| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Previous Article | Next Article ![]()
Eukaryotic Cell, May 2005, p. 948-959, Vol. 4, No. 5
1535-9778/05/$08.00+0 doi:10.1128/EC.4.5.948-959.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94143-2280
Received 2 March 2005/ Accepted 16 March 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The m7GpppN-cap of mRNA is recognized by eukaryotic initiation factor 4E (eIF4E), which interacts also with scaffold protein eIF4G (13, 30). The latter binds to an ATP-dependent RNA helicase, eIF4A, and ribosome-bound eIF3 to recruit the 40S small ribosomal subunit to the 5' end of an mRNA for translation initiation (14, 16, 20, 24). eIF4E is not only a translation initiation factor but also a protein that modulates the overall rate of translation and the mRNA selectivity of the translation apparatus (11, 13). The functional importance of eIF4E is illustrated by the lethality of eif4e gene disruption in Saccharomyces cerevisiae (3). Both the function and structure of eIF4E have been conserved throughout evolution; human and yeast homologues are 31% identical at the amino acid level, and human eIF4E can rescue eif4e gene disruption in S. cerevisiae (3). In spite of the variable N and C termini among the eIF4Es, a core of about 170 amino acids within the eIF4E molecule has been apparently well conserved among all eukaryotes (28, 32, 49). Deletion analysis of eIF4E in S. cerevisiae showed that this core region alone is sufficient for cap recognition (49). The three-dimensional structures of cap analogue-bound eIF4Es from mice (28), humans (48), and S. cerevisiae (29) have been resolved. They each contain an eight-stranded antiparallel ß-sheet on top of three
-helices in a cupped-hand shape. Two Trp residues, located within a narrow cavity inside the concave surface, hold the guanine residue of the cap analogue through
-
stacking interaction (4, 28, 29, 51), which is further stabilized by the hydrogen bonds among the purine base, the polypeptide backbone, and a conserved Glu residue. A third Trp residue recognizes the N7-methyl group of the cap structure, thus contributing to the specificity of cap binding (43).
Recently, multiple eIF4E homologues have been reported in mammals (43), Drosophila melanogaster (25), Caenorhabditis elegans (18, 21), plants (44), and Schizosaccharomyces pombe (38). This multiplicity could reflect simple redundancy but may also suggest more complex roles for the eIF4E isoforms beyond mere involvement with translation initiation. The issue was partially addressed in C. elegans, in which the existence of several eIF4E-like proteins was attributed to the necessity of recruiting mRNAs with different caps (7- and 2,2,7-methylguanosine) to the initiation complex (18, 21). In another case, one of the two eIF4Es in zebra fish, eIF4E-1B, cannot bind to the m7GpppN-cap structure and plays no apparent role in translation initiation. Though it shares 66% identity with human prototypical eIF4E and possesses a conserved cap-binding domain, its function remains unknown (19). In most other cases, the biological significance in multiple eIF4E-like proteins remains unclear. To distinguish the prototypical eIF4E protein in the initiation complex from the other eIF4E homologues in humans, the former has been renamed eIF4E-1 (20).
Giardia lamblia, a parasitic protozoan, is one of the deeply branched and most primitive eukaryotes based on phylogenetic analysis of its small rRNA, as well as many other proteins (1, 17, 42, 46). Within its small 12-Mb genome, most of the genes reported so far do not contain introns (36). Their transcripts have exceedingly short 5' untranslated regions (5'-UTRs), ranging from 0 to 14 nucleotides, and similarly short 3'-UTRs of 10 to 30 nucleotides (2). In a previous study, we demonstrated that translation of an mRNA in Giardia could initiate efficiently from the first initiation codon located only 1 nucleotide downstream from the m7GpppN-cap structure (26). When the 5'-UTR between the cap and AUG was lengthened beyond 9 nucleotides, translation initiation was decreased drastically. This is in contrast to what were observed in yeast and mammalian systems, in which a minimum of 20 nucleotides are required in the 5'-UTR to allow optimal ribosome scanning and prevention of scanning leakiness (22, 23). This interesting discrepancy between Giardia and higher eukaryotes suggests the presence of a unique and perhaps much simpler protein synthetic machinery in Giardia that may not depend on ribosome scanning but recognize the simple structure of cap-AUG as a sufficient signal for translation initiation. The precise cap structure in Giardia RNAs has, however, not yet been determined, even though m7GpppN-capped mRNA introduced into the cells appeared to express well (26). Eight m2,2,7GpppN-capped snRNA species were also identified in Giardia (35). Two of them, snRNA D and snRNA H, shared some common features with snoRNAs and were associated with fibrillarin, which suggested their location in the nucleolus and their potential role in rRNA processing and ribosome maturation (12, 34, 35).
