This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mishra, M.
Right arrow Articles by Balasubramanian, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mishra, M.
Right arrow Articles by Balasubramanian, M. K.

 Previous Article  |  Next Article 

Eukaryotic Cell, March 2005, p. 567-576, Vol. 4, No. 3
1535-9778/05/$08.00+0     doi:10.1128/EC.4.3.567-576.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Hsp90 Protein in Fission Yeast Swo1p and UCS Protein Rng3p Facilitate Myosin II Assembly and Function

Mithilesh Mishra, Ventris M. D'souza, Kai Chen Chang, Yinyi Huang, and Mohan K. Balasubramanian*

Cell Division Laboratory, Temasek Life Sciences Laboratory, and Department of Biological Sciences, National University of Singapore, Singapore

Received 15 July 2004/ Accepted 6 December 2004


arrow
ABSTRACT
 
The F-actin-based molecular motor myosin II is involved in a variety of cellular processes such as muscle contraction, cell motility, and cytokinesis. In recent years, a family of myosin II-specific cochaperones of the UCS family has been identified from work with yeasts, fungi, worms, and humans. Biochemical analyses have shown that a complex of Hsp90 and the Caenorhabditis elegans UCS domain protein UNC-45 prevent myosin head aggregation, thereby allowing it to assume a proper structure. Here we demonstrate that a temperature-sensitive mutant of the fission yeast Hsp90 (Swo1p), swo1-w1, is defective in actomyosin ring assembly at the restrictive temperature. Two alleles of swo1, swo1-w1 and swo1-26, showed synthetic lethality with a specific mutant allele of the fission yeast type II myosin head, myo2-E1, but not with two other mutant alleles of myo2 or with mutations affecting 14 other genes important for cytokinesis. swo1-w1 also showed a strong genetic interaction with rng3-65, a gene encoding a mutation in the fission yeast UCS domain protein Rng3p, which has previously been shown to be important for myosin II assembly. A similar deleterious effect was found when myo2-E1, swo1-w1, and rng3-65 were pharmacologically treated with geldanamycin to partially inhibit Hsp90 function. Interestingly, Swo1p-green fluorescent protein is detected at the improperly assembled actomyosin rings in myo2-E1 but not in a wild-type strain. Yeast two-hybrid and coimmunoprecipitation analyses verified interactions between Rng3p and the myosin head domain as well as interactions between Rng3p and Swo1p. Our analyses of Myo2p, Swo1p, and the UCS domain protein Rng3p establish that Swo1p and Rng3p collaborate in vivo to modulate myosin II function.


arrow
INTRODUCTION
 
The F-actin based molecular motor myosin II plays a key role in cell division in a variety of eukaryotes (16). Forces produced on interaction of F-actin and myosin II have been proposed to result in the physical severing of one cell into two. Type II myosins are hexameric proteins composed of two heavy chains, two essential light chains, and two regulatory light chains. The heavy chains dimerize on the basis of the coiled-coil sequences in their C termini, and these assembled hexamers also associate to form thick filaments (11). During cytokinesis, myosin II is detected at the cell division site as a component of the actomyosin ring (13, 14, 18). The mechanism of assembly of the myosin II complex and its localization to the cell division site have generated substantial interest.

In recent years, the fission yeast Schizosaccharomyces pombe has emerged as a powerful model organism with which to study cytokinesis, due to its well characterized cell cycle and the availability of mutants defective at various steps in cytokinesis. Importantly, fission yeast cells divide through the use of an actomyosin ring, composed of over 20 proteins, including two type II myosins, Myo2p and Myp2p (12). Myo2p is essential for cytokinesis and cell viability; it associates with two light chains, Cdc4p and Rlc1p (19, 23, 27). Myo2p is detected at the division site during cytokinesis in fission yeast cells (18, 22).

A growing body of evidence from a diverse set of organisms ranging from unicellular to multicellular eukaryotes has implicated the involvement of proteins containing UCS domains in myosin structure and/or function (40). The phenotypes observed on disruption of genes encoding UCS domain proteins indicate abnormalities in specific myosin-associated processes. The UCS domain-containing protein in S. pombe, Rng3p, has previously been shown to be essential for formation of the cytokinetic actomyosin ring, with several lines of evidence indicating an involvement of Rng3p in modulation of Myo2p function (39).

An additional player was introduced when Barral et al., in a landmark study (7), showed that the Caenorhabditis elegans UCS domain protein (Unc45p), which is essential for myosin assembly into thick filaments (6), bound the chaperone protein Hsp90. Hsp90-like proteins have been identified from numerous eukaryotes and aid in the folding, maintenance, and regulation of a diverse set of proteins including cochaperones, kinases, and transcription factors (30). Recent work by Srikakulam and Winkelmann (34) demonstrates that nascent myosin filaments in differentiating muscle cells consist of myosin molecules with unfolded motor domains in a complex with Hsp90 and Hsc70 chaperone proteins.

