Surface Hydrophobicity Changes of Two Candida albicans Serotype B mnn4{Delta} Mutants

Cell surface hydrophobicity (CSH) of Candida species enhancesvirulence by promoting adhesion to host tissues. Biochemicalanalysis of yeast cell walls has demonstrated that the mostsignificant differences between hydrophobic and hydrophilicyeasts are found in the acid-labile fraction of Candida albicansphosphomannoprotein, suggesting that this fraction is importantin the regulation of the CSH phenotype. The acid-labile fractionof C. albicans is unique among fungi, in that it is composedof an extended polymer of ß-1,2-mannose linked tothe acid-stable region of the N-glycan by a phosphodiester bond.C. albicans serotype A and B strains both contain a ß-1,2-mannoseacid-labile moiety, but only serotype A strains contain additionalß-1,2-mannose in the acid-stable region. A knockoutof the C. albicans homolog of the Saccharomyces cerevisiae MNN4gene was generated in two serotype B C. albicans patient isolatesby using homologous gene replacement techniques, with the anticipationthat they would be deficient in the acid-labile fraction and,therefore, demonstrate perturbed CSH. The resulting mnn4 ${Delta}$ -deficientderivative has no detectable phosphate-linked ß-1,2-mannosein its cell wall, and hydrophobicity is increased significantlyunder conditions that promote the hydrophilic phenotype. Themnn4 ${Delta}$ mutant also demonstrates an unanticipated perturbationin the acid-stable mannan fraction. The present study reportsthe first genetic knockout constructed in a serotype B C. albicansstrain and represents an important step for dissecting the regulationof CSH.

INTRODUCTION

Top

Introduction

The modification of proteins by carbohydrate is conserved throughouteukaryotic species. The stepwise addition of carbohydrate tonascent proteins occurs shortly after translocation of the polypeptideinto the endoplasmic reticulum, and posttranslational glycosylationis limited to a subset of total cellular proteins that transitthrough the secretory pathway. Core carbohydrate addition tospecific amino acid residues is essentially identical in alleukaryotes. However, the maturation of glycans is variable betweenspecies and can vary between cell types in a single organism.The addition of glycan to a protein plays various functionalroles for the protein and increases the apparent molecular massof the protein. The dissection of carbohydrate maturation pathwayshas been accomplished by the parallel use of biochemical analysisof glycosylation in many cell types and the identification ofmicrobial mutants defective in carbohydrate addition.

The cell walls of fungi are composed of highly branched polymersof glycan with embedded, highly glycosylated proteins and servean essential role in maintaining the structural integrity ofthe cell (46). The addition of glycans to cell wall glycoproteinsin the budding yeast Saccharomyces cerevisiae has been elucidatedby the identification of a panel of viable loss-of-functionmutants at various points in the pathway (see, e.g., references3-7, 20, and 45), and the basic enzymology of carbohydrate additionis essentially conserved between species. Glycoproteins isolatedfrom these mutants are smaller in mass than those observed fromthe wild-type parent strain, due to the decreased amount ofcarbohydrate. Glycosylation in all eukaryotes can occur viathe addition of carbohydrate to either asparagine residues (N-linked)or to serine or threonine residues (O-linked). Eukaryotic N-linkedglycosylation core carbohydrate addition occurs by the transferof a branched 9-mannose-3-glucose structure to select asparagineresidues on the polypeptide backbone by means of the oligosaccharyltransferasecomplex shortly after the protein enters the lumen of the endoplasmicreticulum (reviewed in reference 8). This core group is thenmodified and extended in yeast by the addition of a long chainof ${alpha}$ -1,6-mannose by proteins coded by OCH1, MNN9, MNN10, VAN1,and others (reviewed in reference 13). This outer chain is subsequentlymodified by the addition of ${alpha}$ -1,2-linked mannose side branches,via the action of MNN2, MNN5, and KTR1 through KTR3 (13). Theseside branches are terminated by an ${alpha}$ -1,3-mannose unit, attachedby Mnn1p. Mannosylphosphate is added to a subset of the sidebranches by the action of the MNN4 and MNN6 genes, which hasthe functional effect of contributing a net negative chargeto the cell wall. Phenotypically, the ability of the cell wallto bind the cationic dye Alcian blue can differentiate betweenstrains containing mannosylphosphate and those that do not containthe structure (6, 17). The mannosylphosphate is further modifiedby the addition of a variable number of mannose residues. Theseresides are termed the acid-labile region, due to the mild acidsensitivity of the phosphodiester bond linking them to the remainderof the glycoprotein.

The relationship between the MNN4 and MNN6 genes is complexand not yet resolved. The initial genetic description of theS. cerevisiae mnn4-1 allele (6) indicated that this mutant operatedin a dominant-negative manner relative to the wild-type locusin heterozygous strains, and this conclusion was further confirmedby complete deletion of the MNN4 gene (41). A closely relatedgene sequence (YJR061w) does not complement the mnn4 ${Delta}$ defect,and deletion of that gene does not result in the loss of theability of the strain to bind the Alcian blue (32). Sequenceanalysis of the MNN4 gene product did not indicate an obviousrole of the protein in mannosylphosphate transfer but suggesteda role in regulating the activity of MNN6 (42). The MNN6 geneproduct in S. cerevisiae shares significant structural similaritywith the KRE2/MNT1 family of mannosyltransferases, and deletionof that gene is recessive (56). Jigami and Odani (32) have proposedon the basis of this relationship that Mnn4p acts as a positiveregulator of Mnn6p mannosylphosphate transfer in a dose-dependentmanner with an unidentified negative regulator of transferaseactivity. In vitro demonstration of this model has not beenaccomplished. Functionally, null mutants of the mnn4 and mnn6genes present essentially the same phenotype, resulting in completeloss of detectable cell wall phosphate detected by Alcian bluebinding.