To begin elucidating the structure of translation initiation machinery in Giardia, we describe in this report the identification and characterization of two eIF4E homologues. eIF4E2 binds to m7GpppN-cap and is apparently responsible for translation initiation as a functional equivalent of human eIF4E-1, whereas eIF4E1 binds to the m2,2,7GpppN-capped snoRNA-like molecules and is not involved with translation initiation. The protein is associated with a nucleolus-like structure in Giardia and could perform the function of a snoRNA cap-binding protein for rRNA processing and ribosome biogenesis (15).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Expression and purification of G. lamblia eIF4Es from transformed E. coli.
A colony of the transformed E. coli cells was cultured overnight in 50 ml of LB medium with 50 µg/ml kanamycin at 37°C. The culture was transferred into 1 liter of LB medium and incubated until the optical density at 600 nm reached
0.8. Isopropyl-ß-D-thiogalactopyranoside (IPTG) was then added to 200 µM, and the cells were incubated for another 2 h. The cells were harvested by centrifugation and suspended in lysis buffer (100 mM NaH2PO4, 10 mM Tris-Cl, 8 M urea, pH 8.0) at a ratio of 5 ml of buffer per g of wet cells. The C-terminally His-tagged recombinant protein was purified from the lysate under denatured conditions as suggested by the manufacturer (QIAGEN). Eluents thus collected were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot assay using mouse anti-His tag monoclonal antibody (1:1,000 dilution). Purified eIF4E1 and eIF4E2 (10 mg of each) were used to raise polyclonal antibodies in rabbits at Animal Pharm Services. The antisera thus obtained were titrated against the recombinant antigens by enzyme-linked immunosorbent assay and purified via two-step affinity chromatography using the ImmunoPure rProtein A immunoglobulin G (IgG) Plus Orientation column and the Immobilized E. coli lysate column (Pierce). The purified antibodies were titrated by enzyme-linked immunosorbent assay and used for subsequent immunoblotting and immunofluorescence assays.
m7GTP-Sepharose affinity column chromatography. Trophozoites of Giardia strains WB and WBI (WB strain infected with giardiavirus) in 1.4-liter fresh cultures (50) were cooled on ice for 20 min, harvested at 3,000 x g for 30 min, washed in phosphate-buffered saline (PBS) (137 mM NaCl, 8 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4), and suspended in 10 ml of buffer A (20 mM HEPES [pH 7.4], 150 mM KCl, 1 mM EDTA, 2 mM dithiothreitol) with two complete proteinase inhibitor tablets (Roche) added per 50 ml of buffer A. The cells were sonicated on ice at about 200 W for 3 min with 5-s bursts and 15-s intervals. The lysates were centrifuged for 20 min at 10,000 x g, and the supernatant was mixed with 1 ml of the m7GTP-Sepharose 4B slurry (0.5 ml of beads; Amersham), which was prewashed with 10 column volumes (CV) of water and then 10 CV of buffer A. The mixture was incubated at 4°C overnight and packed into a column. The flowthrough was collected, and the column was washed with 20 CV of buffer A and 20 CV of buffer A plus 0.1 mM GTP. Protein still attached to the column was eluted with 1 ml of buffer A plus 0.1 mM m7GTP four consecutive times.
Protein identification by MALDI-TOF mass spectrometry. Proteins in the final elute were separated in SDS-PAGE, and the gel was stained with E-Zinc as instructed by the manufacturer (Invitrogen). The specific protein band at about 20 kDa was cut off the gel and destained with the destaining buffer (Invitrogen). After reduction and alkylation, the protein band was treated with 12.5 µg/ml trypsin (Promega) at 37°C overnight. The digest, cleaned with ZipTipC18, was analyzed with a matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry instrument (Voyager DE-STR mass spectrometer; Applied Biosystems). Molecular weights of individual peptide peaks were collected to BLAST the National Center for Biotechnology Information genome database using MS-FIT of the ProteinProspector program, version 4.0.5, from the University of California San Francisco (5).
