Eukaryotic Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Klinkenberg, L. G.
Right arrow Articles by Zitomer, R. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Klinkenberg, L. G.
Right arrow Articles by Zitomer, R. S.
Eukaryotic Cell, April 2005, p. 649-660, Vol. 4, No. 4
1535-9778/05/$08.00+0     doi:10.1128/EC.4.4.649-660.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Combinatorial Repression of the Hypoxic Genes of Saccharomyces cerevisiae by DNA Binding Proteins Rox1 and Mot3

Lee G. Klinkenberg, Thomas A. Mennella, Katharina Luetkenhaus, and Richard S. Zitomer*

Department of Biological Sciences, University at Albany—State University of New York, Albany, New York

Received 6 January 2005/ Accepted 4 February 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The hypoxic genes of Saccharomyces cerevisiae are transcriptionally repressed during aerobic growth through recruitment of the Ssn6/Tup1 general repression complex by the DNA binding protein Rox1. A second DNA binding protein Mot3 enhances repression of some hypoxic genes. Previous studies characterized the role of Mot3 at the hypoxic ANB1 gene as promoting synergy among one Mot3 site and two Rox1 sites comprising operator A of that gene. Here we studied the role of Mot3 in enhancing repression by Rox1 at another hypoxic gene, HEM13, which is less strongly regulated than ANB1 and has a very different arrangement of Rox1 and Mot3 binding sites. By assessing the effects of deleting Rox1 and Mot3 sites individually and in combination, we found that the major repression of HEM13 occurred through three Mot3 sites closely spaced with a single Rox1 site. While the Mot3 sites functioned additively, they enhanced repression by the single Rox1 site, and the presence of Rox1 enhanced the additive effects of the Mot3 sites. In addition, using a Rox1-Ssn6 fusion protein, we demonstrated that Mot3 enhances Rox1 repression through helping recruit the Ssn6/Tup1 complex. Chromatin immunoprecipitation assays indicated that Rox1 stabilized Mot3 binding to DNA. Integrating these results, we were able to devise a set of rules that govern the combinatorial interactions between Rox1 and Mot3 to achieve differential repression.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The response of the budding yeast Saccharomyces cerevisiae to hypoxia and anaerobiosis involves the induction of multiple regulons. One of these, characterized by a rapid induction of many oxygen utilizing functions, consists of about 70 Rox1, Ssn6/Tup1 repressed genes (21, 45, 46). Tup1 and Ssn6 form an in vivo general repression complex (33, 39, 40) that represses multiple, otherwise unrelated regulons. Repression is effected by at least two mechanisms. First, Tup1 binds to the amino-terminal tails of histone H3 and H4 and recruits the histone deacetylase Hda1, thereby phasing a nucleosome over the TATA region of a promoter and blocking TATA binding protein recruitment (4, 12, 34, 41). Second, there is a chromatin-independent mechanism that is less well characterized (14, 16, 30, 43). At many genes, these mechanisms are redundant (29, 44).

The Ssn6/Tup1 complex has no intrinsic DNA binding activity and is targeted to specific regulons through recruitment by regulon-specific DNA binding proteins (6, 17, 24, 31, 32, 36, 37). For the hypoxic genes, regulation is controlled by the DNA binding protein Rox1 and, for many but not all hypoxic genes, Mot3 (3, 20, 46). Rox1 recruits Ssn6/Tup1 by an interaction with the TPR (tetratricopeptide repeat) domain of Ssn6 (38). Repression of the hypoxic genes is directly related to the level of Rox1 protein in cells (8). The ROX1 gene is transcriptionally induced aerobically and repressed anaerobically by the DNA binding protein Hap1 which senses oxygen levels through cellular heme levels (22). Heme biosynthesis requires molecular oxygen in two tandem steps, first as an electron acceptor for oxidative decarboxylation and then for oxidation of two methylene groups to methenyl groups. The first of these two steps is rate limiting under hypoxic conditions (42). The Rox1 protein is highly labile, rapidly disappearing from the cell when ROX1 transcription is repressed at the onset of hypoxia. Finally, ROX1 is also auto-regulated, which tightly controls the protein's cellular levels (8).

The role of Mot3 in hypoxic gene regulation is less clear. Mot3 affects the expression of a large, eclectic collection of genes (15, 28). It appears to play a major role in the aerobic repression of a true anaerobic set of genes (35), but its role in repression of the Rox1 hypoxic regulon is secondary for some genes, while others are not affected by Mot3 at all (20). Mot3 does not bind cooperatively with Rox1 in vitro (20), and chromatin immunoprecipitation experiments indicated that it can recruit Ssn6 in the absence of Rox1 (29). However, at ANB1, this Rox1-independent Ssn6 recruitment does not result in a repression-competent complex.

Our previous analysis has focused on one hypoxic gene, ANB1 which is repressed over 200-fold. In the absence of Rox1, ANB1 is fully derepressed, while a mot3 deletion results in only a fourfold depression (20). The ANB1 regulatory region contains two operators, A and B, each of which contains two Rox1 sites. Operator A also contains a single Mot3 site, and it is this operator which is responsible for the bulk of aerobic repression (8, 20). The full Rox1, Mot3, Ssn6/Tup1 complex results in the positioning of a nucleosome over the ANB1 TATA box; while in the absence of Mot3, this positioned nucleosome is lost, although repression is maintained through a chromatin-independent mechanism (20). Not all hypoxic genes are expected to be regulated in the same manner. First, not all hypoxic genes are repressed to the same extent. ANB1 encodes the a subunit of eukaryotic initiation factor 5 (eIF-5a), an essential translation factor, but there is an aerobic homologue, TIF51A (19). As a result, ANB1 can be completely repressed. While aerobic homologues exist for a number of hypoxic genes, others are unique. For these, some level of expression is required under aerobic conditions and repression is less severe. Second, the arrangement and numbers of Rox1 and Mot3 sites are quite different in different genes.

HEM13 is a less strongly regulated hypoxic gene. It encodes the enzyme coproporphyrinogen III oxidase, which catalyzes the rate-limiting step in heme biosynthesis (42). The hypoxic derepression of this gene allows the cell to continue heme biosynthesis under limiting oxygen. Since HEM13 is the only gene encoding coproporphyrinogen oxidase, it cannot be as strongly repressed as the duplicated ANB1 gene, and consequently, it is regulated over a much narrower range than ANB1.

HEM13 contains five putative Mot3 sites interspersed among four widely spaced Rox1 sites. A previous study involved a detailed analysis of the activation sequences of HEM13 and repression by the three coding-sequence-proximal Rox1 sites (1). The authors concluded that the most distal one was responsible for most of the repression. Interestingly, this site is closely flanked by three of the five Mot3 sites in the regulatory region of HEM13. In this study, we further investigated the repression at this gene, focusing on the relationship between the Mot3 and Rox1 sites and the role of Mot3 in repression. We report here a combinatorial repression mechanism involving the cooperative recruitment of the Ssn6/Tup1 complex by Rox1 and Mot3. The combination of sites determines the strength of repression.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Strains and growth conditions. The strains used in this study are listed in Table 1. KZ211-21 and KZ211-14 were meiotic products of the mating of RZ53-6{Delta}r{Delta}m with MZ65-88 by standard yeast genetics (18). Yeast cultures were grown at 30°C, in rich yeast extract-peptone-dextrose medium or synthetic complete medium lacking the appropriate nutrient to select for plasmid maintenance. Anaerobic growth was achieved by bubbling N2 gas through the medium. Yeast transformations were performed by using standard techniques (18).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Strains used

 
Plasmids. All plasmid constructions were carried out by using standard techniques as described previously (2). Genomic sequences were obtained from the Saccharomyces Genome Database maintained at Stanford University (http://www.yeastgenome.org). The sequences for all genes discussed are numbered with the adenine of the start codon numbered +1, bases 5'-wards numbered negatively, and bases 3'-wards numbered positively. The sequences of oligonucleotides used are available upon request.

(i) YCpAZ33. The ANB1-lacZ fusion plasmid YCpAZ33 has been described previously (13).

