Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hirose, S. Articles by Maeda, Y. Search for Related Content PubMed PubMed Citation Articles by Hirose, S. Articles by Maeda, Y.

 Previous Article  |  Next Article 

Eukaryotic Cell, August 2005, p. 1477-1482, Vol. 4, No. 8
1535-9778/05/$08.00+0     doi:10.1128/EC.4.8.1477-1482.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

Shigenori Hirose,^1, Taira Mayanagi,^2, Catherine Pears,³ Aiko Amagai,² William F. Loomis,^1* and Yasuo Maeda²

Cell and Developmental Biology, Biological Sciences, University of California, San Diego, 9500 Gilman Drive, La Jolla California 92093-0368,¹ Department of Developmental Biology and Neurosciences, Graduate School of Life Sciences, Tohoku University, Aoba, Sendai 980-8578, Japan,² Biochemistry Department, Oxford University, South Parks Road, Oxford OX1 3QU, United Kingdom³

Received 6 April 2005/ Accepted 23 May 2005

Top Abstract Introduction Materials and Methods Results Discussion References

 
When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Differentiation of most cells in metazoan organisms occurs after exit from the cell cycle. This growth-to-differentiation transition (GDT) is controlled both spatially and temporally but is poorly understood. The social amoeba Dictyostelium discoideum also displays a GDT when the food source is depleted. The cells arrest in G₂ and stop replicating nuclear DNA (5, 18, 24). Within the next few hours they express a set of early genes such that the cells become able to signal each other chemotactically by extracellular cyclic AMP (cAMP) and to respond by aggregating into mounds containing up to 10⁵ cells (14, 22). As the cell density increases in a growing population and the bacterial food source starts to be depleted, the cells respond to a signal protein, prestarvation factor (PSF), that is continuously secreted and used to predict approaching starvation (7). Conditioned medium containing PSF can induce expression of discoidin I and several early developmental genes (23). Mutants lacking either Gdt1 or Gdt2 express discoidin I precociously, indicating that these putative protein kinases regulate GDT (6, 29). One of the responses to PSF is the expression of the protein kinase YakA, which inhibits the ability of the RNA binding protein PufA to modulate translation of various mRNAs, including that for the catalytic subunit of cAMP-dependent protein kinase, PKA (25, 26). The resulting increase in PKA activity leads to the expression of early developmental genes (14, 19). We have identified several genes (carA, dia1, dia2, and dia3) that are expressed soon after the initiation of differentiation (1, 4, 12, 13). carA encodes the major cAMP receptor (16). The products of dia1 and dia2 do not show significant similarity to proteins of known function. dia3 is a multicistronic mitochondrial gene cluster encoding several subunits of NAD dehydrogenase as well as two mitochondrial small ribosomal subunit proteins. Genetic studies have shown that dia1 plays an inhibitory role in early differentiation by reducing the expression of genes related to the cAMP signal relay system, and both dia2 and dia3 are required for proper expression of early genes, including those for the cAMP receptor CAR1 and the aggregation adenylyl cyclase ACA.

Based on studies with populations in which cell division was synchronized following a temperature shift from 11.5°C to 22°C, it has been proposed that Dictyostelium cells must reach a point late in G₂ (the PS point) before embarking on development (18). Cells which have reached this point and recognize that the environment is depleted in nutrients repress many growth phase genes and induce developmental genes. dia1 is found on chromosome 4 adjacent to impA, which encodes a protein with sequence similarity to the FKBP (FK506 binding protein) class of immunophilins that participate in protein folding (10). A 654-bp region separates the start codons of these genes, which are transcribed in opposite directions. This divergent arrangement allowed us to determine whether the intervening region carries separate or shared cis-acting sequences regulating their transcription.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell culture and developmental conditions. Dictyostelium discoideum Ax-2 was grown axenically in PS medium (1.0% special peptone [Oxoid], 0.7% yeast extract [Oxoid], 8.3 mM D-glucose, 0.8 mM KH₂PO₄, 1.4 mM Na₂HPO₄ · 12H₂O, 4.0 µg/ml vitamin B₁₂, and 8.0 µg/ml folic acid) with shaking at 22°C. Strains carrying reporter constructs were grown in PS medium containing 10 µg/ml of G418. Cells were harvested during the exponential phase of growth, washed twice in BSS (3), suspended at 10⁷ cells/ml in BSS, and shaken at 22°C.