Western blot analyses. Electrotransfer of protein was carried out at 80 V in 10% (vol/vol) methanol-25 mM Tris-Cl (pH 7.4)-192 mM glycine at 4°C for 1 h. Polyvinylidene difluoride membranes were blocked with 5% milk in TBST buffer (50 mM Tris-Cl [pH 8.0], 200 mM NaCl, 0.1% Tween 20) and incubated with mouse monoclonal anti-c-myc IgG (1:5,000 dilution) and rabbit polyclonal anti-Giardia eIF4E1 or eIF4E2 antibodies. Horseradish peroxidase-conjugated goat anti-mouse or anti-rabbit antibodies (1:10,000 dilution; Amersham) were then added prior to washing and visualization with enhanced chemiluminescence (Amersham).
Cap-binding specificity assay. A 200-bp DNA fragment containing the T7 promoter and an AAGAAACC stretch before the ATG initiation codon was digested from pGiaLuc (26) with EcoRI/BstXI and gel purified. The fragment was used as the template for in vitro synthesis of the 178-nucleotide RNA molecule with T7 RNA polymerase in the presence of 12 mM m7G(5')ppp(5')G or 12 mM m2,2,7G(5')ppp(5')G as suggested by the manufacturer (Ambion). The product was purified by phenol-chloroform extraction and ethanol precipitation and examined for integrity by electrophoresis in a 1.5% agarose gel. The concentration of each mRNA sample was estimated at 260 nm in a Beckman DU7 spectrophotometer.
The RNA sample (3 µg) in 50 µl of TE buffer (10 mM Tris-Cl [pH 8.0], 1 mM EDTA) was labeled with biotin using the BrightStar Psoralen-Biotin nonisotopic labeling kit in accordance with the instructions of the manufacturer (Ambion). The excess biotin was removed by n-butanol extraction, and the two biotinylated RNA samples were used in the in vitro pulldown experiments described as follows.
Constructs pGBK4E1 and pGBK4E2 with T7 promoters and HA or c-myc located at the 5' ends of the eIF4E1 and eIF4E2 open reading frames, respectively, were each used as a template in the rabbit reticulocyte TnT quick coupled transcription-translation system (Promega) for in vitro synthesis of the corresponding proteins. The reaction mixtures (5 µl of eIF4E1 and 20 µl of eIF4E2) were each incubated with 1 µg of the biotinylated RNA sample described above in 500 µl of the binding buffer (50 mM HEPES-KOH [pH 7.6], 50 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 5%[vol/vol] glycerol) at 4°C for 60 min and centrifuged at 12,000 rpm for 3 min to remove any aggregated material. Preblocked streptavidin-Sepharose beads (Novagen) were added to the supernatant, and the mixture was incubated at 4°C for 60 min with gentle shaking. The beads were washed twice with the binding buffer, and the bound proteins were eluted off the beads with 200 µM GTP, m7GTP, or m2,2,7GpppG. Aliquots of the collected fractions were analyzed by SDS-PAGE.
Complementation in S. cerevisiae. The pGADT7 vector (Invitrogen) was converted to pGADT7' by removing the AD domain and the hemagglutinin (HA) tag peptide domain. pGADT7' was used to construct the expression cassette of Giardia eIF4E1 and eIF4E2 in yeast. The two cDNAs were removed from pET4E1 and pET4E2 with NdeI/XhoI digestion and inserted into pGADT7'. Yeast eIF4E in pYCP33-supex2 (a kind gift from John McCarthy of UMIST) was removed by NdeI/EcoRI and inserted into pGADT7' as the positive control. The recombinant constructs were verified by restriction enzyme digestion and DNA sequencing.
The S. cerevisiae yTHC strain YSC1180-7428777 (Open Biosystems) was grown in liquid YPD broth containing 200 µg/ml Geneticin to be made competent for transformation. Cells transformed with the construct were plated on Leu and Geneticin plates and incubated at 30°C for 3 days. Cell colonies were selected, and the cells from individual colonies were used in various dilutions to inoculate plates with 10 µg/ml doxycycline and incubated at 30°C for 2 days.