In this study, we have characterized the in vivo role of Swo1p (the fission yeast Hsp90 homolog) in myosin II assembly and/or function in S. pombe. We show that Swo1p is important for myosin II function in fission yeast and that it cooperates with Rng3p to maintain Myo2p in a functionally stable form.


arrow
MATERIALS AND METHODS
 
Strains, media, and genetic techniques. The S. pombe strains used in this study are listed in Table 1. Cell culture and maintenance were carried out using standard techniques (25). Vegetative cells were grown in YES medium (25). myo2-E1 rng3-65 and myo2-E1 swo1-w1 strains were grown to early log phase in YES medium supplemented with 1.2 M sorbitol, after which the cells were given two washes in YES medium and grown in YES medium for 4 h at 36°C. Genetic crosses were performed by mixing appropriate strains of opposite mating type on YPD plates, and recombinant strains were selected by tetrad dissection carried out on an MSM micromanipulator (Singer Instruments UK). Double mutants were typically isolated from nonparental ditype (NPD) tetrads. Geldanamycin (Sigma, St. Louis, Mo.) was used at 2 µg/ml in dimethyl sulfoxide (DMSO). Sorbitol was used at a final concentration of 1.2 M. Fission yeast transformations were done using the lithium acetate method (26).


View this table:
[in this window]
[in a new window]
  		TABLE 1. S. pombe strains used in this study

Fluorescence and time-lapse microscopy. S. pombe cells were fixed for 10 min with 3.7% formaldehyde for staining of nuclei with 4'6,-diamidino-2-phenylindole (DAPI) at 1 µg/ml (5), Alexa 488-conjugated phalloidin at 100 U/ml, and aniline blue at 0.5 µg/ml. DAPI and aniline blue were dissolved in antifade (1 mg of p-phenylenediamine per ml dissolved in 50% glycerol). Anti-green fluorescent protein (GFP) (Molecular Probes Inc., Eugene, Oreg.), anti-Myo2p antibodies, and anti-TAT1 antibodies (provided by Keith Gull) were used at a dilution of 1:1,000, 1:400, and 1:100, respectively. Alexa-conjugated secondary antibodies (Molecular Probes Inc.) were used at a dilution of 1:100. Images were acquired using a Leica DMLB microscope in conjunction with an Optronics DEI-750T cooled charge-coupled device camera and Leica QWIN software. Images were processed and assembled using Adobe Photoshop 5.5. For time-lapse analysis, cells from a logarithmic-phase culture were concentrated by centrifugation. Borosilicate glass slides and coverslips (Matsunami Trading, Tokyo, Japan) were used in all imaging experiments. Cells (1 µl) were spotted on a slide, and the coverslip was immediately pressed down on the slide to get a good smear of cells. Time-lapse fluorescence microscopy on myo2-E1 swo1-GFP was performed using a Leica DMIRE2 microscope equipped with Uniblitz shutter and CoolSnap HQ charge-coupled device camera (Photometrics) driven by MetaMorph 4.6r9 software (Universal Imaging Corp.). Temperatures above ambient were attained using a temperature-controlled stage (MC 60 Linkman Scientific Instruments). Assembly of images was done using NIH Image 1.62 (National Institutes of Health, Bethesda, Md.).

Construction of Swo1p-GFP. Plasmid pCDL927 was created to generate a strain that expressed a Swo1p-GFP carboxy-terminal fusion protein from its genomic locus. To make pCDL927, the last 1 kb of the swo1+ gene was amplified by PCR using primers bearing the KpnI (5' GCGCGCGGTACCCGCCGTGTTTTCATTACCGA CG3') and SmaI (5' GCGCGCCCCGGGATCGACTTCCTCCATCTTGC 3') sites. The 5' primer with the KpnI site carried an in-frame stop codon to prevent translation of the untagged copy. The 1-kb KpnI-swo1-SmaI fragment was directionally cloned upstream and fused in frame in the GFP gene in the pJK210 GFP plasmid (39). Plasmid pCDL927 was linearized with EcoRI and introduced into the wild-type strain MBY192 (leu1-32 ura4-D18 h–), creating strain MBY2440 (swo1-GFP::ura4+ leu1-32 ura4-D18 h–). Putative integrants selected on plates lacking uracil were subjected to PCR analysis and nucleotide sequence determination to confirm that the desired integration had occurred. Genetic crosses between the individual cytokinesis mutants and MBY2440 were used to create all cytokinesis mutant strains that express the Swo1p-GFP fusion.

