Eukaryotic Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dossin, F. d. M.
Right arrow Articles by Schenkman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dossin, F. d. M.
Right arrow Articles by Schenkman, S.

 Previous Article  |  Next Article 

Eukaryotic Cell, May 2005, p. 960-970, Vol. 4, No. 5
1535-9778/05/$08.00+0     doi:10.1128/EC.4.5.960-970.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Actively Transcribing RNA Polymerase II Concentrates on Spliced Leader Genes in the Nucleus of Trypanosoma cruzi

Fernando de Macedo Dossin and Sergio Schenkman*

Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, R. Botucatu 862 8 o andar, 04023-062 São Paulo, Brazil

Received 1 February 2005/ Accepted 14 March 2005


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RNA polymerase II of trypanosomes, early diverging eukaryotes, transcribes long polycistronic messages, which are not capped but are processed by trans-splicing and polyadenylation to form mature mRNAs. The same RNA polymerase II also transcribes the genes coding for the spliced leader RNA, which are capped, exported to the cytoplasm, processed, and reimported into the nucleus before they are used as splicing donors to form mRNAs from pre-mRNA polycistronic transcripts. As pre-mRNA and spliced leader transcription events appear to be uncoupled, we studied how the RNA polymerase II is distributed in the nucleus of Trypanosoma cruzi. Using specific antibodies to the T. cruzi RNA polymerase II unique carboxy-terminal domain, we demonstrated that large amounts of the enzyme are found concentrated in a domain close to the parasite nucleolus and containing the spliced leader genes. The remaining RNA polymerase II is diffusely distributed in the nucleoplasm. The spliced leader-associated RNA polymerase II localization is dependent on the cell transcriptional state. It disperses when transcription is blocked by {alpha}-amanitin and actinomycin D. Tubulin genes are excluded from this domain, suggesting that it may exclusively be the transcriptional site of spliced leader genes. Trypomastigote forms of the parasite, which have reduced spliced leader transcription, show less RNA polymerase II labeling, and the spliced leader genes are more dispersed in the nucleoplasm. These results provide strong evidences that transcription of spliced leader RNAs occurs in a particular domain in the T. cruzi nucleus.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Trypanosomes belong to a group of early diverging flagellated protozoa that causes several parasitic diseases, including Chagas' disease, leishmaniosis, and African trypanosomiasis. As with most eukaryotes, they also have three RNA polymerases characterized by a variable sensitivity to {alpha}-amanitin (15, 48). In trypanosomatids, the {alpha}-amanitin-sensitive RNA polymerase II (RNA Pol II), which transcribes most of the protein coding genes, catalyzes the transcription of long polycistronic messages (25, 47). These long polycistronic messages are then processed in a trans-splicing reaction by addition of a 30- to 40-nucleotide sequence derived from the spliced leader (SL) RNA at the 5' end of each cistron, followed by addition of a poly(A) tail at the 3' end (3, 42). The cap is added at the 5' end of the SL RNA during its transcription, and then it is transferred with the 30 to 40 nucleotides to the mature mRNA in the trans-splicing reaction (21, 29, 37). Transcription is constitutive for almost all genes characterized to date and varies in overall rates according to the parasite developmental stages (18). Thus, most regulation of gene expression in these organisms seems to occur posttranscriptionally either by the stability of the processed mRNAs or by translational controls as discussed in several reviews (8, 23, 44, 49). Recently, a bidirectional promoter was identified in strand-switch regions of chromosomes 1 (31) and 3 (30) of Leishmania major, driving the polycistronic transcription in long portions of these chromosomes. Also, a tRNA gene region on chromosome 3 was identified as a transcription terminator (30).

Transcription of the SL RNA in trypanosomes has been recently attributed to the same RNA polymerase that transcribes the polycistronic pre-mRNA (22), although some small differences regarding the sensitivity to {alpha}-amanitin have been detected (24). Moreover, differently from the polycistronic transcription, specific transcription factors recognize defined promoter and termination sequences on the SL RNA gene transcription (14, 22, 24, 28, 51). The SL RNA is exported to the cytoplasm, where it undergoes 3' extension removal and 5' methylation of nucleotide U4 before being imported into the nucleus and used as trans-splicing substrate (52). These trypanosome-peculiar transcription and mRNA processing mechanisms are reflected in the sequence of their RNA Pol II, which lacks the typical heptapeptide repeats (YSPTSPS) present in the carboxy-terminal domain (CTD) of RNA Pol II of other eukaryotic organisms. These repeats are differentially phosphorylated (36) and synchronize capping, splicing, elongation, and polyadenylation (13, 38), processes that colocalize in the nucleoplasm in an apparent cluster of enzymes (43). Nevertheless, in Trypanosoma brucei, despite its unique CTD, RNA polymerase II is phosphorylated when isolated from elongating complexes (10).

Because the transcription of SL RNA is not coupled to the trans-splicing process, we sought to investigate whether SL RNA transcription would occur in a separate domain regarding the transcription of other genes. To answer this question, in this work we addressed the localization of RNA Pol II in the nucleus of Trypanosoma cruzi, the agent of Chagas' disease. We found that RNA Pol II transcription of SL genes occurs in a specific nuclear domain in this parasite.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Trypanosomes. T. cruzi epimastigote forms (Y strain) were cultured at 28°C in liver infusion tryptose medium supplemented with 10% fetal bovine serum (7). Epimastigotes expressing a histone H2b-green fluorescent protein (H2B-GFP) fusion (18) were also cultivated as above but in the presence of 500 µg Geneticin G418 per ml. Exponentially growing parasites (1 x 107 per ml) were collected by centrifugation and used as described previously (18). Trypomastigote forms were obtained from the supernatants of infected mammalian cells (LLCMK2; American Type Culture Collection) as described previously (2).