(ii) HEM13-lacZ fusions. The upstream region of HEM13 from –983 to +3 was PCR amplified from genomic DNA prepared from RZ53-6 as described previously (18), generating EagI and PstI restriction sites at the 5' and 3' ends, respectively. This promoter region was inserted as an EagI-PstI fragment into YCp(33)ROX1-lacZ (8), replacing the ROX1 promoter with that of HEM13 to generate the lacZ fusion plasmid YCp(33)HEM13Z. Deletions of consensus Rox1 and Mot3 binding sites in this region were generated by PCR-based mutagenesis, where each binding site was replaced by a restriction site. Table 2 shows the relevant sequences before and after the site deletions. Multiple deletions were created by combining individual deletions in a stepwise manner, with the exception of the R1R2 deletion, which also deleted all the sequences between the two sites.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Binding site deletions

 
(iii) YCp(22)MOT3. YCp(22)MOT3 was constructed by cloning the BamHI-HindIII fragment from pBSMOT3 (20), containing the MOT3 sequence from –775 to +1960, into YCplac22 (13).

(iv) YCp(22)pT1-M3-HA. YCp(22)pT1-M3-HA was constructed by fusing the TUP1 promoter, –2080 to +4, from YEp(181)TUP1BBg (5) to a MOT3-hemagglutinin (HA) derivative (29) with a SalI site at +4 in the vector YCplac22. The resulting construct expressed the HA epitope-tagged MOT3 constitutively from the TUP1 promoter.

(v) pMOT3-HA. MOT3-HA was PCR amplified from YCp(23)MOT3-HA, which has the native MOT3 5' regulatory and coding sequence joined to five copies of the HA epitope tag plus the 400 bp of TUP1 3' sequences (29). The amplification introduced an EagI site at +4 and a SacI site 500 bases into the TUP1 3' sequences. The product was inserted into the EagI-SacI sites of pIVEX2.4d (RTS System; Roche). This construction introduced six histidine residues and a factor Xa protease site preceding the MOT3 sequences.

(vi) YCp(22)R1-S6e. The c-myc (9E10) epitope-tagged SSN6 coding and 3' sequences (+4 to +3272) were PCR amplified with the addition of an XhoI site at the 5' end and an EcoRI site at the 3' end. This fragment was ligated into the XhoI (immediately following codon 99) EcoRI sites of YCp(22)ROX1{Delta}Q (7). This construct resulted in the ROX1 promoter and high mobility group DNA binding domain coding sequence (–1290 to +297), followed by an XhoI site fused to the SSN6 coding sequence (+2 to +2901) plus the c-myc epitope tag and SSN6 3' sequences (+2902 to +3272).

Protein purification. His-MOT3-HA was expressed in BL21 codon-plus cells (Stratagene). Cells were grown at 37°C to mid-exponential phase in terrific broth (2) supplemented with 50 µg of ampicillin/ml and 34 µg of chloramphenicol/ml. The cultures were shifted to 18°C, and protein expression was induced overnight by the addition of IPTG (isopropyl-ß-D-thiogalactopyranoside) to 0.2 mM. Cells were chilled, harvested by centrifugation for 5 min at 4,000 x g, and resuspended in lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, adjusted to pH 8.0 with NaOH) containing 1 µg of pepstatin/ml, 1 µg of leupeptin/ml, 1 mM benzamidine, and 1 mM phenylmethylsulfonyl fluoride. After freezing at –80°C and then thawing, cells were lysed with three 15-s cycles of sonication alternating with 2 min on ice. The cell lysate was clarified by centrifugation for 30 min at 12,000 x g. Clarified extracts were then batch bound to Ni-nitrilotriacetic acid agarose (QIAGEN) for 1 h with continuous gentle inversion at 4°C. Beads were batch washed with 20 bed volumes of lysis buffer containing 20 mM imidazole. Elutions were carried out in 250 mM imidazole in lysis buffer. The His tag was cleaved from the Mot3-HA with factor Xa (New England Biolabs) per the manufacturer's recommendations.

Maltose binding protein-Rox1 was purified as described previously (20) with minor modifications. Expression of the fusion was induced with 1 mM IPTG for 3 h.

Electrophoretic mobility shift assays. Gel shifts assays were performed as described previously (20) with restriction fragments that separated Mot3 consensus binding sites. The regions used are indicated in Fig. 2. DNA restriction fragments were labeled by Klenow-mediated fill-in of the restriction enzyme generated single-stranded ends in the presence of [{alpha}-32P]dATP. Binding was carried out in 10 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10 mM MgCl2, 1 µg of dI-dC/ml, and 10% glycerol. Protein was incubated with DNA for 5 min at room temperature and then loaded directly on a 6 or 8% polyacrylamide gel. Specific competition was accomplished by adding 130 ng of synthetic 55-bp DNA containing the known Mot3 binding sequence from ANB1 (20). For nonspecific competition, 130 ng of an equal length synthetic DNA lacking Mot3 binding sequences was used.



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2. Mot3 binds to the M2, M3, and M4 Mot3 sites in the regulatory region of HEM13. (A) The gel retardation assay was carried out as described in Materials and Methods with 25 ng of maltose binding protein-Rox1 (lane 2) or 100 ng of Mot3 (lanes 3 to 5) and 6.5 ng of [{alpha}-32P]dATP-labeled SalI (–588)-MfeI (–468) restriction fragment prepared from YCp(33)HEM13{Delta}R4. This DNA fragment contained the sites R3 and M4 as shown above the gel. No protein was added to lane 1. Lane 4 contained a 20-fold excess of the specific competitor, a synthetic ANB1 OpA DNA which contained a single, functional Mot3 binding site (underlined, 5'-TTTTTCCATTGTTCGTTCGTTGCCTGTTTTTTTGCCCTATTGTTCTCA). Lane 5 contained a 20-fold excess of the nonspecific competitor (5'-AGCTTCCCCTTTCGTCCCCTTGTTTCCCCTTTTTTCCCCTTGAATTCCCCTTC), which lacks a Mot3 binding site. (B) The gel retardation was carried out as described above, except that an [{alpha}-32P]dATP-labeled MfeI (–472)-HindIII (–194) restriction fragment was used. This fragment contained the sites R2, M2, and M3 as shown above the gel. (C) Alignment of Mot3 sites from ANB1 OpA, M1 through 5 of HEM13, and the consensus sequence derived in the binding analysis of Grishin et al. (15). The core consensus sequence is highlighted with a gray background for those sequences that bound Mot3 and with a grey outline for those that did not.

 
ß-Galactosidase assays. Assays were performed as described previously (18). The effects of the individual deletions were small, and to minimize experimental error, the assays were performed with pooled plates of transformants. We found that the largest contribution to error was the substantial variation from performing assays with several individual transformants, perhaps due to variations in copy number. These errors disappeared when several hundred colonies from individual transformant plates were pooled and used to start overnight cultures for a single assay. The errors presented in Tables 3, 4, and 5 show one standard deviation from the mean for assays repeated at least three times, each with a different pool of transformants.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Expression of the HEM13 and ANB1 lacZ fusions in deletion strains

 

View this table:
[in this window]
[in a new window]
 
TABLE 4. Effect of Rox1 binding site deletions on expression of the HEM13-lacZ fusion

 

View this table:
[in this window]
[in a new window]
 
TABLE 5. Effect of Mot3 binding site deletions on expression of the HEM13-lacZ fusion

 
RNA blots, immunoblots, and chromatin immunoprecipitation (ChIP) analyses. RNA was extracted with hot acidic phenol, and Northern blots were carried out as described previously (2). The blots were hybridized to radiolabeled [{alpha}-32P]dATP DNA probes prepared as described previously (2, 29). The probes used contained the following sequences: ANB1, +123 to +465; HEM13, –402 to +803; ACT1, 600-bp internal fragment, used as a loading control.