The cell wall of the commensal pathogen Candida albicans isbiochemically similar to that of S. cerevisiae, and sequencingof the C. albicans genome has readily identified gene homologsin many of the carbohydrate maturation pathways that have previouslybeen described in S. cerevisiae. A modification unique to C.albicans is the stepwise addition of ß-1,2-mannosepolymers to the mannosylphosphate that is added in S. cerevisiaeby the MNN4 and MNN6 genes. The biosynthetic and genetic basisfor ß-1,2-mannose addition has not been described,although it is presumed to be the result of two or more enzymes.This conclusion is based on the observations of Suzuki and coworkers,who have identified enzymatic activities responsible for invitro ß-mannosyltransferase activities that vary intheir substrate specificity (54).

Clinical isolates of C. albicans can be broadly differentiatedinto two serotypes, originally described by Hasenclever andMitchell (23), based on their immunoreactivity with specificagglutinating sera (Candida Check; Iatron Laboratories). Theindividual differences between serotypes can be traced to differencesin their cell wall glycoproteins. Specifically, ß-1,2-mannoseis found in both the acid-stable and acid-labile region of serotypeA strains, whereas it is only in the acid-labile region of serotypeB strains (Fig. 1). Suzuki et al. have speculated (54) thatthe lack of ß-1,2-mannose in the acid-stable regionin serotype B strains is the result of a mutational event affectingone of the enzymes responsible for ß-1,2-mannose addition.

View larger version (23K):
[in this window]
[in a new window]
FIG. 1. N-linked carbohydrate structure of serotype B C. albicans mannoproteins. White circles represent ${alpha}$ -1,6-linked mannose, gray circles represent ${alpha}$ -1,2-linked mannose, and black circles represent ß-1,2-linked mannose attached to ${alpha}$ -1,2-mannan chains via a phosphodiester bond that defines the acid-labile mannan region. The extended ${alpha}$ -1,6-linked mannose backbone can be very extensive, and ${alpha}$ -1,2-mannose side chains can be of variable length along the backbone. Mannosylphosphate addition can also occur at multiple sites along the ${alpha}$ -1,2-mannose side chains, resulting in significant heterogeneity of the mature glycan. Serotype A C. albicans strains contain additional ß-1,2-mannose extending the ${alpha}$ -1,2-mannose residues in the acid-stable region which is not phosphate linked.

Recently, a homolog of the C. albicans MNN4 gene has been described(29), and elimination of that gene in the standard strain (strainCAI4 [16]) for knockout generation results in a derivative thatis negative for cell wall mannosylphosphate addition and doesnot have an acid-labile mannan fraction. Strain CAI4 is derivedfrom a serotype A isolate and, as a result, still contains ß-1,2-mannosein its acid-stable region. The C. albicans MNN4 gene is oneof a family of related gene products in this fungal speciesthat can be identified by computer analysis of the C. albicansgenome, and the contribution of the rest of the members of thefamily to mannosylphosphate addition is not known.

As part of our ongoing studies of cell surface hydrophobicity(CSH) as a virulence contributor of C. albicans, we describedvariations in the acid-labile region of serotype B clinicalisolates and their correlation with CSH (36, 37). Specifically,acid-labile mannan lengths in phenotypically hydrophobic cellsare generally longer than in hydrophilic cells. Acid-stablemannan is comparable in structure in hydrophobic and hydrophiliccell populations, suggesting the hypothesis that regulationof a single modification is able to affect cell wall ultrastructureand surface hydrophobic characteristics (35). Because serotypeA strains still contain readily detectable amounts of ß-1,2-mannosein their acid-stable regions, we have constructed a deletionderivative of the MNN4 gene in two serotype B strains by usinga standard homologous recombination approach for gene targetingin order to test the hypothesis that the ß-1,2-mannosestructure directly affects CSH. The consequences of this knockouton adhesion and pathogenesis were also assessed.

MATERIALS AND METHODS

Top

Materials and Methods

Strains and growth. Strains used in this study are summarized in Table 1. The mnn4 ${Delta}$ /mnn4 ${Delta}$ derivative of CAI4, designated CDH5, was kindly provided byN. Gow and R. Hobson (Aberdeen University). The mnn9 ${Delta}$ /mnn9 ${Delta}$ derivativeof CAI4, designated SS-19, was obtained from C. Specht (BostonUniversity). The mnn9 deletion derivative contains a significantN-glycan defect and only adds the core glycan to proteins; itdoes not add mannosylphosphate. CAI4 and serotype B strainsLGH1095 (ATCC MYA-2719 and A9 [57]) were used for the generationof knockout derivatives and were grown in phosphate-buffered0.67% yeast nitrogen base (Difco)-2% glucose (YNB2G) mediumat either 25 or 37°C to early stationary phase as described(28). Strains with a ura^– phenotype were grown in mediumcontaining 1% yeast extract, 2% peptone, and 2% dextrose. Allstrains were maintained as frozen stocks (–80°C) in100 mM sucrose-2 mM ZnSO₄ (25).

View this table:
[in this window]
[in a new window]
TABLE 1. C. albicans derivatives of CAI4 used in this study

Knockout strategy. Potential homologs of the S. cerevisiae MNN4 gene were identifiedin the unannotated C. albicans genome database by using theFASTA algorithm. Elimination of the MNN4-3 gene in strain CAI4to generate strain CA-DSH5 was accomplished by using the modifiedURA-blaster strategy (58) with PCR primers flanking the putativeMNN4 gene open reading frame (ORF). This gene sequence was thefirst gene identified during our screen for MNN4 homologs inthe initial publicly accessible iteration of the C. albicansgenomic database.

