/group/candida/). Insertion sites were localized to codon 572 out of 774 for nup85::Tn7, codon 81 out of 686 for mds3::Tn7, codon 770 out of 1,469 for kem1::Tn7, and codon 365 out of 720 for suv3::Tn7.
The construction of reconstituted strains for SUV3 (orf19.4519) and MDS3 (orf19.6759) has been described previously (8, 40). Reconstituting the NUP85 (orf19.5887) and KEM1 (orf19.4969) plasmids was done as follows. PCR was used to produce a fragment for NUP85 from approximately 1,000 bp upstream of the ATG to approximately 300 bp downstream of the stop codon of the NUP85 ORF. Because of the size of the KEM1 ORF, the strategy used was to integrate the complementing plasmid at the KEM1 locus by using a PCR fragment of a part of the KEM1 ORF and thus reconstitute a functional KEM1 allele. The PCR product for KEM1 begins 600 bp upstream of the site of integration (BstEII restriction site) and ends 250 bp downstream of the stop codon. NUP85 and KEM1 PCR fragments were inserted into the pGEMT-Easy vector (Promega), which contains NotI sites flanking the insertion. The inserts were released through NotI digestion and ligated into NotI-digested dephosphorylated pDDB78, a HIS1 vector (49), to generate plasmids pMLR2 (containing the NUP85 insert) and pMLR8 (containing the KEM1 insert). Strain MLR12 was constructed by transforming GKO814, the nup85/nup85 homozygous insertion mutant, with the NruI-digested plasmid pMLR2 to histidine prototrophy. The unique NruI site in this plasmid lies in HIS1 sequences, and NruI digestion thus directs integration to the HIS1 locus. Strain MLR28 was constructed by transforming GKO798, the kem1/kem1 homozygous insertion mutant, with the BstEII-digested plasmid pMLR8 to histidine prototrophy, directing the integration to the KEM1 locus.
GFP expression in mutant and reference strains. The green fluorescent protein (GFP) ORF and ADH1 terminator were amplified by PCR with pGFP-HIS1 as a template (12). Primers were designed to add EcoRI and SpeI restriction sites upstream and downstream, respectively, of the GFP gene. The fragment was ligated to EcoRI- and SpeI-digested vector pTEF1 to yield plasmid pMLR31. pTEF1 is a vector derived from plasmid pDDB78 (49) that harbors the strong C. albicans TEF1 promoter. A unique NruI site in this plasmid lies in HIS1 sequences, and NruI digestion thus directs integration to the HIS1 locus. Each His insertion mutant strain was transformed with NruI-digested pMLR31 to produce a strain that expresses GFP.
KEM1 deletion construction.
We created kem1
::ARG4 and kem1
::URA3 DNA fragments by PCR product-directed gene deletion (54), using 80-mer oligonucleotides kem1-3DR (5'-CAATAATGCATTACTGATAACTGTAAGAGAATGGAATATCTGACATATTCATATGGGTGGAATTGTGAGCGGATA) and kem1-5DR (5'-GAGATAGACATATATCATGGGTATGTTATTTGTTGTTAGATTCTGCTAAATCCCTAGTGTTTCCCAGTCACGACGTT). The kem1
/kem1
mutant, strain MLR74, was derived from strain BWP17 through two successive transformations and lacks the entire KEM1 ORF.
CSLM images. Confocal scanning laser microscopy (CSLM) images were obtained in the Columbia University Optical Microscopy Facility by using a Zeiss LSM510 NLO multiphoton confocal microscope. This system is composed of a Zeiss Axioskop 2 FS MOT upright microscope and a laser with multiphoton capability. Biofilms were stained in a 2-ml solution with either 0.2 mg/ml calcofluor white (fluorescent brightener 28, F3543; Sigma) or 50 to 100 µg/ml Alexa conjugate of concanavalin A (Alexa Fluor 594 nm, C-11253; Molecular Probes) for 1 h in the dark and observed without washing. The CSLM imaging uses two visible-light lasers: (i) a 25-mW argon laser exciting at 458 nm (for calcofluor) and 488 nm (for GFP) and (ii) a 1-mW helium-neon laser exciting at 543 nm (for Alexa-concanavalin A). We used a 40x water immersion objective. Image analysis and three-dimensional reconstruction were conducted using Zeiss LSM5 Image browser software. Depth views are translucent images with an artificial color gradient indicating cells closest to (blue) and furthest from (red) the silicone.