Two-hybrid system. A two-hybrid interaction assay using a 5-bromo-4-chloro-3-indolyl {alpha}-D-galactosidase (X-Gal)-based two-hybrid system was carried out using the Matchmaker two-hybrid system (Clontech Laboratories Inc.). The full-length S. pombe rng3 gene was amplified from genomic DNA by PCR with CATGCCATGGAGATGACCCACGAGCTTTCCTC as the 5' primer and CGCGGATCCTCATTTGCTTCCTTGAAGTC as the 3' primer and cloned into the NcoI-BamHI sites of the Gal4BD (pAS2-1) and Gal4AD (pACT2) vectors to create pCDL836 and pCDL841, respectively. The S. pombe myo2 gene corresponding to amino acids 1 to 836 (which includes the head and the two IQ domains of Myo2p) was similarly cloned, using CATGCCATGGAGATGACAGAAGTAATATCTAATAAAATAACTGC as the 5' primer and TCCCCCGGTAGATTGAAAAATAACTTAGTTT as the 3' primer, into the NcoI-BamHI sites of Gal4BD and Gal4AD vectors to create pCDL839 and pCDL844, respectively. The full-length S. pombe swo1 gene was also cloned, using CATGCCATGGAGATGTCGAACACAGAAACTTTCAAG as the 5' primer and CGCGGATCCTTAATCGACTTCCTCCATCTTGC as the 3' primer, into the NcoI-BamHI sites of Gal4BD and Gal4AD vectors to create pCDL838 and pCDL843, respectively. The two types of hybrid plasmids (which carry the yeast TRP1 and LEU2 marker genes) were then cotransformed into the yeast strain Y190 (which is auxotrophic for tryptophan and leucine and has lacZ and his3 reporter genes, each under the independent control of two different GAL4 promoters) using the lithium acetate method of transformation (15). The transformants were first replica plated onto medium lacking leucine and tryptophan to select for those that contained both plasmids. Primary transformants were replica plated onto medium containing 35 mM 3-aminotriazole and lacking histidine as well as tryptophan and leucine to check for expression of the HIS3 reporter gene, indicative of a protein-protein interaction. This interaction was further confirmed by determining the function of the lacZ reporter in His+ Trp+ Leu+ transformants by assaying for ß-galactosidase activity using a colony-lift filter assay as described in the Clontech manual.

Protein extraction, immunoblotting, and immunoprecipitation. Protein extracts were prepared in NP-40 buffer as described previously (37). Briefly, total-cell extracts were prepared from log-phase cells by bead beating in NP-40 buffer (1% Triton X-100, 150 mM NaCl, 2 mM EDTA, 6 mM Na2HPO4, 4 mM NaH2PO4, 1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine, supplemented with protease inhibitor [Complete, EDTA-free; Roche Diagnostics]). For immunoblotting, cells were cultured in YES medium supplemented with 1.2 M sorbitol to an optical density at 595 nm of 0.2, washed twice with YES medium, and grown in YES medium at 36°C for 5 h. Cell extracts were clarified by centrifugation at 16,100 x g for 10 min at 4°C. Equal amounts of total proteins were loaded on sodium dodecyl sulfate (SDS) 0-12% polyacrylamide gels. Myo2p and Arp3p (used as control for normalization) were detected using affinity-purified polyclonal antibodies as previously described (39). Immunoblots were quantitated by densitometry (Bio-rad). For each immunoprecipitation, 3 to 4 mg of soluble protein was incubated with 5 µl of anti-Myo2p, anti-GFP (Molecular Probes), or anti-HA (12CA5; Sigma) antibodies for 1 h at 4°C. Then 100 µl of preswollen Sepharose-protein A beads (Amersham Biosciences) was added to the antigen-antibody immunocomplex, and the mixture was incubated for 45 min at 4°C. The beads were washed six times with 1 ml of NP-40 buffer with 10-min intervals of incubation on the rotor. After the final wash, the beads were resuspended in SDS-polyacrylamide gel electrophoresis (PAGE) gel loading buffer and heated at 95°C for 5 min.

Proteins were separated on SDS-8% polyacrylamide gels and transferred to a polyvinylidene difluoride sequencing. membrane (Millipore Corp., Bedford, Mass.). The membrane was blocked with 5% nonfat milk in phosphate-buffered saline-Tween 20. Primary anti-GFP (Molecular Probes) and 12CA5 (Sigma) antibodies were used at 1:2,000 dilutions, whereas anti-Myo2p was used at a 1:400 dilution. Peroxidase-conjugated anti-rabbit and anti-mouse immunoglobulin G (Sigma) were used at 1:5,000 dilutions, and the enhanced chemiluminescent signal was detected using the ECL1 kit (Amersham) as specified by the manufacturer.


arrow
RESULTS
 
Characterization of the cytokinetic phenotype in swo1-w1 cells. Two temperature-sensitive mutant alleles of the fission yeast Hsp90 chaperone-encoding gene, swo1, have been previously isolated (1, 26). While these studies mainly characterized genetic interactions between the two mutants (swo1-w1 and swo1-26) and the Cdc2 mitotic machinery, it was also observed that the swo1-w1 mutant developed cytokinetic defects when incubated at the restrictive temperature (26). To further characterize the cytokinetic defect in the swo1-w1 mutant, we cultured cells under permissive temperature conditions and then shifted the cultures to the restrictive temperature of 36°C. The cells were fixed and stained with DAPI and aniline blue to visualize the nuclei and septa, respectively. Interestingly, whereas wild-type cells contained approximately 22% binucleate cells and approximately 78% cells with a single nucleus, dramatic cytokinesis defects were detected in the swo1-w1 mutant at the restrictive temperature (Fig. 1A). Only 12% of heat-arrested swo1-w1 cells contained a single nucleus; approximately 42% of the cells contained four or more nuclei, whereas the rest contained two nuclei (Fig. 1B). The septa in swo1-w1 cells were aberrant in appearance (Fig. 1A). Generally, aberrant septation results from assembly of improper actomyosin rings, since constriction of the actomyosin ring is required for and precedes septum assembly.