Crude protein extracts were prepared from mid-exponential-growth-phase cells boiled in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) loading buffer containing ß-mercaptoethanol for 5 min as previously described (2, 29). Proteins were fractionated by sodium dodecyl sulfate-PAGE and then electroblotted onto nitrocellulose membranes (2). The blots were probed with antibody against the HA epitope (F-7; Santa Cruz Biotechnology, Inc.) or c-myc epitope (9E10; Santa Cruz Biotechnology, Inc.) followed by horseradish peroxidase-conjugated anti-mouse antibody (Santa Cruz Biotechnology, Inc.). Bands were visualized with Western blotting luminol reagent (Santa Cruz Biotechnology, Inc.) in accordance with the manufacturer's recommendations. To ensure that equal amounts of extract were loaded in each lane, the blots were either stained with Ponceau S or, after the initial probing, stripped by a 5-min incubation in 0.2 N NaOH and then reprobed with rabbit polyclonal antibody against yeast eIF-5a (prepared by Alexander Kastaniotis). The immunoblots were quantitated by scanning the exposed X-ray film and using ImageQuant software (Molecular Dynamics).

The recruitment of HA epitope-tagged Mot3 to specific regions of DNA was measured by the immunoprecipitation of formaldehyde-cross-linked chromatin with antibody against the HA epitope and protein A-Sepharose resin (Amersham Biosciences) as described previously (2, 11, 25, 29). The relative efficiencies of immunoprecipitation were measured by quantitative radioactive PCR, performed as described previously (25, 29). The oligomer pairs amplified the following regions: ANB1, –505 to –231; HEM13, –617 to –388. PCR products were separated on 8% polyacrylamide gels, and quantitation was performed with a Molecular Dynamics Storm 860 PhosphorImager as described previously (25, 29). To establish that the amplification was in the linear range of incorporation of the labeled [{alpha}-32P]dATP, samples were taken after various cycles, fractionated on polyacrylamide gels as described above, and quantitated.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mot3 can repress HEM13 but not ANB1 in the absence of Rox1. In our previous analysis of the hypoxic repression of the expression of the ANB1 gene, we determined that the Rox1 repressor was essential and that Mot3 enhanced repression by Rox1 severalfold. This contribution by Mot3 was effected through promotion of a synergistic interaction between the two closely spaced Rox1 sites in OpA (Fig. 1). In the absence of the Mot3 protein or the Mot3 site between them, these two sites acted independently or additively (20). To learn whether this activity of Mot3 is a general rule in hypoxic gene repression, we extended our studies to an analysis of the HEM13 gene. To assess the relative contributions of the DNA binding Rox1 and Mot3 repressor proteins to repression of HEM13, the aerobic expression of an HEM13-lacZ fusion was compared in a wild-type strain and strains carrying deletions of MOT3, ROX1, and both genes. The relative repression, calculated as the ratio of ß-galactosidase levels in the rox1{Delta} mot3{Delta} double deletion mutant to those in the wild type, represents the full extent of repression by the combination of the two repressor proteins. The ratio of enzyme levels in the double deletion mutant to the mot3{Delta} deletion mutant represents the extent of repression that Rox1 can achieve in the absence of Mot3, and that of the double deletion mutant to the rox1{Delta} deletion mutant represents the level of repression that Mot3 alone can effect.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 1. Rox1 site mutations in the HEM13 regulatory region. The upper diagram represents the wild-type promoter of HEM13 with both Rox1 (R, black boxes) and Mot3 (M, gray boxes) consensus sites presented. The Mot3 sites that bound Mot3 protein and were active in repression are presented as filled boxes, while those that did not are presented as empty boxes. The Rox1 sites that proved to be less active in repression are shown as empty boxes. The arrow represents the beginning of the coding sequence, and the negative numbers indicate the distance (in base pairs) from the start of the coding sequence. The lower diagram shows the same for ANB1.

 
Initially, we confirmed our findings concerning ANB1 repression with an ANB1-lacZ fusion. As seen in Table 3, the levels of ß-galactosidase activity expressed from an ANB1-lacZ fusion were similar in rox1{Delta} cells to those in rox1{Delta} mot3{Delta} cells, indicating that Rox1 was essential for repression and that Mot3 could not significantly repress ANB1-lacZ in the absence of Rox1. In the absence of Mot3, on the other hand, Rox1 alone repressed ANB1-lacZ expression 54-fold (the ß-galactosidase activity in rox1{Delta} mot3{Delta} cells divided by that in mot3{Delta} cells) compared to the 260-fold repression of ANB1 with both proteins present (the ratio of ß-galactosidase activity in rox1{Delta} mot3{Delta} cells to that in wild-type cells).

Surprisingly, the activity of Rox1 and Mot3 appeared to be different at HEM13; Mot3 appeared to be capable of repressing aerobic HEM13 expression in the absence of Rox1. As seen from Table 3, a HEM13-lacZ fusion was repressed 44-fold by the combination of Rox1 plus Mot3 (the ratio of ß-galactosidase activity in rox1{Delta} mot3{Delta} cells to that in wild-type cells), while Mot3 alone repressed expression 3-fold (the ratio of ß-galactosidase activity in rox1{Delta} mot3{Delta} cells to that in rox1{Delta} cells) and Rox1 alone repressed expression 9-fold (the ratio of ß-galactosidase activity in rox1{Delta} mot3{Delta} cells to that in mot3{Delta} cells). Combining the individual repression by each protein would give 60-fold repression, close to the 44-fold observed.

Mot3 binds to a subset of the putative Mot3 sites of HEM13. As seen above, there are two important differences between repression at ANB1 and HEM13. The former is repressed to a much greater extent, and Mot3 can repress the latter in the absence of Rox1. We hypothesized that this difference may result from the arrangement of Rox1 and Mot3 sites in the two genes as illustrated in Fig. 1. Both genes have several Rox1 sites. For ANB1, we have grouped these sites into two operators, the coding sequence proximal OpB and the distal OpA, based upon the close proximity of the two Rox1 sites in each operator (20 and 30 bp, respectively). OpA of ANB1 contains a Mot3 site between the two Rox1 sites, and these three sites have been shown to act synergistically to account for most of the strong repression of ANB1 expression. HEM13 also contains two closely positioned proximal Rox1 sites, designated R1 and R2 here, and two distal sites, R3 and R4. However, the two distal sites in HEM13 are spaced very differently, with over 100 bp between them. R3 is closely spaced with three putative Mot3 sites; all four sites lie within about 70 bp of each other. There are two additional putative Mot3 sites, one far upstream of the most 5' Rox1 site and the other within the beginning of the coding sequence. Thus, we addressed the question of how the arrangement of these sites affected repressor activity.

The Rox1 binding site has been well characterized, and we can accurately predict how well a given sequence will be bound by the protein (9). However, the published Mot3 binding site is small, 6 bp, and degenerate (C/A/T)AGG(T/C)A, such that a Mot3 site would be predicted to be found about once every 680 bp. It is unlikely that Mot3 binds so many sites in the genome and even more unlikely that it functions at so many sites, so initially, we determined which of the five putative Mot3 sites, designated sites M1 (most proximal) to M5, could bind Mot3 in vitro. A set of restriction fragments were generated from the upstream region of HEM13 that contained individual, or in one case, two, putative Mot3 sites and used in a gel retardation assay with bacterially expressed Mot3. Relatively large fragments were used to maintain the larger contextual sequence of the consensus binding sites that may be important for binding. As shown in Fig. 2A, Mot3 bound to site M4 (lane 3), with the DNA protein complex indicated as M. A doublet was visible which correlated with the appearance of a doublet of the purified protein (data not shown); the reason for the doublet is not clear. The complex was specifically competed by an excess of nonlabeled specific OpA DNA (lane 4) containing the Mot3 binding site from the upstream region of ANB1, which was shown previously to both bind Mot3 protein in vitro and repress transcription in vivo (20). Since this competitor DNA had only the Mot3 site in common with the labeled fragment, it is likely that Mot3 was bound to its cognate site. An equivalent excess of unlabeled DNA lacking a Mot3 site did not affect binding (lane 5). Further evidence that the complex contained Mot3 was observed by a shift in the size of the complex when antibody against the HA tag of Mot3 was added (data not shown). The labeled restriction fragment also contained the R3 Rox1 site, and as a control, bacterially expressed and purified Rox1 was shown to bind to this fragment (lane 2) with the complex in this case designated with an R. Figure 2B demonstrates the specific binding of Mot3 to M2 and M3. Both sites were bound by the protein, as indicated by the appearance of two complexes (lane 3), indicated as a single protein molecule (M) and two molecules bound (2 M). Both complexes were successfully competed by excess specific (lane 4), but not nonspecific (lane 5), competitor. This fragment also contained a Rox1 site, R2, and it bound Rox1 (lane 2).