Recombinant CTD and antibodies. To clone and express the recombinant protein corresponding to the CTD of T. cruzi RNA Pol II (rCTD), a lambda DASH II (Stratagene) clone containing the genomic sequence of RNA Pol II of T. cruzi (16) was used as a template for PCR with oligonucleotides CTDFor (5' CCCATATGGGCGGCAGCTCCTCCGC) and CTDRev (5'CGGATCCCTACTGGTGCCCTTCCTC). The PCR product was inserted into pGEM-T-Easy (Promega, Madison, WI) and then into the NdeI-BamHI sites of pET14b (Novagen). The resulting plasmid was transferred to Escherichia coli BL21 pLysS, and the recombinant protein was obtained by induction of expression with 0.1 mM isopropylthio-ß-D-galactoside (IPTG) for 12 h at 30°C. Bacteria were resuspended in 20 mM Tris-HCl (pH 8), 6 mM MgCl2, 0.1% Triton X-100, frozen and thawed three times to induce lysis, and treated with 20 µg of DNase per ml for 30 min. The insoluble rCTD was washed, solubilized in 8 M urea-100 mM phosphate buffer (pH 8), and applied to an Ni-nitrilotriacetic acid column (QIAGEN) equilibrated in the same buffer. After washes with 30 column volumes of the same buffer, 30 volumes of the same buffer at pH 6.3, and 30 volumes at pH 5.9, the recombinant protein was eluted with 8 M urea-100 mM phosphate buffer (pH 4.5). The eluted protein was dialyzed against 0.1 M NaHCO3 (pH 8.5) and then alkalinized by addition of 100 mM NaOH followed by slow neutralization to pH 8 with HCl to obtain a soluble form of the protein. One-hundred micrograms of the solubilized protein was mixed with 350 µl of alum and subcutaneously injected into rabbits three times with 3-week intervals between each dose. After the third injection, the blood was collected and monospecific antibodies were purified from the sera by chromatography with a Tresyl-agarose column containing the immobilized rCTD and elution with 100 mM triethylamine (pH 11.5).

Immunoblots and immunoprecipitation. Immunoblots were performed using sodium dodecyl sulfate (SDS) extracts of 1 x 107 parasites per lane and detection by ECL (Amersham Biosciences) using standard protocols. Parasite nuclear extracts were used for the immunoprecipitation experiments. The nuclear extracts were prepared from 5 x 109 exponentially growing parasites that were centrifuged and washed twice in cold 20 mM Tris-HCl (pH 7.4)-100 mM NaCl and 3 mM MgCl2, followed by two washes in transcription buffer (150 mM sucrose, 20 mM potassium glutamate, 10 mM HEPES-KOH [pH 7.9], 3 mM MgCl2, 0.2 mM EDTA, 2 mM dithiothreitol, and 10 mg of leupeptin per ml). The parasites were lysed at 130 lb/in2 in a French press apparatus, and the pellets were collected by centrifugation (20,000 x g for 10 min at 4°C) and resuspended in transcription buffer to one packed cell volume. The lysates were then suspended in 300 mM KCl in transcription buffer and centrifuged for 10 min at 4°C (20,000 x g), and the supernatant was diluted in the same buffer without KCl and reconcentrated using a Centricon 10 (Millipore). One-hundred-fifty microliters of these nuclear extracts were precleared with 5 µl normal rabbit immunoglobulin G (IgG) preadsorbed to 30 µl of protein A-Sepharose for 30 min at 4°C. Half of the supernatant was incubated with the specific antibodies and half with control antibodies, both preadsorbed to protein A-Sepharose beads. After 90 min at 4°C, the beads were washed, boiled in sample buffer, and submitted to SDS-polyacrylamide gel electrophoresis (PAGE). The gels were blotted to nitrocellulose and probed with the indicated antibodies by standard procedures.

Immunofluorescence analysis and fluorescence in situ hybridization (FISH). Immunofluorescence was made with parasites attached to glass slides pretreated with 0.01% polylysine. Attached parasites were fixed with 0.5 to 4% paraformaldehyde at 4°C for 15 min and permeabilized in phosphate-buffered saline (PBS) with 0.1% Triton X-100. The fixed and permeabilized cells were washed with PBS, and the slides were incubated with the primary antibody for 1 h at room temperature. The slides were washed with PBS, incubated with anti-rabbit IgG-rhodamine or fluorescein conjugates (Santa Cruz Biotechnology, Santa Cruz, CA), and mounted in VectaShield (Vector Laboratories) in the presence of 10 µg of 4'6'-diamidino-2-phenylindole (DAPI) per ml. For simultaneous immunofluorescence and FISH reactions, after the standard antibody reactions the slides were postfixed with cold 4% paraformaldehyde in PBS and then washed 5 min with PBS and gradually dehydrated by 5-min incubations in 70%, 90%, and 100% ethanol. For FISH experiments without antibody reactions, the cells were fixed, permeabilized, and gradually dehydrated as above. As a control, cells were treated after permeabilization with 30 µg of DNase-free RNase per ml for 15 min at 37°C to exclude the possibility of hybridization with RNA. In all cases, after dehydration the slides were air dried and incubated with 15 ng of digoxigenin or Fluorescein High Prime (Roche)-labeled probes in hybridization solution (2x SSPE, 50% formamide, 10% dextran [1x SSPE is 0.18 M NaCl, 10 mM NaH2PO4, and 1 mM EDTA, pH 7.7]) preheated at 85°C for 7 min in a 25-µl final volume. The slides were sealed with EasiSeal (Hybaid), heated 5 min at 80°C, and then incubated 16 h at 37°C. The seal was removed, and the slides were washed 30 min at 37°C in 50% formamide-2x SSC (1x SSC is 0.15 M NaCl plus 0.015 sodium citrate) and sequentially washed for 10 min with 2x SSC at 50°C, for 1 h with 0.2x SSC at 50°C, and finally for 10 min with 4x SSC at room temperature. The slides were then incubated with sheep anti-digoxigenin (Roche Diagnostics) diluted 1:600 in PBS-2% BSA for 45 min at 37°C and washed twice with PBS containing 0.05% Tween 20 (5 min each) before being incubated with fluorescein-conjugated anti-sheep IgG antibody (Vector) diluted 1:150 in PBS-2% BSA for 45 min at 37°C in the presence of DAPI. The slides were mounted as above. For dual probe FISH experiments, one probe was labeled using the Fluorescein High Prime kit and the other with digoxigenin. After the hybridization reaction, the slides were washed and incubated with sheep anti-digoxigenin-rhodamine (Roche) 1:20 in PBS containing 2% BSA for 45 min at 37°C, washed, and mounted as above. All preparations were observed using either a 100x magnification and 1.4 aperture Plan-Apochromatic lens of a Nikon E600 microscope attached to a Nikon DXM1200 digital camera or a Zeiss 100X magnification and 1.4 aperture Plan-Apochromatic lens of an Axiovert 100 microscope attached to a confocal laser fluorescence-scanning system (Bio-Rad 1024-UV) using the LaserSharp 3.2TC program (Bio-Rad). The images were further processed using the Volume J plugin in the Image J software, version 1.32i. Adobe Photoshop was used to pseudocolor images. The FISH probes were the entire SL gene, the satellite DNA, and a single unit of a tandem repeat of {alpha}- and ß-tubulin genes. The SL RNA probe was prepared by PCR using as template a pGEM-T Easy containing a genomic clone of T. cruzi (Y strain) SL RNA gene and the oligonucleotides SL3 (5'-GGGGTCAGACCCCGGTCAAAA) and SL5 (5'-CCGTTGTGGAACACAACTCCT). The SL probe was labeled with digoxigenin by PCR. Ten nanograms of the amplified DNA fragment purified with Sephaglass BandPrep kit (Amersham Biosciences) was then used as template in a new PCR containing the same primers and 0.2 mM dATP, dCTP, and dGTP, 0.13 mM dTTP, and 0.07 mM digoxigenin-11-dUTP (Roche Diagnostics). The labeled and amplified product was purified again with Sephaglass BandPrep kit and used in the hybridizations. The satellite DNA probe was prepared as described previously (17). The tubulin probe was prepared by random priming labeling using the Fluorescein High Prime kit according to the manufacturer's instructions with a XbaI-EcoRI fragment corresponding to 4.3 kilobases of the {alpha}- and ß-tubulin genes cloned in pDC1 (a gift from Yara Traub Czeko, Fiocruz, Rio de Janeiro, Brazil).