To knockout the MNN4 homolog in the URA⁺ serotype B strains,we used the positive selection scheme used by Wirsching et al.(59) for targeted gene disruption in C. albicans. PCR fragmentsof 600 to 800 bp in size flanking the ORF of the MNN4 gene weregenerated by using the MNN4 sequence to design primers (mnn4F1,GGCCCCTCGTTTATAATAGCAACAAC; mnn4F2, GCTCGAGGAACCAAAGAATAATAACCCTG;mnn4F3, GCTCGAGGCTAAATAGTCAATGTTGTAAT; mnn4R1, CCGCGGGATAATGGGTTTATGGAAATTG;mnn4R2, CCGCGGGCAATTGACTTTTGGTAAATC; and mnn4R3, GGAGCTCGCTTAACACCTCATTTTAATCC).Two MNN4 knockout cassettes were cloned to eliminate eitherallele of the MNN4 locus. Primers mnn4F1/mnn4F2 and mnn4R2/mnn4R3were used to amplify MNN4 segments at the 5' and 3' ends ofthe ORF, respectively, for one knockout cassette, and primersets mnn4F1/mnn4F3 and mnn4R1/mnn4R3 were used to amplify segmentsfor a second cassette. Fragments were cloned into plasmid pSFI1to flank an expression cassette conferring mycophenolic acidresistance and the FLP recombinase gene under the control ofthe C. albicans inducible secreted aspartyl proteinase promoter.The expression cassette is in turn flanked by tandem repeatsthat are able to recombine and loop out the cassette after integrationand induction by growth in medium containing bovine serum albumin(BSA) as the sole nitrogen source.

Strains LGH1095 and A9 were transformed by the standard LiAc-mediatedmethod (58) or by electroporation (44) and plated on YNB2G agarplates containing 10 µg of mycophenolic acid (Sigma) perml for incubation at 30°C until colonies appeared. Candidatecolonies were restreaked to fresh plates, and potential heterozygoteswere assessed by Southern blotting for proper insertion of thetransforming cassette at the MNN4 locus. Mycophenolic acid (MPA)-resistantheterozygotes were reverted to MPA sensitivity by incubationin yeast carbon base-BSA liquid medium at 30°C for 3 days.Cells from growth in yeast carbon base-BSA medium were platedto single colonies and scored for MPA sensitivity or resistance.MPA-sensitive clones were retransformed as before to knock outthe other locus by selection on MPA-containing plates. Potentialhomozygotic transformants were screened phenotypically by growingclones in 96-well plates and were assayed for Alcian blue bindingin microtiter plates, based on the observation of multiple investigators(6, 17, 29) that elimination of the MNN4 gene results in greatlydiminished levels of dye binding.

For subsequent reintegration of the intact MNN4 gene into thedeletion mutant, a reintegration vector was constructed by replacingthe URA3 gene of vector CIP10 (39) with the nourseothricin resistancecassette from vector pSFS2 (44) to construct vector pNATCIP.A full-length MNN4 genomic clone was generated by PCR by usingthe primers CAMNN4-7 (GAACAAGAGCTCTCTTCTTTTTCTTTTATAAC; [29])and CAMNN4-Pst (GCTATGGTAACTGCAGTTGAAACCGG) and subcloned intopNATCIP, which allowed targeting of the reintegration vectoreither to the RP10 locus advocated by Murad et al. (39) andused for reintegration of the C. albicans MNN4 gene by Hobsonet al. (29) by digestion with StuI or to the native MNN4 locusby digestion with BglII. Transformation of the deletion derivativeto generate reintegrants was accomplished by electroporationaccording to the method of Reuss et al. (44) by using gel-purifiedlinearized plasmid DNA, allowing a 3-h recovery period postelectroporationprior to plating on agar plates containing 1% yeast extract,2% peptone, and 2% dextrose supplemented with 100 µg ofnourseothricin (Werner BioAgents; Jena, Germany).

Phenotypic analysis of the mnn4 ${Delta}$ /mnn4 ${Delta}$ mutant. Growth rate and germination efficiency were measured as previouslydescribed (50). Whole glycoproteins were analyzed followingenzymatic release from intact cells by digestion with Zymolyase100T (ICN) in the presence of 1 M sorbitol as an osmotic stabilizeras described (49). Protein samples were then subjected to Westernblot analysis by using monoclonal antibody (MAb) B6.1, recognizinga ß-1,2-mannotriose structure (9), and MAb B6 (21),which recognizes an incompletely characterized epitope on theacid-stable region (both antibodies courtesy of J. Cutler, ResearchInstitute for Children, New Orleans, La.).

Adhesion of yeasts to extracellular matrix proteins was measuredon coated tissue culture plastic in a static binding assay (38,50) and on coated glass capillaries in a dynamic shear bindingassay (18). The static adhesion assay was performed by allowingyeast cells to adhere to fibronectin-coated tissue culture dishesfor 15 min at 37°C, and nonadherent cells were gently washedoff. Dishes were then overlaid with corn meal agar and incubatedovernight at 30°C for subsequent quantification of CFU.Sterile glass capillaries were prepared for the shear forceassay by coating with fibronectin overnight as described elsewhere(38), and the capillaries were then washed five times with assaybuffer (Dulbecco's phosphate buffer with Mg²⁺ and Ca²⁺, pH 7.4).The capillary was placed in line into a recirculating buffersystem and exposed to a constant shear force of 2 dynes/cm²(equivalent to venous capillary shear force), and yeast cellswere introduced via a sampling port. Adhesion was measured microscopicallyas yeast foci attached per unit area of capillary after 8 minof incubation.

Assays. CSH was measured by the hydrophobic microsphere assay developedin our laboratory (24, 27). Microsphere attachment is assessedby bright field microscopy at a magnification of x400. The percentageof cells with three or more attached spheres is recorded asthe percent hydrophobicity. Hexose content was determined bythe phenol-sulfuric acid method of Dubois et al. (14). Sampleabsorbances were compared to a mannose standard curve. Proteinconcentration was determined by the bicinchoninic acid assay(Pierce Chemical) (51). BSA was used as the standard proteinto generate a standard curve. Phosphate concentration was determinedby using the method of Ames and Dubin (1) with K₂HPO₄ to makea standard curve and D-glucose-6-phosphate as a control. Oligosaccharideconcentration was determined by measuring the concentrationof reducing ends as reported by Dygert et al. (15).