Surprisingly, the two putative sites 1 and 5 did not bind Mot3, even at high protein concentrations (data not shown), despite complete matches to the consensus sequence. A summary of contextual sequences 10 bp upstream and downstream of the Mot3 sites for all five HEM13 sites, the ANB1 site, and the fragment used to determine the Mot3 binding site in a previous study (15) are shown in Fig. 2C. Sites M3 and M5 have identical core binding sites yet very different binding activities. A comparison of the contextual sequences in sites that were bound by Mot3, M2, M3, M4, the ANB1 site, and the fragment used to determine the Mot3 binding site with those of sites that did not bind, M1 and M5, provided no insight into the relationship between sequence and function.

The Rox1 site R3 is responsible for most Rox1-dependent repression. To assess the ability of the various Rox1 and Mot3 sites to function in repression in vivo, deletions of single sites and combinations of sites were generated in an HEM13-lacZ fusion construct. As described above, each construct was transformed into a series of strains, wild type, rox1{Delta}, mot3{Delta}, and rox1{Delta} mot3{Delta}, to assess the relative contribution of each site to repression by the two DNA binding proteins. For simplicity, only a subset of the results is presented here, where we felt the omitted data provided no additional insights.

A previous study had indicated that R3 was the largest contributor to repression by Rox1 and that deletion of R1 and R2 alone had little effect (1). To confirm these findings and evaluate the possible influence of Mot3 on repression through these Rox1 sites, we deleted R1 and R2 individually and in combination and R3 and R4 in the R1R2 deletion background. The effect of these deletions is presented in Table 4 as the relative derepression, that is, how much repression was lost by deleting the site(s). This value was calculated as the enzyme activity in rox1{Delta} cells divided by the activity in wild-type cells for the deletion constructs normalized to the same ratio for cells carrying the wild-type HEM13-lacZ construct. Thus, a relative derepression of 1.0 represents no effect of the deletion on the ability of Rox1 to repress, and a high value for the relative derepression represents a large effect of the deletion. It is clear from this ratio that sites R1, R2, and R4 have a minimal effect on HEM13-lacZ repression, deletions of the R1 and R2 sites individually or in combination resulted in no significant derepression, and the deletion of R4 in the R1R2 deletion background had little effect. On the other hand, all constructs with a deletion of R3 resulted in maximal depression. Based upon these results, it appears that most of the Rox1 repression is through R3.

Two anomalies should be noted in the data. First, the deletion of all four Rox1 sites did not result in complete derepression; expression from this deletion was three times higher in rox1{Delta} cells than in wild-type cells. This observation suggests that either there are cryptic Rox1 sites, a possibility we reject due to the results of the gel retardation assays and the well-known sequence for Rox1 binding sites, or there is an indirect effect of the rox1{Delta} mutant on HEM13 expression. Amillet et al. (1) mapped an upstream activation sequence that, when transferred to a heterologous gene, activated transcription three times greater anaerobically than aerobically. The activator has not been identified, but we suggest that it may be repressed aerobically by Rox1. In this case, a rox1{Delta} mutant would have two effects on the R1R2R3R4 deletion allele: elimination of repression through the HEM13 Rox1 sites and enhanced aerobic expression due to loss of repression of the activator. Deletion of the Rox1 sites alone would result in less of an increase in aerobic repression because the activator would still be repressed. This is what we observed.

The second anomaly is that deletions that included R2 resulted in a 1.5- to 2-fold overall increase in HEM13-lacZ expression. We do not know the cause of this phenomenon, but it was clearly Rox1 independent, since the increase was apparent in the rox1{Delta} strain (Table 4) and the rox1{Delta} mot3{Delta} strain (data not shown). This anomaly points out the advantage of assaying the levels of gene expression of each plasmid in the various deletion strains; expression from each plasmid can be normalized to cells with and without the repressor.

Our confirmation of the previous finding that R3 contributed the major Rox1-dependent repression (1) can now be interpreted in the context that this site is surrounded by three Mot3 sites, and these results suggest that repression through this Rox1 site is potentiated by Mot3 binding. This conclusion is supported by the observation that the Mot3 effect on repression is weakened by the loss of the R3 site. The Mot3 effect can be visualized as the ratio of HEM13-lacZ expression in mot3{Delta} cells to that in wild-type cells. This ratio is 5.2 for the cells transformed with the wild-type plasmid and ranged between 5.0 and 7.9 for the deletions of R1, R2, and R4 individually or in combination. However, this ratio fell to between 2.8 and 3.5 for any combination that deleted R3. Consequently, we conclude that the bulk of Rox1 repression is achieved through R3 at least in part because of a weak interaction with Mot3. This interaction was not apparent from the analysis in Table 3 for the wild-type plasmid in the mutant transformants because of the small effect.

It should be noted that R2 bound Rox1 in vitro as shown in Fig. 2, yet its deletion had little effect on repression in vivo. In the case of R4, its distance from the TATA box and the transcriptional initiation region may account for its poor activity. However, for R2 and R1, the lack of repression activity is unclear. There may be some other protein that binds in this region that interferes with Rox1 binding in vivo. Perhaps this is the reason that all deletions, including R2, resulted in an overall 1.5- to 2-fold increase in the fusion expression in all strains.

The function of the Mot3 sites correlate with DNA binding, and Mot3 sites act additively. The five Mot3 sites were also deleted individually and, for M2 through M5, in combination, and the effect of these deletions on HEM13-lacZ expression are presented in Table 5. Sites M1 and M5, the two sites that did not bind Mot3, did not alter the level of repression in wild-type cells. In the case of M1, the original wild-type HEM13-lacZ fusion plasmid contained only the translational initiation codon of the HEM13 coding sequence and, therefore, did not contain M1. To test the function of M1, a new fusion was made that added five additional codons including the M1 site. This plasmid had the same levels of repression as the fusion without M1, and for the sake of clarity, the fusion lacking M1 will be referred to as wild type throughout. The deletion of site M2, M3, or M4 individually caused a modest 1.5- to 2.9-fold increase in HEM13-lacZ expression, as determined by the ratio of enzyme activities in wild-type cells. Thus, the sites that bound Mot3 in vitro caused some repression in vivo, while those that did not bind did not affect repression. It was also clear that the Mot3 sites functioned independently, as determined from the results with multiple deletions. For example, the deletion of M2 plus M3 resulted in a 3.3-fold increase in HEM13-lacZ expression compared to the 1.5- and 2.9-fold increases of the individual deletions. If these sites functioned independently, a 4.3-fold increase would be expected. Similarly, the deletion of M3 plus M4 resulted in a 4.1-fold increase in expression. The 2.9- and 2.6-fold increases caused by the individual deletions of M3 and M4 would be expected to give a 7.5-fold increase for an additive effect. The deletion of all three functional sites, M2, M3, and M4, resulted in a 4.7-fold increase in HEM13-lacZ expression compared to the 11-fold increase expected from independent function. Thus, there is no evidence that the Mot3 sites, despite their proximity, function synergistically. Also, we can conclude that M2, M3, and M4 account for all of the Mot3 repression activity at HEM13 because the deletion of these three sites in combination resulted in the same level of expression in wild-type and mot3{Delta} cells (a 1.1 ratio), indicating that there are no cryptic Mot3 repression sites.

Also, as expected, the deletion of the nonbinding M5 in combination with any of the functional Mot3 sites did not increase derepression further, confirming that this site has no repression activity.