View larger version (75K):
[in this window]
[in a new window]
  		FIG. 1. Characterization of the swo1-w1 mutant strain. Wild-type (WT) (A) and swo1-w1 (B) strains were grown at permissive temperature to log phase, then shifted to the restrictive temperature of 36°C for 7 h. Cells were fixed, stained with DAPI and aniline blue to visualize nuclei and septa, respectively, and then scored for number of nuclei.

The swo1-w1 mutation leads to defects in actomyosin ring assembly. To assess the status of the actomyosin ring in heat-arrested swo1-w1 cells, we looked at three components of the actomyosin ring in these cells, namely, F-actin and the heavy and regulatory light chains of type II myosin (Myo2p and Rlc1p, respectively). Wild-type cells and swo1-w1 mutant cells were grown at the permissive temperature of 25°C, shifted to the restrictive temperature of 37°C for 7 h, fixed, and stained with DAPI and Alexa 488-conjugated phalloidin to visualize DNA and F-actin structures. The cortical F-actin distribution in interphase swo1-w1 mutant cells was similar to that of control cells; F-actin patches were concentrated at both cell ends, and F-actin cables were oriented along the long axis of the cell (Fig. 2A). Mitotic mutant cells, however, lacked a well-defined ring of F-actin and had arrays of loose medial actin cables instead (Fig. 2A). In addition to F-actin, Myo2p and Rlc1p were improperly assembled at the restrictive temperature in swo1-w1 mutants undergoing mitosis, as determined by the presence of mitotic spindles (Fig. 2B and C). These studies utilizing the cytokinesis-defective mutant, swo1-w1, established that Swo1p is important for actomyosin ring assembly and that the defect in actomyosin ring function presumably leads to the assembly of improper division septa.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 2. Swo1p function is essential for assembly of a normal actomyosin ring. (A) Wild-type (WT) and swo1-w1 cells were grown at 25°C to exponential growth phase and shifted to 37°C for 7 hrs, fixed, and stained with DAPI and Alexa 488-conjugated phalloidin to visualize chromosomes (blue) and F-actin (green). (B) Similarly treated cells of the two genotype were processed for indirect immunofluroscence with anti-Myo2p and anti-tubulin to visualize Myo2p and microtubule structures, respectively. (C) swo1-w1 cells and wild-type cells expressing Rlc1-GFP were grown at 25°C to exponential growth phase and shifted to 37°C for 7 h, fixed, stained with DAPI to visualize chromosomes (blue), with anti-GFP to visualize Rlc1p (green), and with anti-tubulin to visualize microtubule structure (red). The figures shown are enlarged, merged images from a stack of 16 confocal z-sections of 0.4 µm that have been reconstructed and processed using Volocity Visualization (Improvision) software.

The swo1-w1 mutant shows a genetic interaction with myo2-E1 and rng3-65 alleles. The improper septa observed in swo1-w1 cells resembled those observed in cells carrying null mutations in the genes encoding myosin II heavy chain, Myo2p (4), and the UCS domain protein, Rng3p (39), suggesting that Hsp90 function might be important for assembly and/or function of myosin II. Detailed in vitro biochemical studies have shown that the C. elegans myosin II head domain forms a stoichiometric complex with Hsp90 and Unc45p, a C. elegans protein related to S. pombe Rng3p, indicative of a substrate-chaperone-cochaperone relationship among these three proteins (7). To further analyze if Swo1p was similarly associated with myosin II in S. pombe, we assessed genetic interactions among swo1-w1, rng3-65, and three different mutant alleles of myosin II, myo2-E1, myo2-S1, and myo2-S2. It is noteworthy that previous work has shown that rng3-65 displayed a synthetic lethal genetic interaction with the myo2-E1 alleles but not with the myo2-S1 or myo2-S2 alleles (39). Interestingly, we found that swo1-w1 also displayed a strong synthetic lethal interaction with myo2-E1 (Fig. 3A). Double mutants with mutations of the genotype myo2-E1 swo1-w1 were inviable at all growth temperatures, whereas the two parental strains were compromised for cell viability only at higher temperatures (data not shown). Microscopic examination revealed that the double mutants had undergone spore germination and died as elongated single cells (Fig. 3B). To further characterize the phenotype of the myo2-E1 swo1-w1 cells, we rescued the double mutants by tetrad dissection on plates containing sorbitol (data not shown). Wild-type cells as well as mutants with mutations of the genotypes myo2-E1, swo1-w1, and myo2-E1 swo1-w1 were grown at 24°C in medium containing sorbitol and subsequently shifted to medium lacking sorbitol. The cells were then fixed and stained with DAPI and aniline blue. Interestingly, we found that the double mutants were specifically defective in cytokinesis and accumulated multiple nuclei before undergoing eventual lysis and death (Fig. 3C). Additionally, swo1-w1 showed a weak interaction with rng3-65, since the double mutants were incapable of colony formation at 32°C, a temperature at which both the parental strains grew and formed colonies (Fig. 3D). Cells belonging to the rng3-65 swo1-w1 strain showed an exacerbated cytokinetic phenotype compared to cells of the rng3-65 genotype at 32°C. swo1-w1 cells did not show any strong genetic interaction with myo2-S1, myo2-S2, and 14 other mutants defective in cytokinesis (data not shown): cdc3, cdc4, cdc8, cps1, cdc12, cdc15, cdc7, cdc11, plo1, sid1, sid2, sid4, spg1, and cdc16 (4, 9, 20, 23, 28, 33). The other allele of Hsp90 in S. pombe, i.e., swo1-26, also showed a similar synthetic interaction with myo2-E1 and rng3-65 (data not shown). Based on the allele-specific genetic interaction with myo2-E1 and the genetic interaction with rng3-65, we concluded that Swo1p was important for myosin II assembly and/or function.