Ribozyme knockdown of gene expression in G. lamblia.
Fragments (
400 bp) of the 5' ends of the Giardia eIF4E1 and eIF4E2 cDNAs were each inserted into the pC631neo plasmid in which neo was used to substitute for pac in the pC631pac plasmid (40). A hammerhead ribozyme sequence was introduced into the constructs by site-directed mutagenesis using two pairs of primers (7, 8, 33): 4E1RZ1 (CGAGGAGCTCTGGCGTGTTTCGTCCTCACGGACTCATCAGGTCGATAACATCCC) plus 4E1RZ2 (GGGATGTTATCGACCTGATGAGTCCGTGAGGACGAAACACGCCAGAGCTCCTCG) and 4E2RZ1 (GCTATCAGTTTTTGCGTTTCGTCCTCACGGACTCATCAGGGCCCAACGTTATTGAC) plus 4E2RZ2 (GTCAATAACGTTGGGCCCTGATGAGTCCGTGAGGACGAAACGCAAAAACTGATAGC).
The two final constructs, pC631neo4E1RZ and pC631neo4E2RZ, together with pC631neo as a negative control, were each linearized by NdeI and transcribed in vitro with T7 RNA polymerase as instructed by the manufacturer (Ambion). The RNA thus synthesized, containing an antisense sequence of eIF4E1 or eIF4E2 plus an inserted hammerhead ribozyme, was electroporated into Giardia WBI trophozoites by a previously described procedure (26, 52). G418 (200 µg/ml) was added to the cell culture for selection of transfectants. When cells grew to confluency, G418 was increased stepwise to 4 mg/ml and the incubation continued until confluency was reached again each time. The efficiency in knocking down the target mRNA was examined by semiquantitative RT-PCR, and the growth of transfectants was monitored in three independent experiments and presented with calculated standard deviations.
Semiquantitative RT-PCR. Total RNA was extracted from antisense RNA-ribozyme-transfected Giardia trophozoites, and the concentration of each RNA sample was measured spectrophotometrically. An equal quantity of RNA was used as the template in a semiquantitative one-step RT-PCR (Invitrogen) using primers of corresponding genes as instructed by the manufacturer. DNA fragments resulting from RT-PCR and identified in agarose gel were quantitated by laser densitometer tracing.
In vitro transcription, RNA transfection of Giardia, and luciferase assay. The luciferase-containing plasmid pGiaLuc mentioned above (26) was linearized with SacII and used as the template for in vitro synthesis of the luciferase mRNA as suggested by the manufacturer (Ambion) in the presence of 15 mM GTP, 12 mM m7G(5')ppp(5')G, or 12 mM m2,2,7G(5')ppp(5')G. The products were purified by phenol-chloroform extraction and ethanol precipitation and examined for integrity by electrophoresis in 1.5% agarose gel. The concentration of each mRNA sample was estimated by its absorbance at 260 nm in a Beckman DU7 spectrophotometer, and 20 µg of each in vitro transcript was introduced into Giardia WBI trophozoites by electroporation (26). The luciferase activity thus expressed in Giardia was assayed 4 h after electroporation as previously described (26).
Pulldown of Giardia snRNAs by GST-fused eIF4E1. The Giardia eIF4E1 gene was cloned into pGEX4T-3 vector between BamHI and NotI restriction sites, and the recombinant plasmid, pGEX4E1, confirmed by DNA sequencing, was transformed into E. coli BL21(DE3) cells. The eIF4E1 protein fused with glutathione S-transferase (GST) at its N terminus was overexpressed and purified following the instruction of the manufacturer (Amersham). Four micrograms of the fusion protein was incubated with 40 µg of Giardia total RNA for 1 h. Glutathione-Sepharose 4B beads (50 µl), thoroughly washed with PBS and preincubated with 1 mg of yeast tRNA and 1 mg of salmon sperm DNA, were incubated with the protein-RNA mixture for 30 min at room temperature. After a thorough wash, the beads were eluted with glutathione and the eluate was extracted with phenol and precipitated. One-tenth of the RNA sample was used for semiquantitative RT-PCR assay using primers RNA D5 (5'-GTCCTAGACGCGTCCTGGGATAATGC-3') and RNA D3 (5'-AAGGACTATAGGGGCGGTGATTAGGC-3') for snRNA D, primers RNA H5 (5'-CTGCCTCTCCTGAGGCAGATG-3') and RNA H3 (5'-GAATTCAGAATACGACAAACTTCG-3') for snRNA H, and primers RNA J5 (5'-AATGTAGCGAACCCACGCGCAAGC-3') and RNA J3 (5'-ATTAAGTAAGGAAGGCTCGGACATCC-3') for snRNA J.