If Mot3 potentiates repression of Rox1 at site R3, then Rox1 should potentiate repression by Mot3. Again this effect can be visualized through the ratio of repression by Rox1 (enzyme activity in rox1{Delta} divided by that in wild-type cells) for the wild-type plasmid to that of the deletion plasmids. This ratio is 15-fold for the wild-type plasmid and only 6-fold for the plasmid containing the triple M2M3M4 deletion, suggesting that Rox1 repression is increased in the presence of Mot3. Furthermore, this ratio varies between 9 and 10 in the three double deletions involving these three sites, suggesting that all three sites must be present to achieve the full Rox1-Mot3 interaction. Thus, the results of these deletion analyses presented in Tables 4 and 5 strongly suggest that Mot3 and Rox1 function to help each other repress but that this interaction requires close proximity of the Rox1 and Mot3 binding sites. While this conclusion is similar to that reached in a deletion analysis of ANB1 OpA (10, 27), in that case, Mot3 promoted a more dramatic synergy between two close Rox1 sites, where in this case, the effect involves a single Rox1 site.

Mot3 recruits Ssn6/Tup1 to enhance Rox1 repression at ANB1. Because Mot3 functioned to repress HEM13 in the absence of Rox1, it seemed likely that Mot3 could recruit the Ssn6/Tup1 repression complex in the absence of Rox1. This conclusion agreed with the results of Sertil et al. (35) that overexpression of Mot3 could repress genes in the absence of Rox1 and that this repression depended on Ssn6 and Tup1. Also, ChIP experiments indicated that Mot3 could recruit Ssn6 to both ANB1 and HEM13 in rox1{Delta} cells at physiological concentrations, albeit at lower than wild-type levels, and of course, the complex was not functional in repression at ANB1. Is Mot3's recruitment of the repression complex also responsible for its ability to promote synergy between the closely spaced Rox1 sites of OpA in ANB1 and the interaction between the Rox1 R3 site and Mot3 sites in HEM13? We tested this possibility by creating a fusion between the coding sequences of the Rox1 DNA binding domain and Ssn6 tagged with the c-myc epitope. If Mot3 enhanced repression solely by helping Rox1 recruit the Ssn6/Tup1 complex, then this fusion protein would obviate the need for Mot3. However, if Mot3 performed an additional, Ssn6/Tup1 recruitment-independent function, then full repression would still require Mot3. It should be noted that the DNA binding domain of Rox1 that was present in this fusion has no repression activity without the remainder of the protein (9).

Initially, we determined the level of expression of the fusion protein compared to that of Ssn6. The fusion protein was expressed from the ROX1 promoter and carried a c-myc epitope tag near the C terminus of Ssn6. Cells were transformed with this plasmid or a plasmid carrying an epitope-tagged SSN6 expressed from its native promoter, and extracts were subjected to immunoblot analysis. The results, presented in Fig. 3, indicated that the fusion was expressed at one-seventh the level of the native Ssn6 protein.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 3. The Rox1-Ssn6 fusion is expressed at a lower level than native Ssn6. Total cellular protein was prepared from aerobically grown RZ53-6{Delta}rox1 cells transformed with YCp(33)R1-S6e expressing the c-myc epitope-tagged Rox1-Ssn6 fusion from the ROX1 promoter (lane 1), YCp(22)SSN6e expressing c-myc epitope-tagged Ssn6 from the SSN6 promoter (lane 2), or YCplac33 (UT, lane 3). The samples were subjected to an immunoblot and probed first with anti c-myc monoclonal antibody, stripped, and then reprobed with polyclonal antisera against eIF-5a.

 
The ability of the fusion to complement a rox1{Delta} mutant was tested. A plasmid carrying the fusion was transformed into rox1{Delta}, rox1{Delta} mot3{Delta}, and rox1{Delta} tup1{Delta} cells, each containing an integrated ANB1-lacZ fusion. As evident from the data presented in Table 6, the fusion repressed aerobic ANB1-lacZ expression as well as the wild-type Rox1 (comparing enzyme activities in the rox1{Delta} cells transformed with a wild-type ROX1 or the fusion plasmid). Furthermore, this repression was dependent on Tup1 (comparing enzyme activities in the rox1{Delta} cells versus the rox1{Delta} tup1{Delta} cells).


View this table:
[in this window]
[in a new window]
 
TABLE 6. Repression by the Rox1-Ssn6 fusion

 
Repression by the fusion plasmid was still enhanced by Mot3, as evident from the 4.8-fold decrease in repression in the rox1{Delta} mot3{Delta} transformants compared to the rox1{Delta} transformants. This effect is similar to the 4.3-fold loss of repression in the rox1{Delta} mot3{Delta} cells compared to the rox1{Delta} cells transformed with the wild-type ROX1 plasmid. However, since these cells contained a genomic wild-type SSN6 allele, it was possible that the Mot3 effect resulted from its recruitment of an additional Ssn6 to the DNA. To determine whether the fusion construct could support full repression in the absence of the possibility for additional Ssn6 recruitment by Mot3, it was transformed into rox1{Delta} ssn6{Delta} and rox1{Delta} ssn6{Delta} mot3{Delta} cells. As can be seen in Table 6, repression was somewhat weaker in the ssn6{Delta} transformants than in those carrying a wild-type SSN6 gene but was similar to that of the SSN6 cells carrying the mot3{Delta} allele. Furthermore, deletion of MOT3 in the ssn6{Delta} background did not further weaken repression. The difference between the effect of Mot3 on the fusion with or without native Ssn6 was probably a result of the sevenfold-lower expression of the fusion; Mot3 could not recruit the Rox1-Ssn6 fusion at the lower level of Ssn6 in the cell. Thus, when unable to recruit Ssn6, Mot3 could not enhance repression. Consequently, we believe that the role of Mot3 is to help Rox1 recruit Ssn6 and help stabilize the Rox1-Ssn6 complex. The same strains transformed with the wild-type ROX1 plasmid were, of course, completely derepressed for ANB1-lacZ expression due to the absence of free Ssn6 from the cell.

Rox1 stabilizes Mot3 binding to DNA. The ability of Mot3 to repress HEM13-lacZ expression in the absence of Rox1 raised a question concerning the rapid induction of HEM13 upon anaerobiosis (29). We previously reported that the kinetics of ANB1 and HEM13 induction correlated with the disappearance of Rox1 from the cell, but while MOT3 expression is regulated by oxygen availability at the level of transcription, Mot3 dissociated from ANB1 and HEM13 well before its protein disappeared from the cell during induction (29, 35). This observation suggested that there may be an active mechanism that promotes the release of Mot3 from the hypoxic repression complex prior to the drop in cellular Mot3 protein levels. We explored this possibility by fusing the MOT3 coding region followed by four copies of the HA epitope to the TUP1 promoter. TUP1 is expressed constitutively, so this construct expressed Mot3-HA independent of oxygen availability but without severe overexpression. The constitutive expression of this pT1-M3-HA was confirmed by Western analysis. RZ53-6{Delta}mot3 cells carrying YCp(22)pT1-M3-HA or YCp(23)MOT3-HA were grown aerobically and anaerobically for 1, 2, and 4 h to mid-exponential phase. An untagged control, consisting of cells carrying YCp(22)MOT3, was grown aerobically. Crude extracts were prepared and subjected to immunoblot analysis. As seen in Fig. 4A, Mot3-HA was expressed at lower levels aerobically from its native promoter than that from the TUP1 promoter (lanes 1 and 5, respectively), but the difference was not excessive. As reported previously (29), when under the control of its native promoter, the amount of Mot3-HA present in the cell decreased slowly during anaerobiosis to nearly undetectable levels after 4 h (Fig. 4A, lanes 1 to 4). On the other hand, constitutively expressed Mot3-HA was relatively unaffected by hypoxia; protein levels remained at or above the aerobic level throughout anaerobic growth (lanes 5 to 8).