Northern analyses. Total RNA was extracted with TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Samples containing 20 µg of RNA were separated by electrophoresis under denaturing conditions and blotted onto Hybond N+ membranes (Amersham). DNA probes were labeled by random priming of the Klenow fragment of DNA polymerase on 200 ng probe DNA in 30 µM dTTP, dCTP, and dGTP; 30 µM ³²P-labeled dATP; 10 mM Tris-HCl, pH 7.5; 5 mM MgCl₂; and 7.5 mM dithiothreitol (DTT) for 30 min at 37°C. Hybridization was performed in 6x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5x Denhardt's solution, 0.1% sodium dodecyl sulfate, and 100 mg/ml denatured salmon sperm DNA at 55°C after 1 h of prehybridization.

Deletion constructs. To be able to monitor transcription in the impA direction by fluorescence, green fluorescent protein (GFP) modified to have a short half-life (rpL11N; S65T) (8) was ligated to the impA end of portions of the 654-bp intergenic region. The intergenic region was digested with SspI, which cuts at bp 340 relative to the ATG of impA, generating the 1-to-340 construct. PCR primers were prepared such that intergenic fragments containing bp 1 to 153 and 1 to 555 were generated and could be ligated to GFP. The primer sequence for bp 1 to 555 (5'-AATCAAGGAGATCGAGCTGATCAGTAAGCTTT-3') was cut at the HindIII site (underlined) to produce the portion from bp 1 to 525. The PCR primer (5'-AAAGTGACTCATGCTTAGGGCCCAAAAA-3') is found at bp 107 to 133 but has an inserted C (underlined) to generate an ApaI site. The product was digested with ApaI to generate the portion from bp 1 to 112, which was ligated to GFP. The construct carrying 112 bp was digested with exonuclease III to generate constructs with 59 bp and 92 bp upstream of GFP. These constructs were cloned in the low-copy extrachromosomal vector pDXA-3C (20) from which the actin 15 promoter had been removed. These vectors were transformed together with the helper plasmid in cells of strain Ax-2, and transformants were selected and maintained in medium containing 10 µg/ml G418. Expression of GFP was measured by flow cytometry and the values confirmed by quantitation of Western blots stained with anti-Aequorea victoria antibody (BD Biosciences) by using horseradish peroxidase-conjugated anti-mouse immunoglobulin G as the second antibody (Santa Cruz Biotechnology).

Another series of constructs was prepared to determine expression in the dia1 direction. The DsRed Express gene (Clontech) was modified to carry a His₆ tag (NH-Red) at the N terminus and ligated at the dia1 end of the intergenic region. Digestion of this construct with SspI left the fragment from bp 440 to 654 fragment ligated to NH-Red. PCR primers were used to generate the fragments from bp 104 to 654, 527 to 654, and 553 to 654 adjacent to NH-Red. Expression of these constructs carried on the low-copy extrachromosomal vector was monitored in transformants that had developed in buffer for 8 h. Samples were collected and lysed in sample buffer (2% sodium dodecyl sulfate, 62 mM Tris-HCl, pH 6.8, 10% glycerol, 42 mM dithiothreitol), heated to 100°C for 5 min, and electrophoretically separated on 12% polyacrylamide gels before being transferred to polyvinylidene difluoride membranes. The levels of NH-Red were determined by staining Western blots with antibody to the His epitope on NH-Red (QIAGEN). NH-Red has a half-life of >24 h. (Clontech).

Flow cytometry. Exponentially growing cells were harvested, washed in 20 mM sodium-potassium phosphate buffer (PB) (pH 6.4), and resuspended in PB. An equal volume of ice-cold methanol was added to the suspension, and the cells were pelleted before being fixed for 10 min at –20°C in 100% ice-cold methanol. Fixed cells were washed in PB twice and incubated in PB containing 5% bovine serum albumin (BSA) (BSA-PB) for 30 min. Anti-A.v. antibody (BD Biosciences) was diluted 1:1,000 in BSA-PB and incubated with the cells for 30 min. Washed cells were incubated with fluorescein isothiocyanate-conjugated anti-mouse immunoglobulin G (Sigma) diluted 1:500 with BSA-PB. The cells were washed three times with PB before being analyzed on a FACSCalibur (Becton Dickinson).