|
|
|---|
![]() View larger version (105K): [in a new window] |
FIG. 1. Screen for biofilm-defective mutants. Squares from silicone sheets were inoculated and incubated for 60 h at 37°C in SD medium plus 50 mM glucose in wells of a 12-well plate. The wells are shown for (A) a typical nondefective insertion mutant, (B) a kem1/kem1 insertion mutant, and (C) an uninoculated control. Growth of nonadherent cells was visualized after removal of the silicone squares for (D) the nondefective insertion mutant and (E) the kem1/kem1 insertion mutant.
|
|
View this table: [in a new window] |
TABLE 2. Growth of mutant strains in planktonic and biofilm states
|
The biofilm defect was quantified by measurement of the biomass dry weight retrieved from the silicone after 60 h of culture (Table 2). The mutants showed a dramatic reduction of biofilm mass. These findings argue that the mutants are capable of adherence to the silicone surface to produce a rudimentary biofilm but are defective in the production of a mature biofilm.
CSLM analysis. We used CSLM imaging in order to visualize the morphologies and structural organizations of the aberrant biofilms produced by the insertion mutants. The biofilms were grown under our standard conditions (in SD medium plus 50 mM glucose or in Spider medium, 37°, 60 h) and stained with calcofluor white concanavalin A, and reconstructed images were compared to those from the reference strain DAY185 and from reconstituted strains. The reference-strain biofilm (Fig. 2A and B) conforms to previously published biofilm descriptions (4, 17, 44). The basal layer, comprising primarily yeast cells, is poorly visible in these images because dye is excluded, presumably by the extracellular matrix and high cell density. (The basal yeast layer is discernible in image sections taken 4 µm and 10 µm above the silicone surface [Fig. 3A and B ]). Above the poorly stained layer is a meshwork of pseudohyphae and hyphae, with a few long hyphae extending 150 µm to 250 µm away from the silicone surface (Fig. 2B).
![]() View larger version (66K): [in a new window] |
FIG. 2. CSLM images of biofilms stained with calcofluor white. Biofilms were cultured for 60 h at 37°C in SD medium plus 50 mM glucose and visualized with a 40x water immersion objective. Image reconstructions were created to provide views from above (x-y plane), which permit visualization of cell types (A, C, E, G, J, L, N, P, and R), and from the side (z plane; B, D, F, H, K, M, O, Q, and S), which permit visualization of depth. All images are presented at the same scale, and the silicone surface is at the bottom of each side view. Strains include the His+ reference strain DAY185 (A and B), an suv3/suv3 insertion mutant (C and D) and its SUV3 reconstituted derivative (E and F), a nup85/nup85 insertion mutant (G and H) and its NUP85 reconstituted derivative (J and K), an mds3/mds3 insertion mutant (L and M) and its MDS3 reconstituted derivative (N and O), and a kem1/kem1 insertion mutant (P and Q) and its KEM1 reconstituted derivative (R and S). All of the insertion mutants were rendered His+ through transformation with plasmid pGEM-HIS1 (7, 54) before cultivation for microscopy.
|
![]() View larger version (93K): [in a new window] |
FIG. 3. CSLM images of biofilms stained with concanavalin A. Biofilms were cultured for 60 h at 37°C in Spider medium and visualized with a 40x water immersion objective, and images were reconstructed to yield views from above (x-y plane). (A and B) Single image slices of His+ reference strain DAY185, taken 4 µm (A) or 10 µm (B) above the silicone surface, showing yeast cells populating the basal layer of the biofilm. (C and D) Image reconstructions were created to provide transparent depth views, with pseudocolor used to indicate depth of field, for (C) reference strain DAY185 and (D) kem1 /kem1 strain MLR91. Note that pseudocolor depth scales are slightly different for panels C and D.