View larger version (74K):
[in this window]
[in a new window]
 
FIG. 4. Constitutively expressed Mot3 does not affect the rate of hypoxic gene induction. (A) RZ53-6{Delta}mot3 cells containing Mot3-HA expressed from its native promoter (Mot3-HA, lanes 1 to 4) or constitutively expressed Mot3-HA (pT1-M3-HA, lanes 5 to 8) were grown aerobically (0) or anaerobically for the number of hours indicated (1, 2, and 4), and RZ53-6{Delta}mot3 cells containing untagged Mot3 (UT, lane 9) were grown aerobically. Crude protein extracts were prepared and subjected to an immunoblot with monoclonal antibody against the HA epitope. Equal loading of the samples was determined by Ponceau S staining (data not shown). (B) Total cellular RNA was prepared from RZ53-6{Delta}mot3 cells containing Mot3 expressed from its native promoter (Mot3-HA, lanes 1 to 6) or constitutive Mot3 (pT1-M3-HA, lanes 7 to 12) grown to mid-exponential phase aerobically (0) or anaerobically for the number of hours indicated (0.5, 1, 1.5, 2, and 4). RNA was hybridized with 32P-labeled probes to ANB1, HEM13, and ACT1 (as a loading control). The positions of the specific RNAs are indicated to the left of the blot. While a probe to TIF51A was not used, its high degree of sequence similarity to ANB1 resulted in cross-hybridization.

 
Despite the constitutive, somewhat higher expression, Mot3-HA did not greatly alter the rate of induction of ANB1 or HEM13. RZ53-6{Delta}mot3 cells carrying YCp(22)pT1-M3-HA or YCp(23)MOT3-HA were grown aerobically or anaerobically for 0.5, 1, 1.5, 2, and 4 h to mid-exponential phase, and total RNA was prepared and subjected to Northern analyses. The blot was probed for the hypoxic RNAs of HEM13 and ANB1 and for that of unregulated ACT1 as a loading control. Due to the high sequence similarity shared between ANB1 and its aerobically expressed paralog, TIF51A, cross-hybridization of the ANB1 probe was observed and served as an internal control for hypoxia. The rates of induction for ANB1 were nearly indistinguishable in cells expressing Mot3-HA from its own promoter (Fig. 4B, lanes 1 to 6) compared to cells expressing Mot3-HA constitutively (Fig. 4B, lanes 7 to 12). HEM13 in the same lanes showed only a minor delay in induction.

To determine whether the constitutively expressed Mot3-HA dissociated from the hypoxic genes during induction, we performed ChIP analysis. RZ53-6{Delta}mot3 cells carrying YCp(22)pT1-M3-HA were grown aerobically and anaerobically for 1, 2, and 4 h; cells carrying YCp(22)MOT3 were grown aerobically as a negative, untagged control. These cells were harvested for ChIP, and the upstream repression sequences of ANB1 and HEM13 were amplified by PCR. The results presented in Fig. 5 show that the levels of Mot3-HA bound to ANB1 and HEM13 in cells grown aerobically (hour zero) were significantly higher than those of the negative untagged Mot3 control, approximately 5-fold and 10-fold, respectively (Fig. 5A, compare time zero and UT). The levels of immunoprecipitated ANB1 decreased steadily during induction, as shown in Fig. 5B, despite the constant levels of Mot3-HA in the cells. Interestingly, Mot3-HA did not appear to dissociate from HEM13 (Fig. 5C). We believe that this apparent discrepancy between the two genes reflects the larger number of Mot3 sites at HEM13, one site in ANB1, and three functional sites in HEM13. Since only one bound molecule is sufficient for immunoprecipitation by ChIP, dissociation could occur to a significant degree at a gene with three sites but not be easily detected. This would explain the lack of an effect on HEM13 induction. One Mot3 bound may be sufficient for immunoprecipitation, but it is not sufficient for repression.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 5. Constitutively expressed Mot3 dissociates from ANB1, but not HEM13, during hypoxia. (A) ChIP assays with monoclonal antibody against the HA epitope were performed with RZ53-6{Delta}mot3 cells containing YCp(23)pT1-M3-HA expressing Mot3-HA constitutively or YCp(22)MOT3 expressing untagged Mot3 (UT). pT1-M3-HA cells were grown aerobically (0) and anaerobically for the number of hours indicated (1, 2, and 4). DNA samples isolated from the immunoprecipitation (ChIP) and prior to immunoprecipitation (Input) were amplified by PCR with oligonucleotide primers to the ANB1 and HEM13 regulatory regions. [{alpha}-32P]dATP was added to the PCR mixtures, and the labeled products were fractionated by PAGE. The bands were visualized and quantitated by using a STORM PhosphorImager and the ImageQuant software package. (B and C) The radioactivity in the ChIP samples for ANB1 (B) and HEM13 (C) was normalized as follows. First, the input samples were normalized by dividing the radioactivity in each input band by that in the hour 0 (aerobic) input sample. Then, each ChIP sample was normalized to its input by dividing the ChIP sample by the normalized input sample. The untagged sample was subtracted from each of the samples with epitope-tagged protein, and finally, the ChIP samples were normalized to the hour 0 sample by dividing each normalized ChIP sample by the normalized hour 0 sample. These normalized ChIP values were plotted as histograms (pT1-M3-HA, gray bars) and represent an average of the results from at least four independent experiments. The data presented for the wild-type (WT, black bars) represent Mot3-HA expressed from its native promoter throughout the hypoxic induction and have been reproduced from Mennella et al. for the sake of comparison (29).

 
It is possible that there is a specific mechanism that removes Mot3 from DNA during hypoxia or that Mot3 binding at ANB1 requires Rox1, which disappears from the cell very rapidly upon the onset of hypoxia (8, 29). We distinguished between these two possibilities by comparing the immunoprecipitation of ANB1 DNA with Mot3-HA in aerobically grown wild-type versus rox1{Delta} cells. As seen in Fig. 6, Mot3-HA was stably associated with the ANB1 regulatory region in wild-type cells but not in the rox1{Delta} cells. Quantitation indicated that four times more ANB1 immunoprecipitated with the HA antibody in the wild-type versus mutant cells. The same samples showed only a twofold difference in the amount of HEM13 immunoprecipitated, once again demonstrating the persistence of Mot3 at this gene. These results indicate that the dissociation of Mot3 from ANB1 and, to a lesser extent from HEM13, correlated with the dissociation of Rox1 and indicates that Rox1 stabilizes Mot3 binding.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 6. Rox1 is required for Mot3 binding to the ANB1 gene and, to a lesser extent, to the HEM13 gene. ChIP assays with monoclonal antibody against the HA epitope were performed with RZ53-6{Delta}mot3 transformed with YCp(23)MOT3-HA (WT) or YCp(23)MOT3 (untagged, UT) and with RZ53-6{Delta}rox1{Delta}mot3 cells transformed with YCp(23)MOT3-HA (rox1{Delta}). Cells were grown aerobically to mid-exponential phase. DNA samples were prepared before (Input) and after (ChIP) immunoprecipitation. The radioactivity in the bands was quantitated and normalized as described in the legend to Fig. 5.

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A comparison of the similarities and differences in the arrangement of the Rox1 and Mot3 sites in the ANB1 and HEM13 genes provides some insight into how these sites interact and how they may function. First, the strongest repression in both genes is mediated by Rox1 and Mot3 sites in close proximity. From a previous study, we found that OpA of ANB1, which consists of two Rox1 sites 31 bp apart with a Mot3 site in between, was responsible for 76-fold repression, while OpB, which consists of two Rox1 sites 21 bp apart without a Mot3 site effects only an eightfold repression (10). Deletion of or point mutations in the Mot3 site of OpA reduced repression to about fivefold. Elimination of one of the Rox1 sites of OpA reduced repression to eightfold. Thus, the Mot3 site acted synergistically with the two Rox1 sites to give the strong repression of ANB1. This present study demonstrated that the strongest Rox1 site in HEM13 was R3, which is flanked by three functional Mot3 sites, all located within 70 bp. The three Mot3 sites acted additively to increase repression by R3. Second, the naturally occurring ANB1 OpA combination of two Rox1 sites plus a single Mot3 site represses much more strongly than the HEM13 combination of one Rox1 site and three Mot3 sites. Based upon in vitro binding studies, there appears to be no large difference in the strength of these different Rox1 or Mot3 sites in these genes, and therefore, we believe that the difference in repression is due to the different combinations according to the following rules. Multiple Mot3 sites or multiple Rox1 sites function additively, as in the case of the Mot3 sites in HEM13 in a rox1{Delta} strain and the Rox1 sites in ANB1 OpB or OpA with the Mot3 site deleted or the wild-type OpA in a mot3{Delta} strain. The sites in combination function more than additively, but the overall synergy depends on the combination of sites. Multiple Mot3 sites plus a single Rox1 site are much weaker than multiple Rox1 sites plus a single Mot3 site. The different combinations of sites in ANB1 and HEM13 achieve the purpose of differential repression, with much greater repression of ANB1 than of HEM13.