Electrophoretic mobility shift assay. Portions of the impA/dia1 intergenic region between bp 1 and 112 as well as bp 106 to 484 were PCR amplified and labeled with [³²P]dATP. The sequence TGATCAGCTCGATC (bp 533 to 546), which is found in two related copies proximal to dia1, was synthesized along with its complement, to which 3 Ts were added at the 5' end such that the double-stranded DNA could be labeled with [³²P]dATP by using the Klenow fragment of DNA polymerase I. Nuclear extracts were prepared by the method of Gollop and Kimmel (11). Approximately 8 x 10⁸ cells were collected and resuspended in ice-cold 50 mM Tris-HCl, pH 7.6, buffer containing 6.5 mM magnesium acetate, 10% sucrose, 2% Nonidet P-40, and 0.5 mM phenylmethylsulfonyl fluoride (PMSF). Following lysis, the extract was centrifuged at 500 x g for 5 min to remove whole cells and debris and the supernatant centrifuged at 3,000 x g for 5 min to pellet the nuclei. The nuclei were suspended in 400 µl of nuclear extraction buffer (5 mM HEPES, pH 7.9, 0.3 M NaCl, 25 mM Tris-HCl, pH 7.6, 2.5 mM magnesium acetate, 2.5 mM MgCl₂, 10% sucrose, 1.25% Nonidet P-40, 0.05 mM EDTA, 0.5 mM DTT, 2.5 mM spermidine, and 0.5 mM PMSF). After incubation at 4°C for 1 h, the extracts were cleared by centrifuging at 10,000 rpm for 30 min. The supernatant was dialyzed against buffer (10 mM HEPES, pH 7.9, 50 mM NaCl, 1 mM MgCl₂, 20% glycerol, 0.5 mM EDTA, 1.0 mM DTT, and 0.5 mM PMSF) at 4°C for 2 h and the protein content determined. Ten micrograms of nuclear protein was incubated with each of the probes in 10 mM Tris-HCl, pH 7.6, 50 mM NaCl, 0.5 mM EDTA, 1 mM MgCl₂, 25 mM ZnCl₂, 0.5 mM DTT, 4% glycerol, and 12.5 µg/ml poly(dI · dC), with or without a 50-fold excess of unlabeled probe added 10 min prior to addition of labeled probe. After 30 min at 4°C, the reaction mixture was electrophoretically separated on 5% polyacrylamide, 0.13% bisacrylamide nondenaturing gels in 0.5x TBE (45 mM Tris base, 45 mM borate, 1 mM EDTA, pH 8.3) at 35 mA at 4°C. Gels were dried onto filter paper and exposed to film.

Top Abstract Introduction Materials and Methods Results Discussion References

 
dia1 and impA are divergently transcribed adjacent genes. We have previously shown that dia1 mRNA is not present in exponentially growing cells but starts to accumulate within 2 h following removal of growth medium, reaching a peak at 4 h and then disappearing (12). Inspection of the genome sequence (10) showed that there is a divergently transcribed gene 654 bp upstream of the ATG of dia1. This gene encodes a protein of 285 amino acids that includes a Pfam domain found in the FKBP class of immunophilins and so was named impA.

The cis-acting regions that control transcription of Dictyostelium genes have all been found in the flanking 5' sequences, and some divergently transcribed genes such as cprB and zfaA have been found to be coordinately regulated in Dictyostelium (9). Microarray studies with human tissues have demonstrated that 90% of bidirectional regulatory regions result in coordinate expression of the flanking genes (27). To determine whether impA and dia1 are coordinately regulated at the GDT, we isolated RNA from exponentially growing cells and from cells that had differentiated after being shifted to BSS. As expected, Northern blot analyses showed that dia1 mRNA was low in growing cells and accumulated within the first 2 hours of development (Fig. 1). On the other hand, impA mRNA was high in growing cells and decreased during the first few hours of development (Fig. 1). It appears that these genes are inversely expressed before and after the GDT.

View larger version (32K): [in this window] [in a new window]

FIG. 1. Expression profiles of dia1 and impA during early differentiation. Exponentially growing Ax-2 cells were harvested, resuspended in BSS at 107 cells/ml, and incubated at 22°C in suspension. Samples were collected at the times indicated and RNA prepared for Northern blot analyses using either dia1 or impA cDNA probes. The 1.4-kb mRNA of dia1 and the 0.7-kb mRNA of impA are indicated.