In vitro transcription. The parasites were washed three times and resuspended to 1 x 107 per ml in transcription buffer containing 80 U per ml of RNase inhibitor (Stratagene). These cells were then permeabilized with 50 µg of lysolecithin per ml (Sigma) for 1 min on ice, centrifuged, and washed in transcription buffer and resuspended to the same cell density in the transcription buffer containing 2 mM ATP, 1 mM CTP, 1 mM GTP, 0.5 mM bromo-UTP (Br-UTP) (Roche), 200 µg of creatine kinase per ml, 50 mM creatine phosphate. The cells were incubated for 15 min at 28°C and then added to glass slides coated with polylysine and processed for immunofluorescence using as primary antibodies 2.5 µg of a mouse monoclonal anti-5-bromodeoxyridine (BrdU) antibody (Roche) per ml and the anti-CTD diluted in PBS-1% BSA, followed by anti-mouse IgG Rhodamine conjugate (1:200; Santa Cruz) and anti-rabbit IgG fluorescein conjugate (Gibco). In some experiments, {alpha}-amanitin, at the indicated concentrations, was included before addition of the nucleotides. The slides were mounted and observed as described above.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
T. cruzi RNA Pol II is concentrated in a major nuclear domain. We cloned the CTD of T. cruzi RNA Pol II (16), expressed and purified the corresponding recombinant protein (rCTD) (29 kDa) (Fig. 1A), and used it to raise antibodies in rabbits. Monospecific antibodies were obtained by affinity chromatography using the immobilized rCTD. These anti-CTD anti-bodies reacted specifically with a 180-kDa band in immunoblots of total parasite lysates (Fig. 1B) and of immunoprecipitates obtained with the same antibodies (Fig. 1C). This is the expected size of the T. cruzi RNA Pol II. The antibodies only labeled the nucleus when used in immunofluorescence assays against fixed and permeabilized parasites (Fig. 1D). Neither the kinetoplast nor the cytoplasm was immunostained. Importantly, the nuclear labeling was not homogeneous. Instead, we observed a more intensely stained spot surmounting a more weak and diffuse pattern occupying most of the nuclear space. The nuclear periphery and the area that was less stained with DAPI, which corresponds to the nucleolus (see below), were not stained. The labeling was completely abolished when the immunofluorescence was made in the presence of rCTD (Fig. 1E), confirming that the detected fluorescence corresponded to the T. cruzi RNA Pol II.



View larger version (56K):
[in this window]
[in a new window]
  		FIG. 1. Antibodies against a recombinant protein corresponding to the T. cruzi RNA Pol II carboxy-terminal domain predominantly label a nuclear spot in the parasite. (A) The rCTD was expressed in E. coli BL21 after IPTG induction and was analyzed by SDS-PAGE (lanes 1 and 2). The same gel shows the fractions purified as inclusion bodies (lane 3), after solubilization in 8 M urea and after purification by affinity chromatography in a Ni-agarose column (lanes 4 and 5). (B) Total parasite extract (lanes 1 and 2) and the corresponding immunoblots using anti-CTD antibodies ({alpha}CTD, lane 3) or normal rabbit IgG (NRS, lane 4). (C) Parasite nuclear extracts immunoprecipitated (IP) with anti-CTD antibodies coupled to protein A-Sepharose beads (lanes 1 and 3) or a control antibody against a nonrelated antigen (lanes 2 and 4). The bands were detected by immunoblot using the anti-CTD (lanes 1 and 2) or the control antibody (lanes 3 and 4). (D) Anti-CTD immunofluorescence assays of parasites fixed with 2% paraformaldehyde and permeabilized with Triton X-100. The figure also shows the DAPI staining, the merged fluorescent images, and the phase contrast of the same field. (E) The same experiment as in D, but the immunostaining was performed in the presence of rCTD at 1 µg per ml. The white arrows indicate the nucleus (N), nucleolus (nuc), and the kinetoplast (K) positions. Bars, 2 µm.

 
The RNA Pol II enriched domain is close to the nucleolus. To further investigate the localization and the nature of the most intensely labeled spot recognized by anti-RNA Pol II antibodies, the immunofluorescence assay was made in cells expressing a fusion of histone H2b and the green fluorescent protein (H2B-GFP). This fusion protein was previously shown to be at the parasite nucleolus, because it colocalizes with an anti-nucleolus monoclonal antibody (18, 34). As seen in the Fig. 2A, the RNA Pol II staining was always very close to but never juxtaposed with the H2B-GFP fusion. It is also possible to see that the fusion was in a region less stained by DAPI, which delimitates the nucleolus. Confocal analysis of the anti-CTD and DAPI fluorescence allowed us to reconstruct the volumes occupied by each one of these stains at several angles. These analyses indicate that the RNA Pol II main labeling occupies a central area in the nucleus, close to the region less stained with DAPI (Fig. 2B), confirming that most of the RNA Pol II is concentrated in a domain near the parasite nucleolus.