View larger version (94K):
[in this window]
[in a new window]
  		FIG. 3. The swo1-w1 mutant shows a synthetic lethal interaction with both myo2-E1 and rng3-65 mutant strains. (A) The swo1-w1 mutant was crossed with cells of the myo2-E1 genotype, and resulting tetrads were dissected and grown at 24°C. Four spores from each tetrad are aligned vertically; seven tetrads are shown. P, parental ditype (all spores viable and showing a temperature-sensitive phenotype); N, nonparental ditype (two viable spores and two nonviable); T, tetratype (one nonviable, the remaining viable three showing 2:1 segregation of temperature sensitive to wild-type). (B) Colony formation by cells from a tetratype tetrad, germinated at 36°C for 3 days. WT, wild type (C) Characterization of the myo2-E1 swo1-w1 phenotype. Cells belonging to the swo1-w1 myo2-E1 genotype were rescued by tetrad dissection on medium containing sorbitol and then grown at 24°C in medium containing sorbital along with strains of wild-type, swo1-w1, and myo2-E1 genotypes. The cells were subsequently shifted to medium lacking sorbitol and stained for nuclei and septa using DAPI and aniline blue, respectively. (D) The restrictive temperature for growth of the double mutant strain swo1-w1 rng3-65 was lowered, with the double mutant being unable to grow at a temperature at which both individual mutant strains still formed colonies. (E) Cells of the rng3-65 strain and the swo1-w1 rng3-65 double mutant strain were grown at 32°C and stained with DAPI and aniline blue to visualize DNA and septa, simultaneously.

myo2-E1 and rng3-65 strains show a heightened sensitivity to the Hsp90 inhibitor geldanamycin. We then used pharmacological approach to independently study the role of Swo1p in myosin II assembly and/or function. The antibiotic geldanamycin specifically binds Hsp90 and disrupts its function (36). We assessed the ability of wild-type, myo2-E1, myo2-S1, myo2-S2, rng3-65, and cdc4-8 cells to form colonies on plates containing a low dose of geldanamycin (2 µg/ml). Interestingly, consistent with the genetic analysis presented above, myo2-E1, swo1-w1, and rng3-65 were sensitive to low doses of geldanamycin and showed only poor growth whereas myo2-S1, myo2-S2, and cdc4-8 were comparable to wild-type cells in their ability to form colonies (Fig. 4A). On treatment with geldanamycin and DAPI staining, wild-type cultures consisted of a population of mono- and binucleate cells (as seen in DMSO-treated cultures), while myo2-E1, swo1-w1, and rng3-65 cultures contained predominantly multinucleate cells with improperly organized division septa (Fig. 4B). DMSO-treated cells belonging to myo2-E1, swo1-w1, and rng3-65 strains did not display a multinucleate phenotype. Based on the genetic and pharmacological analyses, we concluded that Swo1p was important for myosin II structure and function. The genetic interaction between rng3-65 and swo1-w1, as well as the sensitivity of myo2-E1, rng3-65, and swo1-w1 cells to geldanamycin, suggested that Swo1p and Rng3p might collaborate to facilitate myosin II assembly and/or function.



View larger version (70K):
[in this window]
[in a new window]
  		FIG. 4. The mutant strains myo2-E1, rng3-65, and swo1-w1 show a heightened sensitivity to geldanamycin. (A) Tenfold serial dilutions of exponentially growing cells belonging to a wild-type (WT) strain, three allelic strains of the myo2 gene, and the cdc4-8, rng3-65, and swo1-w1 strains were spotted onto YES agar plates in the presence of 2 µg of geldanamycin (GD) per ml or DMSO as control and incubated at 24°C for 3 days. (B) DAPI and aniline blue staining to reveal nuclear number and septa, respectively, in cells of wild-type, swo1- w1, myo2-E1, and rng3-65 genotypes treated with either DMSO as control or 2 µg of geldanamcyin per ml.