Deletion analyses of the impA/dia1 intergenic region. To determine the cis-acting sequences essential for transcriptional regulation of impA and dia1, we prepared low-copy extrachromosomal vectors in which portions of the intervening sequence were used to drive GFP rather than impA or to drive NH-Red rather than dia1 (see Materials and Methods). Due to the weakness of the impA promoter, fluorescence signals were below the detection limit in the fluorescence-activated cell sorting, but GFP expression could be analyzed after staining fixed cells with anti-A.v. antibody and fluorescein isothiocyanate-coupled second antibody (Fig. 2B). Expression levels in exponentially growing cells carrying either the full-length intergenic region (bp 1 to 654) or a portion from which the distal 100 bp was removed were indistinguishable (Fig. 2B). Deletion of another 30 bp (to give bp 1 to 525) reduced the level of GFP about twofold, indicating that this distal sequence plays a role in impA transcription. Further deletion of bases up to 92 bp upstream of the gene (bp 1 to 92) had no further effect on GFP levels, but deletion of another 33 bp, leaving only 59 bp of the impA upstream sequence (1 to 59), abolished GFP expression (Fig. 2B). The relative levels of GFP expression determined by flow cytometry were confirmed by quantitation of electrophoretically separated GFP (Fig. 2C). The values were also confirmed by spectrophotometrically measuring the total fluorescence at 510 nm in extracts of sonicated cells after excitation at 488 nm (data not shown). Expression of GFP decreases rapidly following the initiation of development in cells carrying constructs with at least 92 bp of the adjacent intervening sequence (data not shown). It appears that the cis-acting sequence which is essential for control of impA transcription during growth and repression during development resides in the proximal 92-bp sequence.

View larger version (34K): [in this window] [in a new window]

FIG. 2. Sequences essential for impA. A) Schematic representation of the region separating impA and dia1 and deletion constructs. The base adjacent to the start codon of impA is set at 1. B) Transformants carrying full-length region (bp 1 to 654) and deleted portions ligated to GFP were fixed and stained while in exponential growth before being analyzed by flow cytometry. The intensities of individual cells were plotted and the histogram shaded. The green, red, and blue overlaid lines are the histograms of bp 1 to 59, 1 to 555, and 1 to 654 (representative of three independent experiments). C) GFP was detected on Western blots of extracts from the same cells, which were stained with anti-GFP for chemiluminescence. The signal intensity was quantitated with NIH Image (values are below each lane).

Expression of NH-Red could not be measured by fluorescence because the levels were not significantly above the background level. Therefore, we carried out Western analyses on 8-h-developed cells by using antibodies to the His₆ epitope carried by NH-Red. While cells carrying the full-length (654-bp) construct accumulated the NH-Red reporter, cells carrying constructs in which the distal 107 bp, which is adjacent to impA, had been deleted failed to accumulate any measurable NH-Red during development (Fig. 3), nor did growing cells carrying these constructs have measurable NH-Red (data not shown). It appears that the same region of the intervening sequence is essential for expression of both impA and dia1.

View larger version (16K): [in this window] [in a new window]

FIG. 3. Sequences essential for dia1. A) Schematic representation of the region separating impA and dia1 coding regions and deletion constructs. Numbering is the same as in Fig. 2. B) Transformants carrying the full-length region (bp 1 to 654) and deleted portions ligated to NH-Red were developed for 8 h in shaken suspension. Samples were electrophoretically separated and Western blots stained with antibody to the His epitope on NH-Red. Only the full-length intergenic region (bp 1 to 654) permitted expression of NH-Red.

A cis element necessary for repression of dia1. While the distal 107 bp is necessary for expression of dia1 following the GDT, what accounts for the lack of expression in growing cells? To determine whether the central region of the intervening sequence plays a role in repressing dia1, we ligated the first 153 bp adjacent to impA to the region from bp 440 to the start of dia1. This construct was ligated to NH-Red and introduced into cells. Western analyses showed that exponentially growing cells carrying the full-length construct had no measurable levels of NH-Red and that NH-Red accumulated following the initiation of development (Fig. 4). On the other hand, exponentially growing cells carrying the construct lacking the central 287 bp (153-440) had high levels of NH-Red, and the level did not change significantly following the initiation of development (Fig. 4). It appears that cis-acting signals in the middle region are critical to repression of dia1 before the GDT.

View larger version (20K): [in this window] [in a new window]

FIG. 4. Derepression of dia1 in vegetative cells. Expression of NH-Red was determined in transformants carrying constructs with the full-length region (bp 1 to 654) or the full-length region from which the sequence between bp 153 and 440 was deleted. Samples were collected from vegetative cells as well as cells that had developed for 4 or 8 h. Western blots were stained with antibody to the His epitope as for Fig. 3.