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 2. RNA Pol II is concentrated near the nucleolus of T. cruzi. Parasites expressing a histone H2b-GFP protein previously shown to be located at the parasite nucleolus (18) were fixed with 4% paraformaldehyde and permeabilized with Triton X-100 before immunolabeling with the anti-CTD monospecific antibodies (A, red at the third column). The GFP signal (green) is shown in the second column, and DAPI is in the first one. The fourth column shows the merged images. Scale bars, 2 µm. The anti-CTD and DAPI labeling of fixed and permeabilized parasites were analyzed under a laser confocal microscope, and a Z series of 15 sections of 0.187 nm was generated. The Z series was then used to generate a rendered image using the VolumeJ package (1). The figure (B) shows the volumes of the DAPI staining (red) and anti-RNA Pol II immunolabeling (yellow) at the indicated angles. The white arrows point to the nucleus (N), the kinetoplast (K), and RNA Pol II immunofluorescence (Pol II).

 
The RNA Pol II localization is dependent on active transcription. To determine whether the RNA Pol II localization was dependent on transcription, immunofluorescence assays using the anti-CTD antibodies were performed in cells previously treated with actinomycin D, which has been shown to effectively block all transcription events in T. cruzi (18, 39). As seen in Fig. 3, the labeling intensity decreased significantly in the presence of the drug. Most importantly, the intensely stained spot disappeared and a residual labeling remained in the nucleoplasm. This decrease in the labeling intensity was due to RNA Pol II dispersion, as the total amount of protein remained constant in the parasite as seen in the immunoblot shown in Fig. 3C.



View larger version (27K):
[in this window]
[in a new window]
  		FIG. 3. RNA Pol II localization is dependent on the transcriptional activity. Exponentially growing parasites were incubated for 30 min without (A, control) or with 100 µg actinomycin D per ml (B, Act D) and fixed with 0.5% paraformaldehyde. The cells were then permeabilized and immunostained for the RNA Pol II using the anti-CTD. The acquisition time for the immunofluorescence was identical for both treatments. Scale bar, 2 µm. (C) Immunoblot showing a SDS extract of 2 x 107 epimastigotes treated as above and stained with Ponceau and with anti-CTD antibodies ({alpha}CTD).

 
We next tried to inhibit the labeling using {alpha}-amanitin, which specifically inhibits the RNA Pol II transcription. As cells are poorly permeable to {alpha}-amanitin, we set up an in vitro transcription assay that would enable us to obtain a minimal disruption of the nuclear structure to study whether the RNA Pol II localization is dependent on active transcription. When we used saponin to permeabilize the cells at 0.10 M NaCl as described previously (33), although we obtained a strong incorporation of Br-UTP, the intensely labeled spot containing RNA Pol II and the less intensely labeled DAPI area corresponding to the nucleolus were lost in most of the cells (not shown), indicating that the nuclear structure was disrupted in this condition. In contrast, when we used 50 µg of lysolecithin per ml in a buffer optimized for RNA Pol II transcription, a condition that kept trans-splicing active in T. brucei (48), the preservation of T. cruzi nucleus was much better. In this condition, RNA Pol II labeling was similar to what was found in cells fixed before the permeabilization, with most of the stained area concentrated in a position close to the nucleolus as seen by the less intense DAPI staining (Fig. 4A). In the same experiment, the incorporation of Br-UTP was detected in most of the cells (70%; see Fig. 4C) with a more intense labeling in the area that corresponds to the RNA Pol II spot, although in some cells it was found more diffused. Longer labeling times, increasing detergent amounts, or higher lysolecithin concentrations increased Br-UTP spreading. In these cases no RNA Pol II labeling was detected, suggesting that longer incubations dramatically affected the nuclear structure. When we performed the transcription reaction in conditions that preserve the nuclear structure and in the presence of 15 or 60 µg of {alpha}-amanitin per ml, the Br-UTP labeling decreased significantly. Only a dot at the nucleolus position, probably corresponding to the RNA polymerase I transcription, was seen in all labeled nuclei (Fig. 4B). Indeed, this dot colocalized with the nucleolus as seen by the less intense DAPI staining. In parallel, the RNA Pol II labeling intensity decreased significantly, although in many cells it did not completely disappear. As seen in Fig. 4C, the labeling intensity decreased at 15 µg {alpha}-amanitin per ml in the entire nucleoplasm (green bars), while a more pronounced effect in the major labeled area was only seen when using 60 µg {alpha}-amanitin per ml (yellow bars). {alpha}-Amanitin caused RNA Pol II spreading, as the same amount of protein was detected in immunoblots of treated or untreated extracts (Fig. 4D). These results indicate that in permeable cells, the clustered localization of RNA Pol II is dependent on transcription. They also suggest that the RNA Pol II major labeled spot is more resistant to {alpha}-amanitin compared to the genes distributed in the other parts of the nuclear space. We also observed a 10-fold decrease in [32P]UTP incorporation in permeable parasites in the presence of 60 µg of amanitin per ml (data not shown), compatible with the fact that most of the Br-UTP labeling was due to RNA Pol II in the assay conditions.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 4. In vitro transcription partially colocalizes with the RNA Pol II staining, and both labels are inhibited by {alpha}-amanitin. The parasites were washed in transcription buffer and treated for 1 min on ice with 50 µg of lysolecithin per ml for permeabilization. After two washings, transcription was carried out as described in Materials and Methods. The parasites were then added to glass slides, fixed with cold 0.5% paraformaldehyde, and processed for immunofluorescence using the rabbit anti-CTD antibodies and the mouse anti-BrdU antibodies. The figures show the DAPI staining, the RNA Pol II immunolabeling, the Br-UTP labeling, and the merged images in which transcription was performed in the absence (A) or presence (B) of 15 µg of {alpha}-amanitin per ml. Bars, 2 µm. The graphic in panel C shows the percentage of nuclei labeled with Br-UTP (orange bars), the percentage of total RNA Pol II labeling intensity in the whole nucleus (green bars), and the percentage of RNA Pol II labeling restricted to the major spot (yellow bars); these last two measurements assume 100% for untreated cells. Image J software was used to measure the RNA Pol II signal in the immunofluorescence analysis. The immunoblot in D shows an SDS extract corresponding to 2 x 107 permeabilized parasites treated as above with 60 µg of {alpha}-amanitin per ml and stained with Ponceau and with anti-CTD antibodies ({alpha}CTD).