Alcian blue binding of C. albicans derivatives was assessedas described previously (41) and according to the method ofWang et al. (56). The cationic dye Alcian blue binds to phosphatein the yeast cell wall. A culture of early stationary phaseyeast was pelleted and suspended in 0.05% Alcian blue dye dissolvedin 0.02 N HCl and incubated for 15 min at room temperature.The cells were then pelleted and assessed visually for dye binding.To quantify dye binding, constant numbers of cells were resuspendedin dye as above, and dye remaining in the supernatant afterbinding was measured spectrophotometrically and compared toa dye standard curve. Residual levels of Alcian blue dye bindingin mutants is due to incompletely dissolved dye.

Systemic challenge. Six-week-old female AJ mice were challenged via injection intothe lateral tail vein with 10⁵ to 10⁶ live yeast cells suspendedin Hanks' buffered saline and monitored three times daily fordevelopment of disease. For coinfection, a suspension of equalnumbers (2 x 10⁵ to 5 x 10⁶ total CFU) of C. albicans strainLGH1095 and its mnn4 ${Delta}$ /mnn4 ${Delta}$ derivative were injected into miceand monitored for disease progression. Kidneys were recoveredfrom animals following euthanasia and homogenized in sterilewater (55), and infective CFU were isolated following platingof the homogenate onto YNB2G agar plates. The phenotype of individualcolonies was determined by overnight growth in liquid culturein 96-well plates, followed by determination of Alcian bluebinding as described above. All animal work was carried outin American Association of Laboratory Animal Care-approved facilitiesby using protocols approved for use by the University of VirginiaInstitutional Animal Care and Use Committee.

Mannoprotein preparation. Glycans (glucan and mannoprotein) were extracted from the cellwall by using a protocol based on that of Peat et al. (43) anddescribed previously (35, 37). The washed cell pellet was immediatelysuspended in 50 ml of distilled H₂O, and the cell suspensionwas autoclaved at 121°C for 90 min. Mannoprotein was separatedfrom glucan by using a sequential ethanol precipitation strategybased on that of Lloyd (34, 36). Fractionation of mannan intoacid-labile and acid-stabile fractions was carried out by mildacid hydrolysis as described previously (35) and labeled with8-aminonaphthalene-1,3,6-trisulfonic acid (ANTS) for fluorophore-assistedcarbohydrate electrophoresis (FACE) analysis (37). Acid-stablefractions were further hydrolyzed in acid as previously described(35) to preferentially digest the ${alpha}$ -1,6-glycosidic backbone,leaving the side branches intact for subsequent FACE analysis.Dextran ( ${alpha}$ -1,6-glucose) (catalog no. 31391; Fluka) was subjectedto acid hydrolysis (60), fluorescently labeled, and used asan electrophoretic mobility marker.

FACE. FACE was performed essentially as described by Jackson (31)and modified by Goins and Cutler (19). Prior to use, gel plateswere soaked in 10% (wt/vol) methanolic KOH, washed with detergent(7X; ICN), rinsed with deionized water, and finally rinsed with95% ethanol. Electrophoresis was carried out in a Hoeffer SE600gel electrophoresis apparatus (Amersham). Run parameters were600 V for 4 to 6 h or until the ANTS front reached 1 cm fromthe bottom of the gel. The gel was cooled with a recirculatingwater bath set to 4°C. Gels were imaged with a Kodak EDAS290 system containing a DC290 digital camera and UV transilluminator(302 nm). Image contrast and brightness were optimized by usingPhotoshop version 7.0 (Adobe).

RESULTS

Top

Results

Elimination and reintegration of MNN4. The present study describes the first knockout of a gene involvedin N-linked glycosylation in a serotype B isolate of C. albicans.The MNN4 gene is essential for the biosynthesis of the acid-labilefraction of cell wall mannoproteins in yeast, and eliminationof this gene product in both S. cerevisiae and C. albicans hasthe effect of blocking the addition of mannosylphosphate to ${alpha}$ -1,2-mannose side branches on N-glycans (Fig. 1). This mannosylphosphateis further modified by an enzyme presumably unique to Candidaspecies that transfers mannose to extend ß-1,2-linkedmannose polymers of various length. Although C. albicans knockoutsare generally made in the CAI4 strain, this strain was derivedfrom a serotype A clinical isolate, which has been demonstratedto add ß-1,2-mannose to the acid-stable mannan fractionand to show less hydrophilicity than serotype B strains whengrown at 37°C (37). As a result, although an mnn4 ${Delta}$ /mnn4 ${Delta}$ knockoutderived from CAI4 does not bind the dye Alcian blue (29), itretained significant immunoreactivity with an antibody of clinicalrelevance (21) that recognizes a ß-1,2-manntriose.