Immunofluorescence assays. Giardia trophozoites cultivated in vitro were harvested, washed with PBS three times, and fixed in 4% paraformaldehyde in PBS for 30 min. The cells were then washed three times in PEM buffer (100 mM PIPES, 2 mM EGTA, 0.1 mM EDTA, 1 mM MgSO4, pH 6.9), permeabilized with 0.1% Triton X-100 for 5 min, and washed another three times with PEM buffer. The fixed cells were blocked in blocking buffer (2% bovine serum albumin and 0.1% Triton X-100 in PBS) for 60 min at room temperature and incubated with the following primary antibodies for another 60 min: purified anti-eIF4E1 rabbit polyclonal antibodies (1:100 final dilution), purified anti-eIF4E2 rabbit polyclonal antibodies (1:100 final dilution), mouse monoclonal antibody against yeast fibrillarin (1:500 final dilution), and mouse monoclonal antibody against the m2,2,7G cap structure (1:100 final dilution). Alexa Fluor 488- or 555-conjugated secondary donkey antibodies against mouse or rabbit IgG (1:500 dilution; Invitrogen) were then applied to the cells and incubated for another 60 min at room temperature. Slides were mounted in the presence of 1 µg/ml of 4',6'-diamidino-2-phenylindole (DAPI) and examined under an Olympus 1X70 microscope equipped with bright-field and epifluorescence optics. The images were acquired with the MetaVue software.
RNA fluorescence in situ hybridization. Giardia trophozoites were harvested, suspended in PBS, placed on coverslips pretreated with 0.5% poly-L-lysine, and incubated at 37°C for 30 min to allow the trophozoites to adhere. The cells were then fixed in 4% paraformaldehyde for 30 min at room temperature and washed with PBS and 2x SSC (300 mM NaCl, 30 mM sodium citrate) each for 5 min. Triton X-100 (0.5%) was added and incubated for 15 min at room temperature, and the cells were dehydrated in 70% and 100% ethanol and denatured in 70% formamide in 2x SSC at 70°C for 2 min and dehydrated again in 70% ethanol (20°C) and 100% ethanol each for 5 min. After a further treatment with 1 µl/ml of proteinase K at 37°C for 30 min, the cells were washed with 70% and 100% ethanol for 5 min at 20°C and air dried.
A 30-mer oligonucleotide, 5'-CACCTACGGATACCTTGTTACGACTTCTCC-3', which is complementary to the nucleotide 1403 to 1432 sequence of the Giardia 16S-like rRNA, was synthesized by Operon with fluorescein isothiocyanate (FITC) labeling at the 5' end. Ten picomoles of the labeled probe was mixed with 10 µg of salmon DNA and 10 µg of S. cerevisiae tRNA, dried, suspended in 10 µl of 100% formamide, denatured at 95°C for 10 min, and placed immediately on ice. An equal volume of hybridization buffer (4x SSC, 20% dextran sulfate, 4 mg/ml bovine serum albumin) was added. The cells were hybridized with the probe overnight at 37°C and washed in 2x SSC with 50% formamide at 37°C for 30 min, followed by 2x SSC at 37°C and 1x SSC at room temperature for 30 min. The coverslips were mounted and examined using an Olympus 1X70 microscope equipped with bright-field and epifluorescence optics. The images were acquired with the MetaVue software.