 
The enriched RNA Pol II domain contains SL RNA genes but not tubulin genes. The existence of the RNA Pol II-enriched transcriptional domain suggests that it could correspond to a site of SL RNA transcription, given that SL RNA is abundantly transcribed, and that SL RNA genes (150 to 200 in T. cruzi) are localized in tandem repeats of probably homologous chromosomes (32). In addition, Pol II transcription of SL RNA genes has consistently been found to be more resistant to {alpha}-amanitin as compared to pre-mRNA in in vitro transcription assays (8, 24). To investigate this possibility, we set up conditions to perform both anti-CTD immunolabeling and FISH using as a probe the SL RNA gene sequence. We found that the RNA Pol II spot corresponded exactly to the position of the SL RNA genes, suggesting that RNA Pol II transcription of SL RNA is restricted to a nuclear domain (Fig. 5A). In this experiment only the major spot could be observed, because the treatment required for FISH resulted in the loss of the RNA Pol II signal throughout the nucleoplasm. SL RNA genes do not colocalize with {alpha}- and ß-tubulin gene arrays, present as 3 to 6 dots per nucleus (Fig. 5B). These tubulin arrays probably are in two homologous 1.5 megabase chromosomes (9) that might be dispersed in nucleoplasm. As both the number of tubulin and SL hybridization spots and their signal intensities were unaffected when the FISH was carried out in the presence of RNase (data not shown), the hybridization signals correspond to these genes' distribution in the nucleus, not to their transcripts. Taken together, these findings suggest that transcription of other pre-mRNAs may correspond to less intensely labeled and randomly distributed RNA Pol II sites in the nucleoplasm.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 5. SL RNA genes colocalize with the major RNA Pol II labeling but not with the tubulin genes. (A) Parasites were fixed with 0.5% paraformaldehyde, permeabilized with 0.1% Triton X-100 and first submitted to immunofluorescence labeling with anti-CTD antibodies and anti-rabbit IgG-rhodamine conjugate, and then fixed and processed for FISH using as a probe a digoxigenin-labeled PCR fragment corresponding to T. cruzi SL RNA gene as described in Materials and Methods. The figure shows the merged images of DAPI with SL-FISH (first column), with RNA Pol II (second column), and the three stains together (third column). (B) A volume of 0.5% paraformaldehyde-fixed parasites were processed for FISH using as a probe a fluorescein-labeled {alpha}- and ß-tubulin genes and the same SL RNA gene probe as described in A. The SL probe was detected with an anti-digoxigenin rhodamine-conjugated antibody. Bars, 2 µm.

 
RNA Pol II labeling decreased and spliced leader genes dispersed in trypomastigote forms of the parasite. T. cruzi trypomastigotes do not divide but are able to infect mammalian cells. Their transcription is diminished when compared to the proliferating epimastigote forms (18). These trypomastigotes forms incorporated less [32P]UTP into SL RNA than the epimastigotes (~50-fold reduction), showing also smaller amounts of RNA Pol II in immunoblots and Northern blots (not shown). Therefore, we probed these cells with the anti-CTD antibody and with the SL RNA probe in FISH experiments. As expected, the major RNA Pol II spot was not detected in most trypomastigote nuclei (Fig. 6B), and when detected, the labeling was weaker than that of epimastigotes (Fig. 6A). The RNA Pol II labeling in trypomastigotes was seen in regions less intensely stained by DAPI, which were distributed in patches in all nuclear space. When we probed for the localization of the SL RNA genes in trypomastigotes, we found a more dispersed pattern, with three to more dots, while in epimastigotes the SL RNA genes were seen as one dot in the majority of the cells (Fig. 7). These differences in the SL RNA genes distribution and RNA Pol II labeling pattern suggest that these parasite stages have a different nuclear organization compatible with their transcriptional activity.



View larger version (48K):
[in this window]
[in a new window]
  		FIG. 6. The labeling of RNA Pol II decreases in trypomastigotes. Epimastigotes and trypomastigotes (A and B, respectively) were stained with DAPI (first column) and with the anti-CTD (second column). The third column shows these two latter images merged, and the fourth column shows the corresponding phase-contrast images. The images were acquired using the same exposure time. The arrows point the nucleus (N) and the kinetoplast (K). Arrowheads indicate the RNA Pol II labeling in the trypomastigote nucleus. Scale bars, 2 µm.

 


View larger version (31K):
[in this window]
[in a new window]
  		FIG. 7. SL RNA genes are dispersed in trypomastigotes. Epimastigotes (A) and trypomatigotes (B) were labeled with the digoxigenin SL probe, as described in Materials and Methods. The panels show the DAPI labeling, the SL-FISH labeling, the merged images, and phase-contrast images. The arrows point the nucleus (N) and the kinetoplast (K). Bars, 2 µm. The data in C represent the percentage of cells containing one, two, or three or more spots found in epimastigotes (n = 91) and trypomastigotes (n = 71).

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this study we have found that RNA Pol II is concentrated in a restricted area of the T. cruzi nucleus, next to the nucleolus, at the same position of the SL RNA genes. Additionally, RNA Pol II was found dispersed throughout the central region of the nucleoplasm in several less intensely stained spots. Such RNA Pol II distribution is dependent on transcription, supporting the notion that SL RNA is transcribed in this restricted area close to the nucleolus and that the dispersed labeling corresponds mostly to pre-mRNA transcription sites. Although RNA Pol II transcriptional compartmentalization has been described in other eukaryotes (41), the distribution found here is unique, as trypanosomes have all mRNAs produced by trans-splicing and their levels are posttranscriptionally regulated.

The facts that the permeable parasites incorporate Br-UTP throughout the nucleoplasm and that the position of tubulin genes are always different from the SL RNA genes support the notion that SL RNA transcription occurs in a restricted domain, separated from most of the pre-mRNA transcription. This peculiar localization of transcriptional events is in agreement with the existence of distinct mechanisms for SL RNA transcription and other pre-mRNAs in kinetoplastidae. While the monocistronic transcription of SL RNA involves cotranscriptional capping addition and specific transcription factors, the transcription of pre-mRNAs is not related to capping and is mostly polycistronic (8). Moreover, these different RNA Pol II spatial localizations are in agreement with the fact that SL RNA transcription is uncoupled from trans-splicing, which occurs when the polycistronic messages are being transcribed (46). In this sense, one would expect the trans-splicing machinery to be separated from the SL RNA transcription. Indeed, the RNA Pol II localization as seen in our study is different from the dispersed pattern of U2AF35 and the serine/arginine protein (TSR1), both related to the splicing machineries of T. cruzi and T. brucei, respectively (26, 50). Although unlikely, we cannot exclude that other genes, besides the SL RNA genes are transcribed in the SL gene spot.