Characteristics of the impA/dia1 intergenic sequence. There appear to be at least three regions within the 654 bp separating impA and dia1 that play significant roles in their regulation. The first 100 bp of this region is essential for both impA and dia1 transcription. This region includes the basal promoter region for impA expression as well as TTCAAAAAGTTC and its related inverse, GAATTTTTTGAA. Sequences similar to these inverted repeats are found in the 5' regions adjacent to other genes expressed immediately after the initiation of development, carA and pdsA (Fig. 5). In addition, the 5' region of the GDT-related gene gdt1 has two copies of the motif, one of which is inverted. It is possible that a common trans-acting protein binds these sequences and stimulates coordinate transcription of each of these genes. The sequence in the middle of the intergenic region separating impA and dia1 is high in As and Ts, but there are two pairs of similar sequences (TTCTAATTGATTGAA-TTCTAATTTATTGAA and TTGATAAACTT-TTGATAAACTC) that may be recognized by a trans-acting factor. The region proximal to dia1 which appears to stimulate expression of impA twofold contains two related sequences next to each other (Fig. 5). A similar sequence (AATCAAGCTCGAATCTCCA) is present at the equivalent carA position (Fig. 5), suggesting that a trans-acting factor may bind there and affect transcription to the right as well as to the left.

View larger version (32K): [in this window] [in a new window]

FIG. 5. Sequences in the regulatory regions of impA/dia1, carA, pdsA, and gdt1. Almost identical 7-bp direct repeats (circles) are found as a closely spaced inverted pair 500 bp upstream of dia1. Sequence related to the 7-bp repeats is found 600 bp upstream of carA and 250 and 600 bp upstream of pdsA and gdt1, respectively, in inverted orientation. Circles show their position relative to the start of each gene. There is another sequence related to the 7-bp direct repeat 350 bp upstream of gdt1. A 20-bp sequence is found in two copies near the start of dia1, and a related sequence is found at the equivalent position upstream of carA (hexagons). A 20-bp sequence recognized by a nuclear factor in vegetative cells lies within the region necessary for repression of dia1 (boxed). dia1, carA, and pdsA are expressed immediately following the GDT, while gdt1 is expressed in vegetative cells.

DNA binding factors that recognize the impA/dia1 intergenic sequence. Electrophoretic mobility shift assay were carried out with the 112-bp region proximal to impA as well as the middle region necessary for repression of dia1. The probes were labeled with ³²P, incubated with nuclear extracts from vegetative cells or 4-h-developed cells with or without excess unlabeled probe, and separated on 5% polyacrylamide gels (Fig. 6). Although we tested several conditions, we could not observe a gel shift of the 112-bp probe with nuclear extracts from either growing or differentiating cells (data not shown). However, the middle region (bp 106 to 484) was retarded by nuclear extracts of vegetative cells in a manner that could be competed by unlabeled probe (Fig. 6). When the central portion of this region (bp 290 to 311) was used as a probe, the same band was seen with nuclear extracts of vegetative cells. Neither of these probes was retarded by nuclear extracts of 4-h-developed cells in a manner that could be competed with unlabeled probe (Fig. 6). It appears that a nuclear factor in vegetative cells recognizes the sequence from bp 290 to 311 sequence (GAAGTTCTAATTGATTGAAG) and may play a role in repression of dia1 in vegetative cells. This factor disappears when dia1 is expressed after 4 h of development. Another sequence in the middle region (TTGATAAACTT) did not show a gel shift with nuclear extracts from either vegetative or 4-h-developed cells (data not shown).

View larger version (66K): [in this window] [in a new window]

FIG. 6. Gel shifts with nuclear extracts of vegetative and 4-h-developed cells. A) The central region (bp 106 to 484) necessary for repression of dia1 in vegetative cells was labeled with 32P and incubated with nuclear extract from either vegetative cells (V) or cells cultured in BSS for 4 h with or without unlabeled probe as a competitor. Protein-DNA complexes were electrophoretically separated on 5% polyacrylamide gels before being visualized by autoradiography. B) The 20-bp sequence (GAAGTTCTAATTGATTGAAG, bp 290 to 311) within the central region was subjected to the same gel shift conditions. C) The 13-bp sequence (ACTGATCAGCTCGATC, bp 533 to 546) found proximal to dia1 was subjected to the same gel shift conditions.

There are two copies of the sequence ACTGATCAGCTCGATC proximal to dia1 that are responsible for a twofold increase in the level of transcription in the impA direction (Fig. 2). We prepared a probe with the sequence from bp 533 to 546 and found that it was retarded by nuclear extracts of vegetative cells in a manner that could be competed with unlabeled probe (Fig. 6B). There were two bands near the top of the gel and two bands lower down, suggesting that more than one nuclear protein recognizes this sequence. Omitting zinc from the gel shift buffer reduced the amount of retarded probe, suggesting that the proteins might carry zinc fingers (data not shown). When this probe was incubated with nuclear extracts of cells that had differentiated for 4 h in buffer, one of the upper bands was stronger, the lower bands were not seen, and a new band that was much stronger appeared (Fig. 6C). It appears that this sequence is recognized by several different factors which are controlled at the GDT.