We demonstrated here that Mot3 functions to potentiate Rox1 repression by helping in the recruitment of the Ssn6/Tup1 general repression complex. The ability of Mot3 to recruit the Ssn6/Tup1 complex has been demonstrated before. Great overexpression of Mot3 resulted in ANB1 repression even in the absence of Rox1 (35), and ChIP experiments with antibody against Ssn6 can bring down the ANB1 gene in the absence of Rox1 but not in the absence of both Rox1 and Mot3 (29). Our present study confirms these findings and extends them to demonstrate that Mot3 function is not required for some additional step in repression. A fusion of Ssn6 to the DNA binding domain of Rox1 eliminated the Mot3 effect on repression. Previous in vitro studies had shown that Rox1 and Mot3 did not bind cooperatively to DNA; in gel retardation assays with purified Rox1 and Mot3, there was no increased binding when the proteins were added together versus separately. Thus, Mot3 does not function by increasing Rox1 binding directly (20). Our present finding reinforces this conclusion; if Mot3 functioned through a cooperative interaction with DNA and Rox1 that increased Rox1 recruitment to the ANB1 gene in vivo, Mot3 should still have increased recruitment of the Rox1-Ssn6 fusion. Similarly, if Mot3 functioned to enhance some step post-Ssn6/Tup1 recruitment, it still should have increased repression of the fusion construct.

The general repression complex is comprised of four Tup1 molecules and one Ssn6 molecule (39, 40). Rox1 interacts most strongly with Ssn6 (38), and ChIP experiments indicated that Ssn6 mediated the recruitment of the general repression complex to the hypoxic genes in vivo; Ssn6 can be recruited to ANB1 and HEM13 in the absence of Tup1, but Tup1 cannot be recruited in the absence of Ssn6. Thus, it appears that both Rox1 and Mot3 interact with Ssn6. The Ssn6 protein contains 10 TPR repeats that comprise the functional domain of the protein and have been implicated in the interaction with Tup1 and the various regulon-specific DNA binding repressors that recruit the general repression complex (26, 38). Each protein interacts with a specific subset of TPR repeats, and Rox1 is proposed to interact with repeats four through seven (38). It is not known with which repeats Mot3 interacts. Also, we do not know the stoichiometry of the complex at the hypoxic genes in terms of the number of general repression complexes recruited by each Rox1 molecule and each Mot3 molecule and whether the increased repression results from increased numbers of Ssn6/Tup1 complexes recruited, increased stability of a fixed number of complexes, or both. However, we believe that the experiment with the Rox1-Ssn6 fusion provides some insight to these questions. Mot3 enhanced repression of the fusion protein in SSN6 when it could recruit Ssn6 but not in an ssn6{Delta} background when it could not. Consequently, it seems likely that Mot3 functions to recruit an additional Ssn6. Nonetheless, there must be some level of interaction between the repression complexes recruited by Rox1 and Mot3 for the following reasons. First, Mot3 promotes synergy with Rox1 sites, and second, Rox1 helps in Mot3 binding. It is unclear at this point whether the higher-order interaction of these independently recruited Ssn6 molecules results from an Ssn6-Ssn6 interaction, Tup1 interactions, or a change in the stoichiometry of the Ssn6-Tup1 interaction.

Finally, we show here that Mot3 dissociated from ANB1 under anaerobiosis even when constitutively expressed. We believe that this dissociation resulted from the loss of Rox1; ChIP analysis showed that less Mot3 bound to the ANB1 regulatory region in rox1{Delta} cells than in wild-type cells. Based upon these data, we propose that Mot3 binding to DNA is weak and is stabilized through the interactions of Rox1 and Mot3 with the general repression complex. In the same experiments, constitutively expressed Mot3 persisted at HEM13, and Mot3 binding to HEM13 was reduced only twofold in the absence of Rox1, presumably due to the multiple Mot3 sites in this region. The Mot3 occupancy at HEM13 in the rox1{Delta} mutant also explains the Rox1-independent repression observed at this gene but not at ANB1. Finally, it should be noted that in the absence of Mot3, the hypoxic genes were induced at a faster rate, again suggesting that Mot3 stabilizes the Rox1-Ssn6/Tup1 complex (29).

From the conclusions presented above, we propose the following model for the interactions between Rox1 and Mot3. The combination of Rox1 and Mot3 bound close together within a regulatory region results in synergy due to interactions through the general repression complex. Multiple Rox1 molecules bound without Mot3 provide only additive repression, perhaps due to an inability to promote interactions between independently bound repression complexes. Similarly, multiple Mot3 molecules bound without Rox1 can only function additively. Also, we propose that Rox1 binds more stably to DNA than Mot3, so that Mot3 dissociates from the DNA rapidly upon the onset of hypoxia due to the rapid dissociation of Rox1. Even if Mot3 were to persist in the cell, as in the case of the constitutively expressed Mot3, Rox1 dissociation would promote Mot3 dissociation. Consequently, Rox1 alone is a stronger repressor than Mot3 alone, and the combination of Rox1 and Mot3 is stronger still. Thus, the cell has an array of combinatorial repressor sites that it can use to effect differential repression of the hypoxic genes.

Interestingly, we have also found that Mot3 binding requires more than the degenerate 6-bp consensus sequence. Sites M1 and M5, which conform to this sequence, did not bind Mot3 in vitro. What the additional requirements are were not apparent from a comparison of the sequence surrounding the 6-bp sites.


    ACKNOWLEDGMENTS
 
We thank Margye Zitomer for the construction of yeast strains.

This work was supported by a grant from the National Institutes of Health (GM26061).