We found that addition of actinomycin D and {alpha}-amanitin caused dispersion of RNA Pol II labeling, keeping unaffected the amount of the enzyme, even when using lysolecithin permeable cells, which would allow chromatin-dissociated enzyme to be washed out from the cells. Therefore, transcription inhibition causes mainly a redistribution of RNA Pol II in the T. cruzi nucleus, as found in other eukaryotic cells (27). In the case of actinomycin D, the RNA Pol II labeling intensity at the SL RNA was widely affected while the enzyme was still detected in other regions of the nucleus. In contrast, in the presence of {alpha}-amanitin, the major site of RNA Pol II labeling appears less inhibited compared to other nuclear regions. These observations support the idea that actinomycin causes RNA Pol II to stall, remaining attached to the DNA preferentially during transcription of long polycistronic messages. Accordingly, enzymatic inhibition by {alpha}-amanitin would cause RNA Pol II to concentrate close to initiation sites, abundant in the SL-RNA tandem repeats. Moreover, SL RNA transcription has been shown to be more resistant to {alpha}-amanitin than other RNA Pol II-transcribed genes (8). The reasons for this high resistance of SL RNA transcription are unknown. A possible explanation is that the gene encoding the SL RNA is short. Alternatively, the RNA Pol II would have a higher affinity for the SL RNA gene promoter due to the presence of specific transcription factors (22). We recall that experiments using permeable cells for transcription have to be carefully interpreted, as RNA Pol II localization and distribution is quite sensitive to the nuclear structure. For example, we observed that the presence of higher salt concentration or strong detergents affected the enzyme distribution and also the DNA distribution.

The fact that SL RNA genes are organized in a tandem array in T. cruzi (32) could be an obvious basis for the formation of this defined nuclear domain in which SL RNA transcription takes place. As trypanosomes are diploid and the SL RNA genes are probably located in homologous chromosomes, we should have detected at least two RNA Pol II spots in most cells. This was not the case. SL RNA genes were found concentrated mainly in a single spot in two-thirds of exponentially growing parasites. In the other third, two major spots were detected for both RNA Pol II labeling and SL RNA genes, indicating that not just the genome distribution but also transcription could congregate SL RNA genes into a nuclear domain. Perhaps parasites containing two spots had undergone replication and the SL RNA/RNA Pol II domain also replicates during the cell division cycle. We cannot exclude that some single-spot labeling corresponded to two superimposed domains, although we always detected a single RNA Pol II spot by confocal analysis. We observed that in the presence of actinomycin D, despite the complete disassembly of the RNA Pol II labeling, the localization of the SL RNA genes remained unaffected in epimastigotes (not shown). This result shows that active RNA Pol II is not sufficient to assemble the SL RNA genes and that specific transcription factors could be required to congregate the SL RNA genes. Similarly, actinomycin D also blocks rRNA gene transcription and did not disassemble the nucleolus in T. cruzi. In addition, the fact that tubulin genes, also thought to be in one long array (19) in at least in one pair of homologous chromosomes, appears as 3 to 6 spots, and the data showing that SL RNA gene localization in trypomastigotes is more dispersed reinforce the notion that the active transcription congregates the SL RNA genes, as described for several strong promoters (12). As recent findings demonstrate that active transcription in eukaryotic cells assembles in transcription factories and that genes undergoing transcription migrate to these factories (35), it should be further investigated if this T. cruzi RNA Pol II accumulation represents a general transcription factory, or it could just be the specific accumulation of the enzyme in the SL RNA genes.

Our data also showed that the SL RNA-associated RNA Pol II in T. cruzi was always close to the nucleolus. The reasons for this peculiar location are unclear. Perhaps the proximity with the nucleolus is because both SL RNA transcription and rRNA transcription use an interchangeable bipartite upstream element, recognized by the small nuclear RNA-activating protein complex (40). This upstream element is not present in the RNA polymerase I transcription of the variant surface glycoprotein (VSG) of T. brucei, which has also been found to form a nuclear structure dependent on active transcription but quite distant from the nucleolus (11, 33). Interestingly, tRNA transcription (by RNA polymerase III) in yeast clusters close to the nucleolus, independently of the chromosomal location of the genes (45). This tRNA transcription exerts an inhibitory effect on RNA Pol II transcription, except in the retrotransposons Ty1 to Ty4, which are inserted close to tRNA genes in yeast (6). Intriguingly, in trypanosomes, some retrotransposons are specifically inserted in SL RNA genes (5) and the SL RNA genes are organized within the 5S rRNA gene tandems in Trypanosoma rangeli (4). Alternatively, SL RNA transcription domain might be related to the assembly of snRNA seeing Cajal bodies of other eukaryotes, which are functionally or spatially connected to the nucleolus (20).

In conclusion, we have shown that RNA Pol II accumulates in a nuclear domain containing the SL RNA genes in T. cruzi. SL RNA is required to generate most of the cellular mRNAs by trans-splicing in several trypanosomes, and we are currently investigating whether this finding is general for trypanosomes. The SL RNA undergoes capping addition and posttranscriptional modifications, which may take place in this domain. These RNA processing reactions do not occur for other RNA Pol II-transcribed genes and could explain why there are two different transcription domains in trypanosomes. Thus, the identification of the factors that enable the formation of the SL RNA transcriptional domain may help to understand the unique machinery of several parasites, being good candidates for drug targets.


   ACKNOWLEDGMENTS
 
We thank Keith Gull, Bill Wickstead, and Maria Carolina Elias for discussions and suggestions. We also thank Beatriz A. Castilho for critically reading the manuscript, Renato Mortara for the use of the Confocal Microscope, and Marcelo Avedisian, Charles Lindsay, and Mariz Vainzof for the use of their microscope facilities.

This work was supported by grants from FAPESP and CNPq (Brazil). F.M.D. was a FAPESP (Brazil) fellow.