Top Abstract Introduction Materials and Methods Results Discussion References

 
Genome-wide microarray studies have shown that there is a significant change in the global pattern of transcription when growth ceases as the result of nutrient deprivation and cells start to differentiate (15, 28). Many genes that are expressed during growth, including impA and the genes encoding ribosomal proteins, are turned off immediately after the GDT, while a set of early genes, including dia1, dia2, and dia3 as well as carA, pdsA, and gpaB, are rapidly induced (1, 2, 4, 12, 14). Although reversible, the GDT is one of the most significant transitions in the life cycle, since growth potential is curtailed. There are multiple preparatory steps that involve YakA, PufA, PKA, AmiB, Gdt1, Gdt2, and the DNA binding proteins CbfA and CRTF (6, 17, 25, 29). There is also evidence that cells must progress through the cell cycle before arresting at the PS point such that the cells initiate development in late G₂ (18). Transcriptional regulation at the GDT is likely to involve changes in the proteins that bind to cis-acting sequences upstream of the pertinent set of genes. The fortuitous arrangement of a gene that is repressed and a gene that is induced at the GDT has allowed us to dissect the intergenic region into some of its component parts.

There is a pair of 7-bp direct repeats in the 92-bp region proximal to impA which is essential for expression of both impA and dia1 (Fig. 2 and 3). Related sequences can be recognized upstream of carA, pdsA, and gdt1, genes whose expressions are regulated soon after the GDT (Fig. 5). Site-directed mutations in the copy that is upstream of carA have been shown to significantly reduce expression of carA and affect binding of the transcription factor CRTF (21). It is likely that CRTF or related proteins function in transcriptional regulation of each of these genes. Unfortunately, we could not detect protein binding to this region in electrophoretic mobility shift assays.

There is a region in the middle of the impA/dia1 intergenic region that is essential for repression of dia1 expression in growing cells (Fig. 4). A sequence within this region (GAAGTTCTAATTGATTGAAG) is recognized by a factor present in growing cells but absent in cells which have differentiated for 4 h. The most likely reason that impA is expressed in growing cells while dia1 is not expressed is that a repressor binds in the middle of the intergenic region and blocks transcription to the right but not the left. This repressor disappears following a shift from growth medium to buffer and likely accounts for this aspect of GDT.

Finally, there is a pair of nearly identical 20-bp sequences in the region proximal to dia1 that appear to stimulate expression of impA about twofold. Deletion of one member of this pair reduces the level of the GFP reporter twofold (Fig. 2B and C). The repeated sequence is recognized by several proteins present in growing cells, at least one of which disappears following the initiation of development. These proteins may be transcriptional factors responsible for the stimulation of impA expression in growing cells. Another protein that recognizes this sequence accumulates during early development and may play a role in expression of dia1. A highly related sequence is found just upstream of carA and may stimulate expression of this gene at the GDT.

 
We thank Sam Payne for useful discussions and database searches. The short-half-life GFP (rpL11N; S65T) used in this study was a kind gift from Harry MacWilliams (Universität München, Germany).

This work was supported by a Grant-in-Aid (No. 14654170) from the Ministry of Education, Science, Sports and Culture of Japan, a grant from the Japan Society for the Promotion of Science (JSPS), and a grant from the Mitsubishi Foundation to Y.M.; grant no. 063612 from the Wellcome Trust to C.P.; and a grant from the National Institutes of Health (GM62350) to W.F.L.

 
* Corresponding author. Mailing address: Cell and Developmental Biology, UCSD, 9500 Gilman Drive, La Jolla, CA 92093-0368. Phone: (858) 534-2543. Fax: (858) 822-2094. E-mail: wloomis{at}ucsd.edu.

These authors contributed equally to this work.

Top Abstract Introduction Materials and Methods Results Discussion References

 