Elimination of the MNN4 gene in two serotype B C. albicans strainsresulted in derivatives that are virtually negative for bindingthe cationic dye Alcian blue (Fig. 2) and generates white cellpellets in comparison to the dark blue pellets seen for theparent strains. This confirms and extends the observation madefor a knockout derivative of the same gene in the standard strainbackground used for C. albicans genetic studies (29). Heterozygoticstrains were observed to generate an intermediate phenotypefor Alcian blue binding. The exponential phase growth rate ofthe LGH1095 mnn4 ${Delta}$ /mnn4 ${Delta}$ derivative was comparable to the parentstrain in YNB2G medium at 25°C. The A9 mnn4 ${Delta}$ /mnn4 ${Delta}$ demonstrateda slight ( $~$ 20%) reduction in exponential phase growth rate, butstationary phase cell densities (26 h) were comparable. A moderategrowth defect (as assessed by colony size) was observed by platingthe mnn4 ${Delta}$ /mnn4 ${Delta}$ strain on Sabauroud's glucose plates at 24 h,but comparable colony sizes were observed at later time points.Both strain backgrounds showed similar yeast-to-hyphal transitionof the derivatives upon reinoculation at low cell density intodefined media (Table 2). Dye binding in the LGH1095 and A9 mnn4 ${Delta}$ /mnn4 ${Delta}$ derivatives was diminished to levels observed for the serotypeA mnn4 ${Delta}$ /mnn4 ${Delta}$ strain in comparison to the parent strains (Table3). Reintegration of the MNN4 gene in the LGH1095 mnn4 ${Delta}$ /mnn4 ${Delta}$ derivative to the MNN4 locus by digestion of the targeting cassettewith BglII appeared to be efficient, as greater than 90% ofthe transformants recovered Alcian blue dye binding. In contrast,only about 10% of colonies recovered from transformants withStuI-digested DNA targeting the RP10 locus demonstrated recoveredAlcian blue binding. This result is consistent with the observationof Hobson et al. (29) that multiple copies of the reintegratedMNN4 gene are necessary to rescue the mutant phenotype whenthe RP10 locus is used to target reintegration.

View larger version (128K):
[in this window]
[in a new window]
FIG. 2. (A) Restriction map of MNN4 locus. The genomic region containing the C. albicans MNN4 gene (ORF, nucleotides 27312 to 30302 of contig19-10162; GenBank accession no. AACQ01000084) is mapped schematically for the wild-type, MPA-sensitive deletion, and the nourseothricin-resistant (reintegrant) loci. Hash marks indicate HinDIII (H), EcoRI (R), BglII (B), SacII (S), and XhoI (X) sites in the sequence, and the black bar indicates the probe fragment from the 3' end of the MNN4 gene sequence used for Southern blotting. (B) Southern analysis of LGH1095 and derivatives. Genomic DNA prepared from strains LGH1095 (lanes 1), CA-DSH4 (lanes 2), and CA-DSH6 (lanes 3) was digested by restriction enzymes EcoRI or HinDIII, separated by agarose electrophoresis, and transferred to nylon for Southern blotting. Blots were hybridized in formamide-containing hybridization buffer overnight at 45°C with ³²P-labeled probe corresponding to the 3' end of the MNN4 open reading frame, washed at high stringency at 62°C, and then exposed to film. (C) Alcian blue binding by LGH1095 and mnn4 derivative. Colonies of either strain LGH1095 or the isogenic mnn4-deficient derivative (CA-DSH4) were grown overnight in YNB2G medium in 96-well microtiter plates. Following overnight growth, cells were pelleted and resuspended in a solution of 0.05% Alcian blue dye in 0.02 N HCl for 15 min at room temperature. The microtiter plate was again centrifuged and was inspected visually. Wild-type cell clones are able to bind all of the dye in solution and generate blue cell pellets. Mutant cell clones do not bind the dye, generate creamy white cell pellets, and leave unbound dye in the well that can be quantified by spectrophotometry. Comparable results are observed with strain CA-JMH1.

View this table:
[in this window]
[in a new window]
TABLE 2. Phenotypic characterization of mnn4 ${Delta}$ mutants^a

View this table:
[in this window]
[in a new window]
TABLE 3. Relative Alcian blue binding by glycosylation-deficient C. albicans derivatives grown at 37°C

Although there is an increasing number of other C. albicansgenes that appear to be redundant or cooperative members ofmultiple paralog gene families, elimination of a single ORFled to a derivative that is phenotypically similar to the homologousgenetic knockout in S. cerevisiae. The function of other membersof the MNN4 gene paralog family is unknown; however, knockoutof one of these genes during the initial phase of this study(orf19.5557; this represents the second most similar ORF tothe S. cerevisiae MNN4 gene sequence by FASTA analysis withan E value of 10^–7 and contains significant conservationof domain order with the budding yeast protein) in the strainCAI4 background had the result of partially lowering total Alcianblue binding (Table 3, strain CA-DSH5). This result was notunexpected, however, as a recent survey of 622 nonessentialS. cerevisiae deletion strains found that approximately 10%showed alterations in Alcian blue binding (11), concluding thatmany diverse cellular pathways can ultimately contribute tothe amount of cell wall mannosylphosphate.

Hydrophobicity and adhesion of the mnn4 ${Delta}$ /mnn4 ${Delta}$ knockout. Our phenotypic analysis of the two serotype B mnn4 ${Delta}$ /mnn4 ${Delta}$ deletionstrains had determined that the CSH of the mutants was indistinguishablefrom the parent strain in cells grown under conditions thatpromote the hydrophobic phenotype. When grown under conditionsthat promote the hydrophilic phenotype at 37°C, wild-typestrain cell populations are composed of less than 5% hydrophobiccells, whereas hydrophobicity in the mnn4 ${Delta}$ /mnn4 ${Delta}$ knockout derivativesreproducibly increased to 25 to 60% (Tables 2 and 4). This resultwas different from what has been observed in the serotype Amnn4 ${Delta}$ /mnn4 ${Delta}$ deletion derivative CDH5, which demonstrated CSH levelscomparable to the parent strain CAI4 under all growth conditions(data not shown).

View this table:
[in this window]
[in a new window]
TABLE 4. Compositional analysis of C. albicans mannan

Adhesion of the mutant derivative grown at 37°C as assessedin a static binding assay to fibronectin-coated plates was slightlyelevated relative to strain LGH1095. Cells of either type grownat 25°C to promote the hydrophobic phenotype bound equallywell. A much more pronounced difference was observed when therewas adhesion of yeasts to coated capillaries under physiologicshear forces (Table 2). The knockout derivative grown at 37°Cbound significantly more frequently to fibronectin-coated capillariesthan the parent strain, correlating with the observed differencesin hydrophobicity. The increased difference between the mutantand parent strains in the shear assay demonstrates the benefitsof the assay for assessing relative changes in adhesion.