Swo1p-GFP persists at the actomyosin ring only in the myo2-E1 strain. Rng3p is related to the myosin II cochaperone UNC-45p, which, together with Hsp90, prevents aggregation and misfolding of myosin II heads in C. elegans (6). Previous studies with fission yeast have shown that whereas Rng3p-GFP is detected as a weak cytoplasmic signal in wild-type cells, Rng3p-GFP is detected in the improperly formed actomyosin rings in cells harboring the myo2-E1 mutation but not in cells belonging to myo2-S1, myo2-S2, or other cytokinesis mutant strains (39). We therefore characterized the localization of Swo1p that was fused to GFP at its C terminus (as the sole Swo1p copy expressed from its native chromosomal promoter) in wild-type, myo2-E1, myo2-S1, myo2-S2, and 14 other strains that are defective in cytokinesis. As expected, Swo1p-GFP was detected as a strong and diffuse staining throughout the cytoplasm of wild-type cells, indicative of multiple targets that might depend on Swo1p for their folding, assembly, and function. Swo1p-GFP was also observed as a diffuse cytoplasmic signal in heat-arrested myo2-S1 and myo2-S2 cells and cells belonging to the other mutant strains. Interestingly, as with Rng3p-GFP, Swo1p-GFP was detected in the improperly organized actomyosin rings in heat-arrested myo2-E1 cells (Fig. 5A). The rings of Swo1p-GFP also underwent constriction at a semipermissive temperature, consistent with the ability of myo2-E1 cells to undergo actomyosin ring constriction and septum deposition inefficiently under such conditions (Fig. 5B). These studies established that Swo1p is enriched in the actomyosin ring when myosin II function is compromised as a consequence of the myo2-E1 mutant allele.



View larger version (91K):
[in this window]
[in a new window]
  		FIG. 5. Swo1p-GFP is detected at the division site in myo2-E1 cells but not in myo2-S1 or myo2-S2 cells. (A) Cells belonging to the wild-type (WT), myo2-S1, myo2-S2, and myo2-S2 genotype expressing Swo1p-GFP from the genomic locus were grown at 24°C, shifted to 32°C, and checked for Swo1p-GFP fluorescence. (B) Cells of the Swo1-GFP myo2-E1 strain growing at 24°C were shifted to 32°C for 4 h before being mounted for time-lapse analysis. Individual images from a time-lapse series obtained at 32°C using a heated microscope stage are shown.

Rng3p physically interacts with the Myo2p head domain and with Swo1p. We next attempted to obtain evidence for a direct physical association of the Myo2p head domain with Swo1p and Rng3p. Yeast two-hybrid analysis was used to check if Rng3p directly interacts with Swo1p and with the Myo2p head domain. Rng3p, Swo1p, and the head domain of Myo2p were cloned into yeast Matchmaker vectors, producing fusions to the binding and activation domains of the yeast transcriptional activator GAL4. Expression of the HIS3 reporter activity and levels of ß-galactosidase activity (Fig. 6A) indicated that a specific interaction existed between Rng3p and the head domain of Myo2p as well as between Rng3p and Swo1p. Evidence for a direct interaction between the Myo2p head domain and Swo1p was less clear in this assay. While viable His+ colonies were observed for this pair of interactors, the level of ß-galactosidase activity was below detectable limits. Control experiments involved the independent transformation of DNA-BD/target plasmid alone and AD/target plasmid, as shown in Fig. 6A. These control transformants did not show any ß-galactosidase activity and displayed greatly reduced HIS3 activity, ruling out any autonomous reporter gene activation.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 6. Physical interactions between Myo2p and Rng3p with Swo1p. (A) Cell suspensions of the S. cerevisiae strain Y190 carrying the indicated BD and AD plasmids were selected on synthetic complete medium lacking leucine and tryptophan and rescreened for HIS+ expression to select for strains containing pairs of interacting proteins. Colonies grown on histidine-minus medium with 3-aminotriazole (35 mM) were assayed for ß-galactosidase activity by a colony lift filter assay. (B) Cell extracts were prepared from myo2-E1, myo2-E1swo1-HAH, and myo2-E1 rng3-GFP strains and immunoprecipitated (IP) with anti-Myo2p antibodies, anti-HA antibodies, anti-GFP antibodies, or nonspecific control antibodies. Lanes: 1, myo2-E1 lysate; 2, myo2-E1 swo1-6HA lysate; 3, myo2-E1 swo1-6HA IP with anti-HA antibodies; 4, myo2-E1 swo1-6HA IP with anti-Myo2p antibodies; 5, myo2-E1 swo1 -6HA IP with nonspecific immunoglobulin G; 6, myo2-E1 IP with anti-HA antibodies; 7, myo2-E1 lysate; 8, myo2-E1 rng3-GFP lysate; 9, myo2-E1 rng3-GFP IP with anti-Myo2p antibodies; 10, myo2-E1 rng3-GFP IP with anti-GFP antibodies; 11, myo2-E1 rng3-GFP IP with nonspecific IgG; 12, myo2-E1 IP with anti-GFP antibodies.