1
1. Abe, F., and Y. Maeda. 1994. Precise expression of the cAMP receptor gene, CAR1, during transition from growth to differentiation in Dictyostelium discoideum. FEBS Lett. 342:239-241.[CrossRef][Medline]
2
2. Agarwal, A. K., S. N. Parrish, and D. D. Blumberg. 1999. Ribosomal protein gene expression is cell type specific during development in Dictyostelium discoideum. Differentiation 65:73-88.[CrossRef][Medline]
3
3. Bonner, J. T. 1950. Observations on polarity in the slime mold Dictyostelium discoideum. Biol. Bull. 99:143-151.[Abstract/Free Full Text]
4
4. Chae, S. C., Y. Inazu, A. Amagai, and Y. Maeda. 1998. Underexpression of a novel gene, dia2, impairs the transition of Dictyostelium cells from growth to differentiation. Biochem. Biophys. Res. Commun. 252:278-283.[CrossRef][Medline]
5
5. Chen, G., G. Shaulsky, and A. Kuspa. 2004. Tissue-specific G1-phase cell-cycle arrest prior to terminal differentiation in Dictyostelium. Development 131:2619-2630.[Abstract/Free Full Text]
6
6. Chibalina, M. V., C. Anjard, and R. H. Insall. 2004. Gdt2 regulates the transition of Dictyostelium cells from growth to differentiation. BMC Dev. Biol 4:8.[CrossRef][Medline]
7
7. Clarke, M., and R. H. Gomer. 1995. PSF and CMF, autocrine factors that regulate gene expression during growth and early development of Dictyostelium. Experientia 51:1124-1134.[CrossRef][Medline]
8
8. Deichsel, H., S. Friedel, A. Detterbeck, C. Coyne, U. Hamker, and H. K. MacWilliams. 1999. Green fluorescent proteins with short half-lives as reporters in Dictyostelium discoideum. Dev. Genes Evol. 209:63-68.[CrossRef][Medline]
9
9. Driscoll, D. M., and J. G. Williams. 1987. Two divergently transcribed genes of Dictyostelium discoideum are cyclic AMP inducible and coregulated during development. Mol. Cell. Biol. 7:4482-4489.[Abstract/Free Full Text]
10
10. Eichinger, L., J. Pachebat, G. Glockner, M-A. Rajandream, R. Sucgang, M. Berriman, J. Song, R. Olsen, K. Szafranski, Q. Xu, B. Tunggal, S. Kummerfeld, M. Madera, A. Konfortov, F. Rivero, A. Bankier, R. Lehmann, N. Hamlin, R. Davies, P. Gaudet, P. Fey, K. Pilcher, G. Chen, D. Saunders, E. Sodergen, P. Davis, A. Kehornou, X. Nie, N. Hall, C. Anjard, L. Hemphill, N. Bason, P. Farbrother, B. Desany, E. Just, T. Morio, R. Rost, C. Churcher, J. Cooper, S. Haydock, N. van Driessche, A. Cronin, I. Goodhead, D. Muzny, T. Mourier, A. Pain, M. Lu, D. Harper, R. Lindsay, H. Hauser, K. James, M. Quiles, M. Mohan, T. Saito, C. Buchrieser, A. Wardroper, M. Felder, Thangavelu, D. Johnson, A. Knights, H. Loulseged, K. M. Mungall, K. Oliver, C. Price, M. Quail, H. Urushihara, J. Hernadez, E. Rabbinowitsch, D. Steffen, M. Sanders, J. Ma, Y. Kohara, S. Sharp, M. Simmonds, S. Spiegler, A. Tivey, S. Sugano, B. White, D. Walker, J. Woodward, T. Winckler, Y. Tanaka, G. Shaulsky, M. Schleicher, G. Weinstock, A. Rosenthal, E. Cox, R. Chisholm, R. Gibbs, W. F. Loomis, M. Platzer, R. R. Kay, J. Williams, P. Dear, A. A. Noegel, B. Barrell, and A. Kuspa. 2005. The genome of the social amoeba Dictyostelium discoideum. Nature 435:43-57.[CrossRef][Medline]
11
11. Gollop, R., and A. R. Kimmel. 1997. Control of cell-type specific gene expression in Dictyostelium by the general transcription factor GBF. Development 124:3395-3405.[Abstract]
12
12. Hirose, S., Y. Inazu, S. Chae, and Y. Maeda. 2000. Suppression of the growth/differentiation transition in Dictyostelium development by transient expression of a novel gene, dia1. Development 127:3263-3270.[Abstract]
13
13. Inazu, Y., S. C. Chae, and Y. Maeda. 1999. Transient expression of a mitochondrial gene cluster including rps4 is essential for the phase-shift of Dictyostelium cells from growth to differentiation. Dev. Genet. 25:339-352.[CrossRef][Medline]
14
14. Iranfar, N., D. Fuller, and W. F. Loomis. 2003. Genome-wide expression analyses of gene regulation during early development of Dictyostelium discoideum. Eukaryot. Cell 2:664-670.[Abstract/Free Full Text]