   FOOTNOTES
 
* Corresponding author. Mailing address: Departamento de Microbiologia, Imunologia e Parasitologia, Universidade Federal de São Paulo, R. Botucatu 862 8 o andar, 04023-062 São Paulo, Brazil. Phone: 55-11-55764551. Fax: 55-11-55715877. E-mail: sergio{at}ecb.epm.br. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abramoff, M. D., and M. A. Viergever. 2002. Computation and visualization of three-dimensional soft tissue motion in the orbit. IEEE Trans. Med. Imaging 21:296-304.[CrossRef][Medline]
  2. Abuin, G., L. H. G. Freitas-Junior, W. Colli, M. J. Alves, and S. Schenkman. 1999. Expression of trans-sialidase and 85 kDa glycoprotein genes in Trypanosoma cruzi is differentially regulated at the post-transcriptional level by labile protein factors. J. Biol. Chem. 274:13041-13047.[Abstract/Free Full Text]
  3. Agabian, N. 1990. Trans splicing of nuclear pre-mRNAs. Cell 61:1157-1160.[CrossRef][Medline]
  4. Aksoy, S., G. L. Shay, M. S. Villanueva, C. B. Beard, and F. F. Richards. 1992. Spliced leader RNA sequences of Trypanosoma rangeli are organized within the 5S rRNA-encoding genes. Gene 113:239-243.[CrossRef][Medline]
  5. Bhattacharya, S., A. Bakre, and A. Bhattacharya. 2002. Mobile genetic elements in protozoan parasites. J. Genet. 81:73-86.[Medline]
  6. Bolton, E. C., and J. D. Boeke. 2003. Transcriptional interactions between yeast tRNA Genes, flanking genes and Ty elements: a genomic point of view. Genome Res. 13:254-263.[Abstract/Free Full Text]
  7. Camargo, E. P. 1964. Growth and differentiation in Trypanosoma cruzi: origin of metacyclic trypomastigotes in liquid media. Rev. Inst. Med. Trop. Sao Paulo 6:93-100.
  8. Campbell, D. A., S. Thomas, and N. R. Sturm. 2003. Transcription in kinetoplastid protozoa: why be normal? Microbes Infect. 5:1231-1240.[CrossRef][Medline]
  9. Cano, M. I., A. Gruber, M. Vazquez, A. Cortés, M. J. Levin, A. Gonzalez, W. Degrave, E. Rondinelli, B. Zingales, J. L. Ramirez, C. Alonso, J. M. Requena, and J. F. Da Silveira. 1995. Molecular karyotype of clone CL Brener chosen for the Trypanosoma cruzi genome project. Mol. Biochem. Parasitol. 71:273-278.[CrossRef][Medline]
  10. Chapman, A. B., and N. Agabian. 1994. Trypanosoma brucei RNA polymerase II is phosphorylated in the absence of carboxyl-terminal domain heptapeptide repeats. J. Biol. Chem. 269:4754-4760.[Abstract/Free Full Text]
  11. Chaves, I., J. Zomerdijk, A. Dirks-Mulder, R. W. Dirks, A. K. Raap, and P. Borst. 1998. Subnuclear localization of the active variant surface glycoprotein gene expression site in Trypanosoma brucei. Proc. Natl. Acad. Sci. USA 95:12328-12333.[Abstract/Free Full Text]
  12. Cook, P. R. 2002. Predicting three-dimensional genome structure from transcriptional activity. Nat. Genet. 32:347-352.[CrossRef][Medline]
  13. Corden, J. L., and M. Patturajan. 1997. A CTD function linking transcription to splicing. Trends Biochem. Sci. 22:413-416.[CrossRef][Medline]
  14. Das, A., and V. Bellofatto. 2003. RNA polymerase II-dependent transcription in trypanosomes is associated with a SNAP complex-like transcription factor. Proc. Natl. Acad. Sci. USA 100:80-85.[Abstract/Free Full Text]
  15. Earnshaw, D. L., T. J. Beebee, and W. E. Gutteridge. 1987. Demonstration of RNA polymerase multiplicity in Trypanosoma brucei. Characterization and purification of alpha-amanitin-resistant and -sensitive enzymes. Biochem. J. 241:649-655.[Medline]
  16. Ejchel, T. F., M. I. Ramirez, N. Vargas, E. B. Nascimento, B. Zingales, and S. Schenkman. 2003. The largest subunit of the RNA polymerase II of Trypanosoma cruzi lacks the repeats in the carboxy-terminal domain and is encoded by several genes. Parasitol. Int. 52:243-249.[CrossRef][Medline]
  17. Elias, M. C., M. Faria, R. A. Mortara, M. C. M. Motta, W. de Souza, M. Thiry, and S. Schenkman. 2002. Chromosome localization changes in the Trypanosoma cruzi nucleus. Eukaryot. Cell 1:944-953.[Abstract/Free Full Text]
  18. Elias, M. C., R. Marques-Porto, E. Freymuller, and S. Schenkman. 2001. Transcription rate modulation through the Trypanosoma cruzi life cycle occurs in parallel with changes in nuclear organisation. Mol. Biochem. Parasitol. 112:79-90.[CrossRef][Medline]
  19. Ersfeld, K., K. Asbeck, and K. Gull. 1998. Direct visualisation of individual gene organisation in Trypanosoma brucei by high-resolution in situ hybridisation. Chromosoma 107:237-240.[CrossRef][Medline]
  20. Filipowicz, W., and V. Pogacic. 2002. Biogenesis of small nucleolar ribonucleoproteins. Curr. Opin. Cell Biol. 14:319-327.[CrossRef][Medline]
  21. Freistadt, M. S., G. A. Cross, A. D. Branch, and H. D. Robertson. 1987. Direct analysis of the mini-exon donor RNA of Trypanosoma brucei: detection of a novel cap structure also present in messenger RNA. Nucleic Acids Res. 15:9861-9879.[Abstract/Free Full Text]
  22. Gilinger, G., and V. Bellofatto. 2001. Trypanosome spliced leader RNA genes contain the first identified RNA polymerase II gene promoter in these organisms. Nucleic Acids Res. 29:1556-1564.[Abstract/Free Full Text]
  23. Gull, K. 2001. The biology of kinetoplastid parasites: insights and challenges from genomics and post-genomics. Int. J. Parasitol. 31:443-452.[CrossRef][Medline]
  24. Gunzl, A., E. Ullu, M. Dorner, S. P. Fragoso, K. F. Hoffmann, J. D. Milner, Y. Morita, E. K. Nguu, S. Vanacova, S. Wunsch, A. O. Dare, H. Kwon, and C. Tschudi. 1997. Transcription of the Trypanosoma brucei spliced leader RNA gene is dependent only on the presence of upstream regulatory elements. Mol. Biochem. Parasitol. 85:67-76.[CrossRef][Medline]