To independently confirm the physical association of Myo2p with Rng3p and Swo1p in vivo, we carried out coimmunoprecipitation experiments. Localization of Rng3p and Swo1p to the actomyosin ring in myo2-E1 strains predicted the possibility of a stronger interaction of these proteins in the mutant background. Hence, we looked for evidence of a physical association of Myo2p, Rng3p, and Swo1p in a myo2-E1 strain background. Strains of the genotypes swo1-HA6His myo2-E1 and rng3-GFP myo2-E1 were generated and used for coimmunoprecipitation experiments (Fig. 6B). Both Rng3-GFP and Swo1-HA were recovered in immune complexes generated using anti-Myo2p antibodies (Fig. 6B, lanes 4 and 9, respectively) but not with control serum (lanes 5 and 11). Furthermore, mutant Myo2p was recovered when immune complexes were generated with antibodies against HA (HA-Swo1p) and GFP (Rng3p-GFP) (lanes 3 and 10, respectively). Cross-reactivity of anti-GFP and anti-HA antibodies to Myo2-E1p was ruled out (lanes 6 and 12). These data indicate that Swo1p and Hsp90p directly interacts with Myo2-E1p in vitro and suggest an association with Myo2p in vivo.

Myo2-E1p levels are reduced in the absence of Swo1p and Rng3p. Given that our data indicate a role for Rng3p and Swo1p in myosin function, we examined the stability of Myo2-E1p in rng3-65 and swo1-w1 mutant cells. It has previously been shown that the levels of myosin in myo2-E1 remain comparable to those in wild-type strains after 5 h of maintaining cultures at the restrictive temperature of 36°C (reference 38 and data not shown). Immunoblotting experiments using lysates from myo2-E1 rng3-65 and myo2-E1 swo1-w1 strains and anti-Myo2p antibodies indicated that the levels of Myo2-E1p in these strains were less than half of that seen in myo2-E1 cells (Fig. 7A and B). We infer, from these data, the involvement of both Rng3p and Swo1p in maintaining the native conformation and stability of Myo2p.



View larger version (36K):
[in this window]
[in a new window]
  		FIG. 7. Swo1p and Rng3p are required for the stability of myo2-E1p. (A) Lysates of the indicated strains were arrested at the restrictive temperature of 36°C for 5 h, resolved by SDS-PAGE (12% polyacrylamide), immunoblotted, and probed with antibodies against Myo2p and Arp3p. (B) The amount of myosin in the three strains as quantified by densitometry, after background substraction and normalization against Arp3p band intensity, was estimated and plotted.


arrow
DISCUSSION
 
The motor protein myosin is of central importance in eukaryotic motility, since it catalyzes diverse processes such as muscle contraction, transport of organelles, cytokinesis, and organization of the actin cytoskeleton. Most members of the myosin superfamily have a heavy chain consisting of a conserved ~ 80-kDa catalytic domain at the N terminus, followed by an {alpha}-helical light-chain binding region and a C-terminal rod-like tail domain (8). Variations within the tail domain and extensions in the N-terminal head region are the basis for sorting individual myosins into various classes. The head domain at the N terminus of myosin contains the sites for nucleotide hydrolysis and actin binding. Binding and hydrolysis of ATP at this domain leads to conformational changes that alter the affinity of myosin for actin, leading to the association-dissociation cycle that is central to force generation by this motor protein (31). While myosin tail fragments and myosin light chains appear to spontaneously adopt their functional conformation in nonnative systems (3, 32), the proper folding of head domains of recombinant myosins has not been as straightforward. Expression of an embryonic striated muscle myosin II motor domain, with GFP fused at its C terminus, in a functionally active form, was possible only in skeletal muscle myocytes and not in kidney epithelial cell lines (10). This indicated a folding dependency of the motor domain on muscle-specific factors.

Myo2p, one of two type II myosins in S. pombe, is an essential component of the actomyosin ring that constricts, concomitant with septum deposition, to effect cytokinesis (18, 22). An increasing amount of evidence indicates that Myo2p in S. pombe utilizes accessory proteins to facilitate its function. The first such protein, Rng3p, was isolated in the course of a large-scale screen designed to identify genes important for cytokinesis (4). Germinated spores carrying a null mutation for Rng3p were multinucleate with disorganized F-actin patches and defective septa, consistent with a defect in actomyosin ring assembly. A study of Rng3p localization in S. pombe indicated that Rng3-GFP was detected only in improperly assembled actomyosin rings at the restrictive temperature in myo2-E1 mutants and not in wild-type, myo2-S1, myo2-S2, or 18 other cytokinesis. mutants (39). The myo2-E1 mutation is a G345R point mutation in the head region of Myo2p between the F-actin and ATP-binding domains. Similarly, two rng3 mutant alleles, rng3-65 and rng3-A3, displayed synthetic lethality with myo2-E1 but not with 19 other mutants including the other 2 myosin mutant alleles, mutants defective in actomyosin ring assembly and placement, and mutants defective in regulation of septum synthesis (39). Rng3p was shown to be necessary for localization and maintenance of the type II myosin in S. pombe, Myo2p, in a spot structure that behaves as a progenitor for actomyosin ring formation (38).