15
15. Iranfar, N., D. Fuller, R. Sasik, T. Hwa, M. Laub, and W. F. Loomis. 2001. Expression patterns of cell-type-specific genes in Dictyostelium. Mol. Biol. Cell 12:2590-2600.[Abstract/Free Full Text]
16
16. Klein, P., D. Fontana, B. Knox, A. Theibert, and P. Devreotes. 1985. cAMP receptors controlling cell-cell interactions in the development of Dictyostelium. Cold Spring Harbor Symp. Quant. Biol. 50:787-799.[Abstract/Free Full Text]
17
17. Kon, T., H. Adachi, and K. Sutoh. 2000. amiB, a novel gene required for the growth/differentiation transition in Dictyostelium. Genes Cells 5:43-55.[Abstract]
18
18. Maeda, Y., T. Ohmori, T. Abe, F. Abe, and A. Amagai. 1989. Transition of starving Dictyostelium cells to differentiation phase at a particular position of the cell cycle. Differentiation 41:169-175.[CrossRef][Medline]
19
19. Mann, S. K., J. M. Brown, C. Briscoe, C. Parent, G. Pitt, P. N. Devreotes, and R. A. Firtel. 1997. Role of cAMP-dependent protein kinase in controlling aggregation and postaggregative development in Dictyostelium. Dev. Biol. 183:208-221.[CrossRef][Medline]
20
20. Manstein, D. J., H. P. Schuster, P. Morandini, and D. M. Hunt. 1995. Cloning vectors for the production of proteins in Dictyostelium discoideum. Gene 162:129-134.[CrossRef][Medline]
21
21. Mu, X., B. Lee, J. M. Louis, and A. R. Kimmel. 1998. Sequence-specific protein interaction with a transcriptional enhancer involved in the autoregulated expression of cAMP receptor 1 in Dictyostelium. Development 125:3689-3698.[Abstract]
22
22. Parent, C. A., and P. N. Devreotes. 1996. Constitutively active adenylyl cyclase mutant requires neither G proteins nor cytosolic regulators. J. Biol. Chem. 271:18333-18336.[Abstract/Free Full Text]
23
23. Rathi, A., S. C. Kayman, and M. Clarke. 1991. Induction of gene expression in Dictyostelium by prestarvation factor, a factor secreted by growing cells. Dev. Genet. 12:82-87.[CrossRef][Medline]
24
24. Shaulsky, G., and W. F. Loomis. 1995. Mitochondrial DNA replication but no nuclear DNA replication during development of Dictyostelium. Proc. Natl. Acad. Sci. USA 92:5660-5663.[Abstract/Free Full Text]
25
25. Souza, G. M., A. M. da Silva, and A. Kuspa. 1999. Starvation promotes Dictyostelium development by relieving PufA inhibition of PKA translation through the YakA kinase pathway. Development 126:3263-3274.[Abstract]
26
26. Souza, G. M., S. Lu, and A. Kuspa. 1998. YakA, a protein kinase required for the transition from growth to development in Dictyostelium. Development 125:2291-2302.[Abstract]
27
27. Trinklein, N. D., S. F. Aldred, S. J. Hartman, D. I. Schroeder, R. P. Otillar, and R. M. Myers. 2004. An abundance of bidirectional promoters in the human genome. Genome Res. 14:62-66.[Abstract/Free Full Text]
28
28. Van Driessche, N., C. Shaw, M. Katoh, T. Morio, R. Sucgang, M. Ibarra, H. Kuwayama, T. Saito, H. Urushihara, M. Maeda, I. Takeuchi, H. Ochiai, W. Eaton, J. Tollett, J. Halter, A. Kuspa, Y. Tanaka, and G. Shaulsky. 2002. A transcriptional profile of multicellular development in Dictyostelium discoideum. Development 129:1543-1552.[Abstract/Free Full Text]
29
29. Zeng, C., C. Anjard, K. Riemann, A. Konzok, and W. Nellen. 2000. gdt1, a new signal transduction component for negative regulation of the growth-differentiation transition in Dictyostelium discoideum. Mol. Biol. Cell 11:1631-1643.[Abstract/Free Full Text]

---

Eukaryotic Cell, August 2005, p. 1477-1482, Vol. 4, No. 8
1535-9778/05/$08.00+0     doi:10.1128/EC.4.8.1477-1482.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Hirose, S., Payne, S. H., Loomis, W. F. (2006). cis-Acting Site Controlling Bidirectional Transcription at the Growth-Differentiation Transition in Dictyostelium discoideum.. Eukaryot Cell 5: 1104-1110 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Hirose, S. Articles by Maeda, Y. Search for Related Content PubMed PubMed Citation Articles by Hirose, S. Articles by Maeda, Y.