| RESULTS |
|---|
|
|
|---|
The sequence of Giardia eIF4E1 encodes a putative protein of 218 amino acids with an estimated molecular mass of 25,129 Da. It shares 13% identity and 29% similarity with human eIF4E-1 (Fig. 1A) and contains four out of the eight conserved Trp residues in human eIF4E-1 and three of the other four residues are two Tyr and one Phe. For the two Trp residues (Trp56 and Trp102) in human eIF4E-1 that are known to hold the guanine moiety of the cap, Trp56 is replaced with Phe whereas Trp102 remains unchanged at the corresponding positions in Giardia eIF4E1. The conserved Glu103 in human eIF4E-1 that stabilizes the interaction with the cap and a third Trp residue (Trp166 in human eIF4E-1) that recognizes the N7-methyl group of the cap structure remain also conserved in Giardia eIF4E1. Thus, in spite of the relatively poor sequence identity with human eIF4E-1, Giardia eIF4E1 could still function as a cap-binding protein. There is also in Giardia eIF4E1 a basic amino acid-rich sequence, RRSSRAPSEERSRTHKR, at the C terminus (Fig. 1A), which was predicted to be a bipartite nuclear localization signal, suggesting that eIF4E1 may locate and even function in the nucleus.
|
Alignment of the two Giardia eIF4E amino acid sequences with each other showed that they are not similar to each other at all except for some of the conserved residues in the 170-amino-acid core. Even there, there are only 8% identity and 20% similarity (Fig. 1A), suggesting that though both proteins may be able to bind to the cap structure, they may perform distinctive biological functions in Giardia.
Phylogenetic analysis revealed that the two Giardia eIF4Es are highly divergent from all the other eIF4Es (Fig. 1B). While eIF4E1 is the farthest removed from the others, eIF4E2 shows a closer relationship only to C. elegans eIF4E4 and Arabidopsis thaliana nCBP. It verifies the fact that Giardia is one of the most deeply branched eukaryotes and raises the interest in identifying the precise functions of these two proteins in Giardia.
cDNAs containing the complete open reading frame sequences of eIF4E1 and eIF4E2 were amplified by RT-PCR from Giardia mRNAs. The two recombinant proteins, each tagged with a hexahistine peptide at the C terminus, were overexpressed in transformed E. coli, purified under denaturing conditions (see Fig. S1 in the supplemental material), and used to raise antibodies in rabbits (see Materials and Methods).
Neither Giardia homologue can complement an eIF4E knockout in S. cerevisiae. Since human eIF4E-1 is capable of complementing the eIF4E function in S. cerevisiae (3) in spite of the sequence divergence (31% identity), we tested the two homologues from Giardia for complementing the function of yeast eIF4E (3). In S. cerevisiae yTHC strain YSC1180-7428777, the promoter of endogenous eIF4E was replaced with a tetracycline-titratable promoter. Thus, the expression of endogenous eIF4E can be switched off by doxycycline, forcing dependence of cell growth on an ectopic expression of another functional eIF4E. cDNAs of the two Giardia eIF4Es, as well as yeast eIF4E, were each cloned into pGADT7', which has a LEU selection marker and allows insert expression from the constitutive ADH1 promoter. Following transformation and selection for transformants in leucine-deficient medium, cell cultures were applied to doxycycline-containing plates in serial dilutions. The outcome (Fig. 2) indicates that neither eIF4E1 nor eIF4E2 from Giardia is capable of rescuing the growth of yeast lacking endogenous eIF4E. The failure could be attributed to the significant sequence divergence between Giardia and yeast eIF4Es (18% identify for eIF4E1 and 15% for eIF4E2). It could also raise doubt about whether the two homologues perform a function in Giardia similar to that of yeast eIF4E in S. cerevisiae.
|
Lysate of Giardia trophozoites was subjected to m7GTP-Sepharose affinity column chromatography. Column eluates were fractionated by SDS-PAGE and visualized with E-Zinc staining (Fig. 3A). One protein band with an estimated molecular mass of 20 kDa was eluted with m7GTP and tentatively designated a cap-binding protein (Fig. 3A, lane 5). The gel containing this protein band was removed, digested with trypsin, and subjected to MALDI-TOF mass spectrometric analysis (see Fig. S2 in the supplemental material). A database search using the peptide masses thus obtained resulted in identification of a single match, eIF4E2, with 46% of its sequence covered by the identified peptides. There is thus little doubt that eIF4E2 is expressed in Giardia and that it binds to the m7GpppG-cap structure.