Virulence of the mnn4 ${Delta}$ /mnn4 ${Delta}$ knockout. We have also examined the relative virulence of the knockoutstrain by systemic infection via the lateral tail vein in AJmice. Both the mutant and parent strains were virulent at 10⁵or 10⁶ CFU/dose, and the disease course progresses with similarkinetics in both cases (data not shown). We have additionallyused the mnn4 ${Delta}$ /mnn4 ${Delta}$ derivative together with strain LGH1095 incoinfection experiments and recovered CFU from kidneys of animalsat the experimental endpoint. Colonies (24 per mouse; 5 miceper infective dose; 3 different doses of between 2 x 10 to 5x 10⁶ CFU per dose) were then randomly chosen and plated in96-well plates, grown overnight, and phenotypically scored aseither the knockout or parent. Equal ratios of mutant to parentcells were observed directly after infection and up to 3 dayspostinfection, indicating that neither strain has a short-terminfective advantage relative to the other. The serotype A mnn4 ${Delta}$ /mnn4 ${Delta}$ mutant was also found to be equally virulent in mice in comparisonto its cognate parent strain and did not demonstrate a deficitin macrophage interaction (29).

Altered immunoreactivity of carbohydrate epitopes in the mnn4 ${Delta}$ /mnn4 ${Delta}$ mutant. The most significant phenotypic effects of the mnn4 ${Delta}$ /mnn4 ${Delta}$ mutantare on the mature structure of cell surface glycoproteins. Boththe serotype A and serotype B mnn4 ${Delta}$ /mnn4 ${Delta}$ derivatives lack anacid-labile mannan fraction on N-linked wall glycoproteins.The serotype B mutants were unreactive with an antibody thatrecognizes the ß-1,2-mannotriose structure that isadded distally to the mannosylphosphate, which is missing dueto the disruption of MNN4 (Fig. 3, top panel). However, theserotype A mnn4 ${Delta}$ /mnn4 ${Delta}$ strain CDH5 retained significant immunoreactivitywith MAb B6.1. Deletion derivatives constructed in both serotypesshowed an unanticipated altered immunoreactivity with an antibodythat is reactive with an incompletely characterized epitopeon the acid-stable mannan region (Fig. 3, bottom panel).

View larger version (65K):
[in this window]
[in a new window]
FIG. 3. Immunoreactivity of glycosylation-deficient C. albicans derivatives with anticarbohydrate antibodies. Cell wall proteins from stationary phase cultures of C. albicans glycosylation mutants were extracted by digestion with Zymolyase 100T (a ß-1,3-glucanase; ICN Biochemicals) and separated by on 12% polyacrylamide gels for transfer to nitrocellulose. Western blots were probed either with MAb B6.1, which recognizes a ß-1,2-mannotriose, or MAb B6, which recognizes an incompletely characterized epitope in the acid-stable mannan fraction. Lanes were loaded with equal amounts of protein, which resulted in a consistent pattern across the blot as visualized by staining with Ponceau S. The sample on the right (LGH1095*) represents total cell lysate generated by glass bead breakage of a cell pellet (49).

FACE analysis. Absence of the acid-labile fraction in the serotype B mnn4 ${Delta}$ /mnn4 ${Delta}$ mutants was further demonstrated by FACE analysis (Fig. 4).Mannoproteins extracted from wild-type, hydrophobic cells producedgreater amounts of acid-labile oligosaccharides. The concentrationof oligosaccharide was 5- to 10-fold higher in these samplesthan in any other sample. An unexpected result was that a smallamount of oligosaccharide was detected in the acid-labile fractionof the mnn4-disrupted strains. Because of the sensitivity ofthe assay, the detected oligosaccharide could represent environmentalcontaminants. The material detected by the oligosaccharide assaycan be seen as a faint signal in some of the mnn4 lanes. Theweakness of this signal relative to the wild-type lanes suggeststhat this is not due to bona fide acid-labile mannan. Furthermore,none of the bands in the mnn4 lanes comigrates with bands inthe wild-type samples. This indicates that none of the mnn4bands are ß-1,2-oligomannosides because electrophoreticmobility is affected by glycosidic linkage anomericity ( ${alpha}$ versusß) and position and the component monosaccharides(J. Masuoka and K. C. Hazen, unpublished results.) More likely,it is due to a small amount of acid hydrolysis of the underlyingglucan that takes place even in 10 mM HCl when heated in boilingwater for 60 min.

View larger version (66K):
[in this window]
[in a new window]
FIG. 4. Acid-labile mannan analysis of C. albicans derivatives by purification and FACE. Bulk mannan was prepared from wild-type (LGH1095 and A9) and mnn4 ${Delta}$ /mnn4 ${Delta}$ cells grown at either 25°C (RT) (hydrophobic cells, lane 1) or 37°C (hydrophilic cells, lane 2) and extracted to obtain the acid-labile fraction as described in the text. Equal moles of reducing end sugars were labeled with ANTS, electrophoretically separated, and visualized by UV-fluorescence. wt, wild type.

A perturbation of the acid-stable region is also apparent byFACE analysis where acetolysis of the acid-stable mannan wasfollowed by electrophoretic separation of the released branches.Compared to the wild-type cells, acetolysates from the mnn4 ${Delta}$ /mnn4 ${Delta}$ strains showed a greatly simplified electrophoretic profile(Fig. 5). The number of bands was reduced, and their relativemobilities were changed in most cases. In addition, the majorityof the fluorescent signal appeared at the top of the gel. Oneinterpretation of this result is that the structure of the acid-stablemannan (e.g., the ${alpha}$ -1,6-mannose backbone which is cleaved duringacetolysis) in mnn4 ${Delta}$ /mnn4 ${Delta}$ cells has been altered so that it ismore resistant to acetolysis than the corresponding fractionfrom wild-type cells. The significant loss of MAb B6 immunoreactivityseen in Fig. 3B could therefore be due to obscuring of the epitopeas a result of this change in structure, without any other significantdisruption of the mature mannan biosynthesis.