|
The kem1/kem1 mutant has a different phenotype than the other mutants, forming a 30-µm biofilm that includes yeast cells, pseudohyphae, and some rare hyphae (Fig. 2P and Q). Reconstitution of a KEM1 allele restored the ability to form a normal biofilm (Fig. 2R and S), and a kem1
/kem1
strain lacking the entire KEM1 ORF produced a 30-µm biofilm similar in appearance to the insertion mutant biofilm (data not shown). Therefore, a loss of Kem1p function causes a biofilm formation defect. The kem1/kem1 insertion and deletion mutant strains both produced thick (
200-µm) biofilms in Spider medium that were similar in depth to reference-strain biofilms. However, examination of a CSLM depth view revealed a meshwork comprising almost exclusively long hyphae for the reference strain and primarily pseudohyphae for the kem1
/kem1
strain (Fig. 3C and D, respectively).
We conclude that there are two distinct phenotypic classes of mutants. In addition, restoration of biofilm formation ability in the reconstituted strains argues that the insertion mutations, rather than secondary mutations in the strains, cause the phenotypic defect in biofilm formation.
Hypha formation by biofilm-defective mutants. Hyphae are a prominent feature of biofilms. The mutants we identified appear to be partially or fully defective in hypha formation in the context of the biofilm. We considered two models for the proximal cause of the mutants' biofilm defects. One model is that the mutants have a general defect in hypha formation, and their failure to produce large adherent populations of cells on the substrate reflects a specific contribution of hyphae to adherence in the biofilm. A second model is that the mutants are defective in adherence, and their failure to produce hyphae is a consequence of diminished biofilm depth, so that no hypha-inducing signal is produced in the biofilm.
The first model would gain support if the mutants were defective in hypha formation under a variety of growth conditions; the second model would gain support if the mutants formed normal hyphae under these conditions. We reported previously that mds3/mds3 mutants are defective in hypha formation in alkaline media, such as M199 medium, pH 8, and Spider medium (8). Indeed, all of the mutants failed to form abundant hyphae in M199 medium, pH 8 (Fig. 4) and Spider medium (data not shown). The suv3/suv3, nup85/nup85, and kem1/kem1 mutants also failed to form hyphae in N-acetylglucosamine medium, while the mds3/mds3 strain was competent to do so (data not shown). Reconstitution of wild-type alleles restored the ability to form hyphae (Fig. 4 and data not shown). All of the mutants formed hyphae in 5% serum (data not shown). These results indicate that these mutants are all defective in the formation of hyphae, at least under some conditions.
![]() View larger version (63K): [in a new window] |
FIG. 4. Hypha formation assays of biofilm-defective mutants. Each strain was incubated in M199 medium, pH 8, at 37°C for 12 h. Culture samples were visualized at a x400 magnification to visualize yeast cells and hyphae. All images are presented at the same magnification. Strains include the His+ reference strain DAY185 (A), an suv3/suv3 insertion mutant (B) and its SUV3 reconstituted derivative (C), a nup85/nup85 insertion mutant (D) and its NUP85 reconstituted derivative (E), an mds3/mds3 insertion mutant (F) and its MDS3 reconstituted derivative (G), and a kem1/kem1 insertion mutant (H) and its KEM1 reconstituted derivative (J). All of the insertion mutants were rendered His+ as described in the Fig. 2 legend.
|
![]() View larger version (49K): [in a new window] |
FIG. 5. Confocal images of mixed biofilms. Biofilms were cultured for 60 h at 37°C in SD medium plus 50 mM glucose and visualized with a 40x water immersion objective. The images are oriented with silicone at the bottom of each panel. Biofilms were created from a 1:1 inoculum of reference strain DAY185 with (A, B, and C) GFP-tagged suv3/suv3 strain MLR56 or (D, E, and F) GFP-tagged kem1/kem1 strain MLR57. Images show (A and D) GFP alone, (B and E) calcofluor alone, or (C and F) both GFP and calcofluor signals merged.
|
|
|
|---|
One conclusion from this study is that temporally defined stages of biofilm formation appear to be governed by distinct control mechanisms. The mutants blocked at the early biofilm stage have very similar phenotypes: their rudimentary biofilms have few filamentous cells, are about 10 µm thick, and do not exclude the dye from their basal layer. This observation suggests that matrix accumulation is dependent upon later events in biofilm development. The mutants are not simply growth arrested at the early temporal stage, because cells are released into the medium and planktonic growth rates are comparable to those of the reference strain. The suv3/suv3 mutant saturates planktonic cultures at a twofold-lower density than the reference strain, a mild growth defect that does not account for its 10-fold reduction in biofilm biomass. Thus, we believe that the common biofilm phenotypic defects in these mutants may have a single molecular or cell biological origin.