|
Distinctive cap-binding specificities of eIF4E1 and eIF4E2. The cap-binding properties of HA-tagged eIF4E1 and c-myc-tagged eIF4E2, both synthesized from the rabbit TnT quick coupled transcription-translation reticulocyte system, were further examined by m7GTP affinity column chromatography. Effluents from the column were examined by Western blot analysis. The results indicated that eIF4E1 was not retained by the column (Fig. 4A), whereas eIF4E2 was retained and eluted only by m7GTP (Fig. 4B).
|
Only eIF4E2 plays an essential function in protein synthesis in Giardia. To elucidate whether eIF4E1, eIF4E2, or both perform an essential function in Giardia, an antisense-ribozyme strategy with a viral vector, which has been proven efficient for specific gene knockdowns in Giardia (7, 8, 33), was utilized. An in vitro transcript of the antisense sequence from a fragment of eIF4E1 or eIF4E2 cDNA with an inserted hammerhead ribozyme sequence was introduced into Giardia trophozoites, multiplied by the giardiavirus RNA replicating machinery in the cells, and enriched under drug pressure. Semiquantitative RT-PCR and densitometer tracing showed that in the eIF4E1 knockdown experiment, the mRNA of eIF4E1 was reduced to 37% of the original level, while that of eIF4E2 remained relatively unchanged (Fig. 5B, inset). For the eIF4E2 knockdown, the eIF4E2 mRNA was decreased to 19% whereas eIF4E1 mRNA remained unaffected (Fig. 5C inset). Growth of the eIF4E1 knockdown cells reached about 80% of the control (Fig. 5B), whereas eIF4E2 knockdown resulted in only 30% cell growth (Fig. 5C). These outcomes suggest that each protein may perform certain role in Giardia trophozoites, but eIF4E2 appears to play a more essential function in cell growth.
|
To verify if translation initiation in Giardia is mediated by m7GpppN-cap, m2,2,7GpppN-cap or no cap at all, a firefly luciferase transcript without a cap or with the m7GpppG-cap or m2,2,7GpppG-cap structure was electroporated into Giardia trophozoites. No luciferase activity could be detected from the cells transfected with the transcript without a cap or with the m2,2,7GpppG cap structure (see Fig. 7A), but cells transfected with the m7GpppG-capped luciferase transcript expressed a significant level of luciferase activity (Fig. 6A), indicating that m7GpppN-cap is most likely the cap of Giardia mRNAs and functions in translation initiation. The observation also agrees with the previous findings that eIF4E2 is most likely the cap-binding protein involved in translation initiation (Fig. 5D) and that it binds to the m7GpppG-cap structure (Fig. 3 and 4B).
|
|
Localization of the two eIF4E proteins in Giardia trophozoites. As the two eIF4Es bind to different cap structures and may perform distinctive functions in Giardia, we asked whether this might be reflected in their intracellular distribution. Immunofluorescence assays using purified rabbit polyclonal antibodies against eIF4E1 and eIF4E2 revealed very different patterns of distribution for the two proteins (Fig. 7). Although both proteins were identified in the cytoplasm of Giardia, eIF4E1 also showed a concentrated presence in a nucleolus-like structure in the nucleus (Fig. 7, top panel). To verify this observation, two more monoclonal antibodies against the m2,2,7GpppN-cap structure and the nucleolus marker fibrillarin (37) were used in the immunofluorescence assay and showed that eIF4E1 was indeed colocalized with the cap and fibrillarin in the nucleolus-like structures in both nuclei of Giardia (Fig. 8A). The nucleolus-like structure was mostly located at the anterior end of the nucleus. Its identity was further verified in an RNA fluorescence in situ hybridization study using FITC-conjugated oligonucleotide complementary to the 3' end of Giardia 16S-like rRNA molecule. The results indicated the presence of the 16S-like rRNA in the nucleolus-like organelles at the anterior ends of the nuclei (Fig. 8B) similar to those structures containing eIF4E1, m2,2,7GpppN-cap, and fibrillarin (Fig. 7, top panel, and 8A).