  25. Huang, J., and L. H. van der Ploeg. 1991. Maturation of polycistronic pre-mRNA in Trypanosoma brucei: analysis of trans splicing and poly(A) addition at nascent RNA transcripts from the hsp70 locus. Mol. Cell. Biol. 11:3180-3190.[Abstract/Free Full Text]
  26. Ismaili, N., D. Perez-Morga, P. Walsh, M. Cadogan, A. Pays, P. Tebabi, and E. Pays. 2000. Characterization of a Trypanosoma brucei SR domain-containing protein bearing homology to cis-spliceosomal U1 70 kDa proteins. Mol. Biochem. Parasitol. 106:109-120.[CrossRef][Medline]
  27. Kimura, H., K. Sugaya, and P. R. Cook. 2002. The transcription cycle of RNA polymerase II in living cells. J. Cell Biol. 159:777-782.[Abstract/Free Full Text]
  28. Luo, H., and V. Bellofatto. 1997. Characterization of two protein activities that interact at the promoter of the trypanosomatid spliced leader RNA. J. Biol. Chem. 272:33344-33352.[Abstract/Free Full Text]
  29. Mair, G., E. Ullu, and C. Tschudi. 2000. Cotranscriptional cap 4 formation on the Trypanosoma brucei spliced leader RNA. J. Biol. Chem. 275:28994-28999.[Abstract/Free Full Text]
  30. Martinez-Calvillo, S., D. Nguyen, K. Stuart, and P. J. Myler. 2004. Transcription initiation and termination on Leishmania major chromosome 3. Eukaryot. Cell 3:506-517.[Abstract/Free Full Text]
  31. Martinez-Calvillo, S., S. Yan, D. Nguyen, M. Fox, K. Stuart, and P. J. Myler. 2003. Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol. Cell 11:1291-1299.[CrossRef][Medline]
  32. McCarthy-Burke, C., Z. A. Taylor, and G. A. Buck. 1989. Characterization of the spliced leader genes and transcripts in Trypanosoma cruzi. Gene 82:177-189.[CrossRef][Medline]
  33. Navarro, M., and K. Gull. 2001. A pol I transcriptional body associated with VSG mono-allelic expression in Trypanosoma brucei. Nature 414:759-763.[CrossRef][Medline]
  34. Ogbadoyi, E., K. Ersfeld, D. Robinson, T. Sherwin, and K. Gull. 2000. Architecture of the Trypanosoma brucei nucleus during interphase and mitosis. Chromosoma 108:501-513.[CrossRef][Medline]
  35. Osborne, C. S., L. Chakalova, K. E. Brown, D. Carter, A. Horton, E. Debrand, B. Goyenechea, J. A. Mitchell, S. Lopes, W. Reik, and P. Fraser. 2004. Active genes dynamically colocalize to shared sites of ongoing transcription. Nat. Genet. 36:1065-1071.[CrossRef][Medline]
  36. Palancade, B., and O. Bensaude. 2003. Investigating RNA polymerase II carboxyl-terminal domain (CTD) phosphorylation. Eur. J. Biochem. 270:3859-3870.[Medline]
  37. Perry, K. L., K. P. Watkins, and N. Agabian. 1987. Trypanosome mRNAs have unusual "cap 4" structures acquired by addition of a spliced leader. Proc. Natl. Acad. Sci. USA 84:8190-8194.[Abstract/Free Full Text]
  38. Proudfoot, N. J., A. Furger, and M. J. Dye. 2002. Integrating mRNA processing with transcription. Cell 108:501-512.[CrossRef][Medline]
  39. Queiroz da Cruz, M., H. M. Brascher, J. R. Vargems, and A. Oliveira-Lima. 1991. Effect of actinomycin D on Trypanosoma cruzi. Experientia 47:89-92.[CrossRef][Medline]
  40. Schimanski, B., G. Laufer, L. Gontcharova, and A. Gunzl. 2004. The Trypanosoma brucei spliced leader RNA and rRNA gene promoters have interchangeable TbSNAP50-binding elements. Nucleic Acids Res. 32:700-709.[Abstract/Free Full Text]
  41. Spector, D. L. 2003. The dynamics of chromosome organization and gene regulation. Annu. Rev. Biochem. 72:573-608.[CrossRef][Medline]
  42. Sutton, R. E., and J. C. Boothroyd. 1986. Evidence for trans splicing in trypanosomes. Cell 47:527-535.[CrossRef][Medline]
  43. Szentirmay, M. N., and M. Sawadogo. 2000. Spatial organization of RNA polymerase II transcription in the nucleus. Nucleic Acids Res. 28:2019-2025.[Abstract/Free Full Text]
  44. Teixeira, S. M. 1998. Control of gene expression in Trypanosomatidae. Braz. J. Med. Biol Res. 31:1503-1516.[Medline]
  45. Thompson, M., R. A. Haeusler, P. D. Good, and D. R. Engelke. 2003. Nucleolar clustering of dispersed tRNA genes. Science 302:1399-1401.[Abstract/Free Full Text]
  46. Tschudi, C., and E. Ullu. 2002. Unconventional rules of small nuclear RNA transcription and cap modification in trypanosomatids. Gene Expr. 10:3-16.[Medline]
  47. Ullu, E., K. R. Matthews, and C. Tschudi. 1993. Temporal order of RNA-processing reactions in trypanosomes: rapid trans-splicing precedes polyadenylation of newly synthesized tubulin transcripts. Mol. Cell. Biol. 13:720-725.[Abstract/Free Full Text]
  48. Ullu, E., and C. Tschudi. 1990. Permeable trypanosome cells as a model system for transcription and trans-splicing. Nucleic Acids Res. 18:3319-3326.[Abstract/Free Full Text]
  49. Vanhamme, L., and E. Pays. 1995. Control of gene expression in trypanosomes. Microbiol. Rev. 59:223-240.[Abstract/Free Full Text]
  50. Vazquez, M., C. Atorrasagasti, N. Bercovich, R. Volcovich, and M. J. Levin. 2003. Unique features of the Trypanosoma cruzi U2AF35 splicing factor. Mol. Biochem. Parasitol. 128:77-81.[CrossRef][Medline]
  51. Xu, P., L. Wen, G. Benegal, X. Wang, and G. A. Buck. 2001. Identification of a spliced leader RNA binding protein from Trypanosoma cruzi. Mol. Biochem. Parasitol. 112:39-49.[CrossRef][Medline]
  52. Zeiner, G. M., N. R. Sturm, and D. A. Campbell. 2003. Exportin 1 mediates nuclear export of the kinetoplastid spliced leader RNA. Eukaryot. Cell 2:222-230.[Abstract/Free Full Text]

Eukaryotic Cell, May 2005, p. 960-970, Vol. 4, No. 5
1535-9778/05/$08.00+0     doi:10.1128/EC.4.5.960-970.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dossin, F. d. M.
Right arrow Articles by Schenkman, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dossin, F. d. M.
Right arrow Articles by Schenkman, S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Appl. Environ. Microbiol. Infect. Immun. J. Bacteriol.
Mol. Cell Biol. Microbiol. Mol. Biol. Rev. ALL ASM JOURNALS