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biological Sciences, University at Albany—State University of New York, 1400 Washington Ave., Albany, NY 12222. Phone: (518) 442-4385. Fax: (518) 442-4767. E-mail: rz144{at}albany.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Amillet, J. M., N. Buisson, and R. Labbe-Bois. 1996. Characterization of an upstream activation sequence and two Rox1p-responsive sites controlling the induction of the yeast HEM13 gene by oxygen and heme deficiency. J. Biol. Chem. 271:24425-24432.[Abstract/Free Full Text]
  2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 2000. Current protocols in molecular biology. John Wiley and Sons, Inc., New York, N.Y.
  3. Balasubramanian, B., C. V. Lowry, and R. S. Zitomer. 1993. The Rox1 repressor of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility-group motif. Mol. Cell. Biol. 13:6071-6078.[Abstract/Free Full Text]
  4. Bone, J. R., and S. Y. Roth. 2000. Recruitment of the yeast Tup1p-Ssn6p repressor is associated with localized decreases in histone acetylation. J. Biol. Chem. 276:1808-1813.
  5. Carrico, P. M., and R. S. Zitomer. 1998. Mutational analysis of the Tup1 general repressor of yeast. Genetics 148:637-644.[Abstract/Free Full Text]
  6. Conlan, R. S., and D. Tzamarias. 2001. Sfl1 functions via the co-repressor Ssn6-Tup1 and the cAMP-dependent protein kinase Tpk2. J. Mol. Biol. 309:1007-1015.[CrossRef][Medline]
  7. Deckert, J., R. A. Khalaf, S. M. Hwang, and R. S. Zitomer. 1999. Characterization of the DNA binding and bending HMG domain of the yeast hypoxic repressor Rox1. Nucleic Acids Res. 27:3518-3526.[Abstract/Free Full Text]
  8. Deckert, J., R. Perini, B. Balasubramanian, and R. S. Zitomer. 1995. Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae. Genetics 139:1149-1158.[Abstract]
  9. Deckert, J., A. M. Rodriguez Torres, J. T. Simon, and R. S. Zitomer. 1995. Mutational analysis of Rox1, a DNA-bending repressor of hypoxic genes in Saccharomyces cerevisiae. Mol. Cell, Biol. 15:6109-6117.[Abstract]
  10. Deckert, J., A. M. Torres, S. M. Hwang, A. J. Kastaniotis, and R. S. Zitomer. 1998. The anatomy of a hypoxic operator in Saccharomyces cerevisiae. Genetics 150:1429-1441.[Abstract/Free Full Text]
  11. Dudley, A. M., C. Rougeulle, and F. Winston. 1999. The Spt components of SAGA facilitate TBP binding to a promoter at a post-activator-binding step in vivo. Genes Dev. 13:2940-2945.[Abstract/Free Full Text]
  12. Edmondson, D. G., M. M. Smith, and S. Y. Roth. 1996. Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4. Genes Dev. 10:1247-1259.[Abstract/Free Full Text]
  13. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.[CrossRef][Medline]
  14. Green, S. R., and A. D. Johnson. 2004. Promoter-dependent roles for the Srb10 cyclin-dependent kinase and the Hda1 deacetylase in Tup1-mediated repression in Saccharomyces cerevisiae. Mol. Biol. Cell 15:4191-4202.[Abstract/Free Full Text]
  15. Grishin, A. V., M. Rothenberg, M. A. Downs, and K. J. Blumer. 1998. Mot3, a Zn finger transcription factor that modulates gene expression and attenuates mating pheromone signaling in Saccharomyces cerevisiae. Genetics 149:879-892.[Abstract/Free Full Text]
  16. Gromoller, A., and N. Lehming. 2000. Srb7p is a physical and physiological target of Tup1p. EMBO J. 19:6845-6852.[CrossRef][Medline]
  17. Huang, M., Z. Zhou, and S. J. Elledge. 1998. The DNA replication and damage checkpoint pathways induce transcription by inhibition of the Crt1 repressor. Cell 94:595-605.[CrossRef][Medline]
  18. Kaiser, C., S. Michaelis, and A. Mitchell. 1994. Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  19. Kang, H. A., H. G. Schwelberger, and J. W. Hershey. 1992. The two genes encoding protein synthesis initiation factor eIF-5A in Saccharomyces cerevisiae are members of a duplicated gene cluster. Mol. Gen. Genet. 233:487-490.[Medline]
  20. Kastaniotis, A. J., T. A. Mennella, C. Konrad, A. M. Torres, and R. S. Zitomer. 2000. Roles of transcription factor Mot3 and chromatin in repression of the hypoxic gene ANB1 in yeast. Mol. Cell. Biol. 20:7088-7098.[Abstract/Free Full Text]
  21. Kastaniotis, A. J., and R. S. Zitomer. 2000. Rox1 mediated repression. Oxygen dependent repression in yeast. Adv. Exp. Med. Biol. 475:185-195.[Medline]
  22. Keng, T. 1992. HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 12:2616-2623.[Abstract/Free Full Text]
  23. Khalaf, R. A., and R. S. Zitomer. 2001. The DNA binding protein Rfg1 is a repressor of filamentation in Candida albicans. Genetics 157:1503-1512.[Abstract/Free Full Text]
  24. Komachi, K., M. J. Redd, and A. D. Johnson. 1994. The WD repeats of Tup1 interact with the homeo domain protein alpha 2. Genes Dev. 8:2857-2867.[Abstract/Free Full Text]
  25. Kuras, L., and K. Struhl. 1999. Binding of TBP to promoters in vivo is stimulated by activators and requires Pol II holoenzyme. Nature 399:609-613.[CrossRef][Medline]
  26. Limbach, M. P., and R. S. Zitomer. 2000. The isolation and characterization of missense mutants in the general repressor protein Ssn6 of Saccharomyces cerevisiae. Mol. Gen. Genet. 263:455-462.[CrossRef][Medline]
  27. Lowry, C. V., M. E. Cerdan, and R. S. Zitomer. 1990. A hypoxic consensus operator and a constitutive activation region regulate the ANB1 gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 10:5921-5926.[Abstract/Free Full Text]
  28. Madison, J. M., A. M. Dudley, and F. Winston. 1998. Identification and analysis of Mot3, a zinc finger protein that binds to the retrotransposon Ty long terminal repeat (delta) in Saccharomyces cerevisiae. Mol. Cell. Biol. 18:1879-1890.[Abstract/Free Full Text]
  29. Mennella, T. A., L. G. Klinkenberg, and R. S. Zitomer. 2003. Recruitment of Tup1-Ssn6 by yeast hypoxic genes and chromatin-independent exclusion of TATA binding protein. Eukaryot. Cell 2:1288-1303.[Abstract/Free Full Text]
  30. Papamichos-Chronakis, M., R. S. Conlan, N. Gounalaki, T. Copf, and D. Tzamarias. 2000. Hrs1/Med3 is a Cyc8-Tup1 corepressor target in the RNA polymerase II holoenzyme. J. Biol. Chem. 275:8397-8403.[Abstract/Free Full Text]
  31. Park, S. H., S. S. Koh, J. H. Chun, H. J. Hwang, and H. S. Kang. 1999. Nrg1 is a transcriptional repressor for glucose repression of STA1 gene expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:2044-2050.[Abstract/Free Full Text]
  32. Proft, M., A. Pascual-Ahuir, E. de Nadal, J. Arino, R. Serrano, and F. Posas. 2001. Regulation of the Sko1 transcriptional repressor by the Hog1 MAP kinase in response to osmotic stress. EMBO J. 20:1123-1133.[CrossRef][Medline]
  33. Redd, M. J., M. B. Arnaud, and A. D. Johnson. 1997. A complex composed of tup1 and ssn6 represses transcription in vitro. J. Biol. Chem. 272:11193-11197.[Abstract/Free Full Text]
  34. Roth, S. Y. 1995. Chromatin-mediated transcriptional repression in yeast. Curr. Opin. Genet. Dev. 5:168-173.[CrossRef][Medline]
  35. Sertil, O., R. Kapoor, B. D. Cohen, N. Abramova, and C. V. Lowry. 2003. Synergistic repression of anaerobic genes by Mot3 and Rox1 in Saccharomyces cerevisiae. Nucleic Acids Res. 31:5831-5837.[Abstract/Free Full Text]
  36. Smith, R. L., M. J. Redd, and A. D. Johnson. 1995. The tetratricopeptide repeats of Ssn6 interact with the homeo domain of alpha 2. Genes Dev. 9:2903-2910.[Abstract/Free Full Text]
  37. Treitel, M. A., and M. Carlson. 1995. Repression by SSN6-TUP1 is directed by MIG1, a repressor/activator protein. Proc. Natl. Acad. Sci. USA 92:3132-3136.[Abstract/Free Full Text]
  38. Tzamarias, D., and K. Struhl. 1995. Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev. 9:821-831.[Abstract/Free Full Text]
  39. Varanasi, U. S., M. Klis, P. B. Mikesell, and R. J. Trumbly. 1996. The Cyc8 (Ssn6)-Tup1 corepressor complex is composed of one Cyc8 and four Tup1 subunits. Mol. Cell. Biol. 16:6707-6714.[Abstract]
  40. Williams, F. E., U. Varanasi, and R. J. Trumbly. 1991. The CYC8 and TUP1 proteins involved in glucose repression in Saccharomyces cerevisiae are associated in a protein complex. Mol. Cell. Biol. 11:3307-3316.[Abstract/Free Full Text]
  41. Wu, J., N. Suka, M. Carlson, and M. Grunstein. 2001. TUP1 utilizes histone H3/H2B-specific HDA1 deacetylase to repress gene activity in yeast. Mol. Cell 7:117-126.[CrossRef][Medline]
  42. Zagorec, M., and R. Labbe-Bois. 1986. Negative control of yeast coproporphyrinogen oxidase synthesis by heme and oxygen. J. Biol. Chem. 261:2506-2509.[Abstract/Free Full Text]
  43. Zaman, Z., A. Z. Ansari, S. S. Koh, R. Young, and M. Ptashne. 2001. Interaction of a transcriptional repressor with the RNA polymerase II holoenzyme plays a crucial role in repression. Proc. Natl. Acad. Sci. USA 98:2550-2554.