View larger version (93K):
[in this window]
[in a new window]
FIG. 5. Acid-stable mannan analysis of C. albicans derivatives by purification and FACE. Bulk mannan was prepared as before from wild-type (LGH1095 and A9) and mnn4 ${Delta}$ /mnn4 ${Delta}$ cells grown at either 25°C (hydrophobic cells) or 37°C (hydrophilic cells). The ${alpha}$ -1,6-mannose backbone of purified acid-stable mannan was cleaved by acetolysis as described in the text, and equal moles of cleaved reducing ends were labeled with ANTS and electrophoretically separated as described in the legend of Fig. 4. The left-hand lane is a labeled ladder of hydrolyzed dextran ( ${alpha}$ -1,6-glucose) as an approximate sizing standard, and the right-hand lane is a acid-labile ladder from phobic cells prepared as described in the legend of Fig. 4. wt, wild type; Dex, dextran; AL, acid-labile ladder; Phil, hydrophilic; Phob, hydrophobic; KO, knockout.

Compositional analysis of mannan prepared from hydrophobic (grownat 25°C) or hydrophilic (grown at 37°C) cells was performedto ascertain whether bulk mannan from wild-type or mnn4 ${Delta}$ /mnn4 ${Delta}$ mutant cells was comparable in makeup (Table 4). Relative levelsof protein to hexose in mannoproteins were very similar betweenthe wild-type strains and cognate mnn4 ${Delta}$ /mnn4 ${Delta}$ mutants, indicatingthat a glycan structure comparable in size is formed. Similarlevels of phosphate were measured in both wild-type and mnn4mutant cells. As Ballou et al. (6) observed in S. cerevisiae,disruption of MNN4 eliminates Alcian blue binding but does noteliminate phosphate from the cell wall (6) (Table 4).

DISCUSSION

Top

Discussion

We have used gene replacement by means of homologous recombinationto independently knockout the MNN4 gene in two serotype B C.albicans strains. Standard molecular techniques in C. albicanstypically use selection of a prototrophic marker for identifyingtransformants. We have used a positive selection scheme (59)to generate a deletion derivative that differs from the parentstrain only at the gene of interest. The selection scheme withmycophenolic acid resistance acquisition is typically leakierthan the standard prototrophic marker selection, resulting inthe need to screen larger numbers of transformants for insertionsof interest; however, the single gene difference between thetwo strains ultimately facilitates phenotypic comparisons betweendeletion derivatives and the parent strain. Of particular significanceis the fact that the recently observed position effects on geneexpression (33, 53) of the URA3 selectable marker are not relevantwith these mutants, making virulence studies easier to interpret.Multiple investigators have reported that reintroduction ofthe URA3 selection marker at different chromosomal sites independentof other mutational events has profound effects on the abilityof the yeast derivative to survive within the host, due to variabilityin the levels of expression of the URA3 gene (2, 10, 33).

The present study was undertaken to further examine the relationshipbetween CSH and mannoprotein makeup. Previous work had demonstratedthat cell walls appear different ultrastructurally between hydrophobicand hydrophilic cell populations (26). However, gross proteinprofiles and overall glycosylation appear similar between thetwo phenotypes, and the major glycosylation difference thathas been found is an increase in the length of the acid-labilemannan fraction in hydrophobic cells (36, 37). This observationhas led us to postulate that the length of this structure inwall mannoproteins affects the folding of cell wall fibrils,potentially by interacting with other proteins or carbohydrates(37). One can extend this reasoning to expect that eliminationof the acid-labile fraction in the serotype B background mightaffect CSH, which we anticipated would result in conversionto the hydrophilic phenotype. We have found that the mnn4 ${Delta}$ /mnn4 ${Delta}$ mutant does have a significant effect on CSH; however, the mutantstrains demonstrate an increased hydrophobic phenotype in comparisonto the parents. The reason for this effect is unknown but doescontinue to support a role of the ß-1,2-oligomannosegroup in the regulation of hydrophobicity, in that subtle differencesin glycosylation can have a remarkable effect on CSH.

Readily detectable levels of phosphate in purified mannan fromwild-type and mnn4 mutant derivatives confirmed earlier observationsin S. cerevisiae. Ballou et al. (6), and before them Friis andOttolenghi (17), speculated that quantity and location of thephosphate groups contributed to Alcian blue binding, suggestingthat in the mnn4 mutant mannosylphosphorylation might occurin a region of the glycan inaccessible to dye binding. Bothgroups observed that mannosylphosphorylation was linked to onlya single gene and correlated with the addition of a single specificgroup to maturing glycoproteins. But both groups also observedcell wall phosphate in the background of an mnn4 or mnn4-likemutant and speculated that this additional phosphate was deeperin the wall and inaccessible to dye. It was unclear from theprevious analyses whether these additional phosphate groupsare also attached to mannoprotein or are on another cell wallcomponent. Several possible scenarios arise to fit these results.First, mannosylphosphorylation continues to occur in the mnn4background, but the phosphate groups are added to glycan proximalto the polypeptide or are on glycoprotein components burieddeeper in the cell wall. In either case, Ballou et al. (6) speculatedthat the phosphate groups might not be accessible enough tointeract with the dye. Unlike Coomassie blue, Alcian blue doesnot form colloids and is relatively small, which likely allowsit to penetrate the outer layers of the cell wall. Our resultssuggest that this interpretation is incorrect by assessing thephosphate content of purified mannoproteins. No acid-labileoligosaccharides were detected throughout the glycan in themnn4 ${Delta}$ /mnn4 ${Delta}$ mutant, indicating that in the purified mannoproteinsalteration of mannosylphosphorylation occurs on a global scale,not just at the distal ends of the glycans more likely to interactwith the dye. Second, phosphate might exist in N-linked glycansaside from an acid-labile mannosylphosphate linkage, such asin the core portion of the N-glycan. Odani et al. (41) observedthat the mannosylphosphate content of the core oligosaccharidein mnn4 mutants was greatly diminished relative to wild-typein S. cerevisiae, suggesting that this source of phosphate isalso not significant in the C. albicans mnn4 mutant. Third,other sources of phosphate distinct from the acid-labile fractionmannosylphosphate that might contribute to cell wall-associatedphosphate are potential plasma membrane contamination or thephospholipomannan fraction that has been recently describedto mediate fungal cell adhesion (12).