|
| DISCUSSION |
|---|
|
|
|---|
The structural basis for the specific binding between eIF4E1 and m2,2,7GpppN-cap is a little more difficult to envision. The five eIF4E variants found in C. elegans have eIF4E-3 and eIF4E-4 binding only to the m7GpppN-cap, whereas eIF4E-1, eIF4E-2, and eIF4E-5 bind to both m7GpppN- and m2,2,7GpppN-cap (21). Molecular dynamic simulation suggested that the width and depth of the cap-binding cavity were smaller in eIF4E-3 than in eIF4E-5 (31). Site-directed mutations of eIF4E-5 aimed at reducing the size of its cap-binding cavity resulted in a mutant binding only to m7GpppN-cap. This well-derived structural basis for selective cap binding cannot, however, explain the specific binding to only the trimethyl-cap by Giardia eIF4E1. In view of the vastly divergent amino acid sequence of eIF4E1 compared with those of the other eIF4Es, it is possible that a different structural basis may underlie the binding specificity of this Giardia protein, which will have to wait for the resolution of its three-dimensional structure.
Giardia eIF4E2 binds only to m7GpppN-cap and is most likely involved in translation initiation in Giardia. The fact that only transcripts with the m7GpppN-cap are translated in Giardia has further confirmed this conclusion. This is the first translation initiation protein identified in Giardia thus far.
By the knowledge from other eukaryotes, His37, Pro38, Val69, Trp73, Leu131, Glu132, and Leu135 in eIF4E (by human eIF4E-1 numbering) are involved in interacting with the scaffold protein eIF4G and 4E-BPs (27). Val69 and Trp73 are located in a conserved sequence (S/T)V(E/D)(E/D)FW in which substitution of the third residue E in yeast eIF4E with either A or D reduced the interaction with eIF4G (39). A comparison between Giardia eIF4E2 and human eIF4E-1 indicated that residues corresponding to His37, Pro38, and Leu131 are missing from the Giardia protein. Val69 is replaced by Leu and Trp73 is substituted by Phe, whereas Glu132 and Leu135 remain unchanged. The conserved sequence (S/T)V(E/D)(E/D)FW is changed to SLKAFF (Fig. 1). These drastic changes in the Giardia protein raise the possibility that either the eIF4G homologue in Giardia is also altered significantly in its eIF4E-binding domain or it does not exist. The composition of the initiation complex in Giardia could be radically different from those in the higher eukaryotes.
Using various domains in human eIF4G1 that are known to bind to the mRNA, poly(A)-binding protein, eIF4E, eIF4A, eIF3, and mitogen-activated protein kinase signal-integrating kinase 1 (4) as individual queries in mining the Giardia genome data bank, a 410-amino-acid protein was identified (accession number EAA40087). It has a 73-amino-acid stretch at the C terminus bearing 28.8% sequence identity with a portion of the eIF4A-binding domain in eIF4G1. The other binding domains are, however, all missing from this protein. It is dubious whether this protein is a bona fide initiation factor performing the function of a scaffold in the translation initiation complex of Giardia. An eIF4A homologue (EAA36655 [GenBank] was, however, identified and shown to function in translation initiation in Giardia (unpublished data), whereas homologues of eIF4B and eIF4H could not be found in Giardia. These two proteins are the RNA-binding factors thought to promote eIF4A to unwind the RNA secondary structure near the 5' end of the mRNA presumably required for ribosome scanning (26). Their absence may verify our previous observation (26) that translation initiation in Giardia may not include ribosome scanning but leaves the structure of the initiation complex even more obscure.
The Archaea, which are the closest relatives to the nuclear components of eukaryotes, have uncapped mRNA with very short or no 5'-UTR (9). They also possess a regiment of initiation factors that are clearly homologous to those in the eukaryotes that participate in identifying the initiation codon. In Methanobacterium jannaschii, the presence of eIF1, eIF1A, eIF2, and eIF4A was verified, but eIF2B, eIF4B, eIF4E, eIF4G, eIF4H, and eIF5 were not found (9). This similar deficiency of initiation factors between Archaea and Giardia suggests a simple initiation complex shared by the two with the additional presence of cap-binding protein eIF4E2 in the latter. The composition of this relatively simple complex in Giardia will be further pursued by monitoring protein-protein interactions in future studies.
| ACKNOWLEDGMENTS |
|---|
This work was supported by grant AI-30475 from the National Institutes of Health.
| FOOTNOTES |
|---|
Supplemental material for this article may be found at http://ec.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||