Our assay for biofilm-induced hypha formation helps to define the origin of the mutants' defects. Our observations indicate that all of the mutants we have identified are defective in producing hyphae in the context of a biofilm, as they are during planktonic growth in several inducing media. Direct observation has shown clearly that hyphae are a component of C. albicans biofilms (9, 31), and it has been shown that hypha-defective mutants are defective in producing a substantial biofilm (1, 44). The use of the efg1/efg1 cph1/cph1 mutant strain as a foundation for hyphal cause-effect arguments has been criticized because of uncertainty about the extent of its pleiotropy (28). Expression profiling experiments have lent credence to this argument, since the strain has altered expression of many cell wall protein genes along with several translation factors and transport modulators (39, 48). These gene expression changes may account for the altered adherence properties of efg1/efg1 cph1/cph1 yeast cells when grown under biofilm-inducing conditions (11). Our suv3/suv3, mds3/mds3, and nup85/nup85 mutants have more subtle hypha formation defects; for example, they produce hyphae in response to serum. Therefore, their biofilm-deficient phenotype strengthens the argument that mature biofilm formation depends upon hyphae, because these mutants clearly adhere to the silicone substrate and can populate the basal biofilm layer. Given that the mutants can be incorporated efficiently into mixed biofilms, we conclude that their adherence defect can be remedied by the presence of hyphae. Thus, we infer that the mutants' primary defect is in hypha formation and that the failure of mutant cells to adhere to their 10-µm biofilms is a consequence of the lack of hyphae.
If these mutants' biofilm defects arise from a hypha formation defect, it follows then that hyphae provide unique adherent surfaces that facilitate the formation of thick biofilms. This idea is in keeping with the increased expression of several ALS genes, which specify a surface adhesin family (19), in biofilms compared to planktonic cultures (4, 11, 15) and with the fact that several ALS genes are preferentially expressed during hyphal growth (10, 19, 20). The recent finding that adherence regulator Bcr1p is required for biofilm formation (40a) also supports this view.
The kem1/kem1 mutant is clearly blocked at a different stage of biofilm formation than are the other mutants described here, based on the mass and depth of its rudimentary biofilm. In addition, its biofilms include substantial numbers of pseudohyphal cells, distinguishable by their elongated morphology and growth in filamentous chains. The extent of its biofilm defect is dependent on the medium, a feature commonly found among bacterial biofilm mutants (16, 41). However, kem1/kem1 biofilms remain deficient in hyphae in both SD medium plus 50 mM glucose and Spider medium. The properties of the kem1/kem1 mutant raise a type of question that is commonly encountered in analyses of developmental pathways. The question is whether the kem1/kem1 terminal biofilm phenotype represents a true intermediate stage in normal biofilm development or whether it is an aberrant response to the primary mutant defect. The temporal analyses of Chandra et al. and of Hawser and Douglas did not reveal a stage in which only yeast cells and pseudohyphae were present (4, 17). In addition, we have not seen a distinct pseudohyphal layer in optical sections of biofilms. Thus, we believe that the preponderance of pseudohyphal cells produced by the kem1/kem1 mutant does not reflect an intermediate stage in biofilm formation.
This work was supported by Public Health Services grants R01 AI50931, T32 AI07161 (V.M.B.), and T32 DK007786 (C.J.N.), for which we are very grateful. The Optical Microscopy Facility was established by NIH Shared Instrumentation Grants S10 RR10506 and S10 RR13701 and by the Lieber Foundation. It is supported by NIH Grant P30 CA13696 as part of the Herbert Irving Comprehensive Cancer Center at Columbia University.
Present address: Laboratoire de Microbiologie et Génétique Moléculaire, INA P-G, UMR-INRA216, URA-CNRS1925, BP01, 78850 Thiverval-Grignon, France. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»