An unanticipated perturbation of the acid-stable region is inapparent contradiction to the reported function of the MNN4gene product as strictly a regulator of mannosylphosphate additionin S. cerevisiae (40, 42). No reported role of the MNN4 genehas been biochemically or genetically demonstrated elsewherein the mature mannan structure. The standard model of glycoproteinbiosynthesis holds that maturation of carbohydrate structureoccurs in a sequential manner, due to the action of multiplegene products as the protein migrates through sites within thesecretory pathway, and in yeast this is mainly due to the activityof numerous specific mannosyltransferases. Loss of a specificenzymatic activity would then be predicted not to have an effecton the structure that had been previously synthesized. Our resultssuggest that MNN4 function (and therefore mannosylphosphateor ß-1,2-mannose addition) is important for properglycan structure or function, and elimination of Mnn4p activityhas unexpected repercussions on overall mannan structure. Itis not known whether a perturbation in the acid-stable regionis present in S. cerevisiae mnn4 mutants; however, mannan structureup to the point of ß-1,2-mannose addition is similarbetween the two fungal species. It can be anticipated that ifthe presence of mannosylphosphate is necessary to form a properglycan structure, then the S. cerevisiae mnn4 mutant would demonstratea similar defect. If it is the lack of acid-labile associatedß-1,2-oligomannose in mnn4 ${Delta}$ /mnn4 ${Delta}$ mutants that causesthe acid-stable perturbation, this defect would be restrictedto Candida species. Analysis of the cognate S. cerevisiae mutantsis currently being done.

The physiologic role of glycan mannosylphosphorylation in fungihas not been identified. Comparison of the S. cerevisiae Mnn4psequence with the GenBank database readily identifies paralogoussequences in all fungal genomes deposited to date, arguing thatthe regulation of mannosylphosphate addition has been conservedduring fungal divergence. Elimination of the MNN4 gene in S.cerevisiae and C. albicans demonstrated that mannosylphosphorylationis not essential for viability and in the latter species isnot necessary for virulence in a hematogenous disseminationmodel (the present study) and for macrophage recognition (29).In light of these observations, several possible scenarios canbe postulated about the role of Mnn4p-mediated mannosylphosphorylationin fungi and why it has been preserved among disparate fungalspecies. First, the phosphodiester bond is a labile linkagethat might allow pathogenic fungi to rapidly alter antigeniccharacteristics or other surface properties. However, thereis as yet no evidence that this mechanism is utilized for immunecircumvention by fungi. Second, the carbohydrate-associatedphosphate confers a net negative charge on the cell wall, whichmay mediate intercellular contact through ionic interactionsor disrupt cell aggregation by electrostatic repulsion. Ionicinteractions have been demonstrated in binding of a plant antifungalprotein with yeast phosphomannan (30, 47). Third, mannosylphosphorylationmight be necessary for proper glycan conformation, which inturn would allow proper structure and function of the cell wallelements. The preliminary data presented here are consistentwith this possibility, but further experimentation is necessaryto demonstrate a role for Mnn4p in affecting cell wall morphologyin C. albicans and to extend it to other fungal species.

In summary, elimination of the MNN4 gene blocks the additionof ß-1,2-mannose residues that extend from mannosylphosphate.The ß-1,2-mannose polymer forms an epitope of diagnosticsignificance and of clinical and therapeutic relevance (12,22, 48). Although there is not an immediately obvious effecton virulence in the mouse, absence of this carbohydrate modificationleads to a significant change in CSH, which in turn affectsadhesion to fibronectin. Loss of the acid-labile mannan fractionin a serotype B C. albicans strain does not result in significantchanges in the ratio of protein to hexose, suggesting that theoverall extent of glycosylation is relatively similar in themnn4 ${Delta}$ /mnn4 ${Delta}$ strain background. An uncharacterized perturbationof the acid-stable region as assessed by FACE analysis of purifiedacid-stable mannan and immunodetection supports the hypothesisthat loss of the acid-labile fraction results in an overallchange in mannoprotein conformation and confirms its role inthe regulation of cell surface hydrophobicity.

ACKNOWLEDGMENTS

This work was supported with funds from the Public Health Service'sNational Institute of Allergy and Infectious Diseases grantR01 AI43997.

The authors thank Paula Veldhuis (Department of Pathology, Universityof Virginia) for performing the adhesion assays and statisticalanalysis, Neil Gow (University of Aberdeen) and Richard Hobson(University of Leeds) for helpful discussions and communicatingstrains and results prior to publication, and Jim Cutler (ResearchInstitute for Children) for providing antibodies.

FOOTNOTES

* Corresponding author. Mailing address: Department of Pathology, P.O. Box 800904, 3127 MR5, University of Virginia Health System, Charlottesville, VA 22908-0904. Phone: (434) 243-2744. Fax: (434) 924-2151. E-mail: drs3y{at}virginia.edu.

REFERENCES

Top