Rng3p has a 400-residue conserved region at the C terminus referred to as a UCS domain (39). This has resulted in the classification of Rng3p as a member of the UCS-domain containing family of proteins, which have been characterized in fungi, budding yeast, nematodes, and higher organisms (17). Mutations in UCS-domain-containing proteins result in a diverse set of phenotypes such as disruption of the actin cytoskeleton, endocytosis defects, and defective sarcomere development (40). These have been directly and indirectly linked to interactions of UCS proteins with myosins of various classes such as I, II, and V. The two temperature-sensitive alleles of rng3 that have been isolated, rng3-65 and rng3-A3, both map to the conserved UCS domain and exhibit defects at the restrictive temperature that include cytokinesis failure, loss of the Myo2p progenitor spot at restrictive temperatures on treatment with hydroxyurea, and subsequent failure to form the actomyosin ring on release from the restrictive temperature in the absence of hydroxyurea (38, 39).

We now report the involvement of a second protein in Myo2p structure and function in S. pombe, the Hsp90 homolog Swo1p, and present the first in vivo data indicating that Swo1p and Rng3p cooperate in proper Myo2p function in the fission yeast S. pombe. Our characterization of the phenotype of a mutant allele of the fission yeast Hsp90-encoding gene, swo1-w1, reveals that the swo1-w1 mutant is defective in actomyosin ring assembly. The swo1-w1 mutant shows phenotypic similarities to myo2{Delta} and rng3{Delta} mutants. This evidence, combined with allele-specific genetic interactions between myo2-E1 and swo1-w1 as well as between rng3-65 and swo1-w1 mutant pairs, suggests that Swo1p probably participates in myosin II assembly and/or function in vivo. Moreover, partial reduction of Swo1p function by pharmacological treatment with the Hsp90 inhibitor geldanamycin resulted in severe cytokinesis defects in myo2-E1, rng3-65 cells, and swo1-w1 cells but did not affect myo2-S1, myo2-S2, cdc4-8, and wild-type cells at the concentrations used. As was observed with Rng3p, Swo1p-GFP has been detected in the improperly formed actomyosin rings in a myo2-E1 strain but not in wild-type cells. This observed colocalization may be attributed to their persistent association with myosin molecules having potentially misfolded head domains. An interaction between Swo1p and Rng3p with the Myo2p head domain may be too transient and/or diffuse to be detected in wild-type cells by fluorescence microscopy. Our evidence for chaperone-mediated folding of the myosin head domain is consistent with the results of immunofluorescence studies of differentiating C2C12 myocytes, which have revealed that GFP-tagged embryonic myosin heavy chain colocalizes with the molecular chaperones Hsc70 and Hsp90 in intermediates but not in the mature myofibrils (34). Geldanamycin treatment of C2C12 myocytes caused the formation of aggregates which contained myosin, Hsp90, and Hsc70, as detected by immunostaining with specific antibodies.

Our results substantiate in vitro studies performed using unc-45, the rng3 homolog in C. elegans. The UNC-45 protein is found throughout the thick filaments of body wall muscle sarcomeres (2) and has an N-terminal domain composed of three tetratricopeptide repeat (TPR) motifs and a C-terminal UCS domain (7, 35). In vitro binding assays revealed that UNC-45 formed stoichiometric complexes with scallop myosin head subfragment 1 (S1) and Hsp90, suggesting the formation of a ternary complex in which myosin binds the C-terminal region and Hsp90 binds the N-terminal region of UNC-45 (7). Evidence, using the S. pombe system, for a physical interaction between Rng3p and the head domain of Myo2p as well as between Rng3p and Swo1p was obtained using the yeast two-hybrid system and coimmunoprecipitation experiments with myo2-E1 mutant strains. Recent studies by Lord and Pollard (21) have also shown that S. pombe Rng3p physically interacts with Myo2p and might stimulate its activity. Our results also suggest that Rng3p and Swo1p is important for the stability of Myo2p. The mode of chaperone-assisted folding of the Myo2p-head in S. pombe is still open to speculation. Hsp90 in mammalian cells interacts with a host of other cochaperones that facilitate its interaction with nucleotides and client proteins (summarized on the webpage http://www.picard.ch/DP/downloads/Hsp90interactors.pdf). The cochaperones are divided into two classes based on the presence or absence of TPR domains that bind at the C-terminal MEEVD motif in Hsp90. Some of these cochaperones additionally interact with the client proteins and with each other. Rng3p in S. pombe lacks a TPR domain. The binding of Swo1p to Rng3p may therefore be either at an alternate region of Rng3p or via a hitherto unidentified protein. Future work will involve the identification and characterization of TPR domain-containing proteins and proteins displaying functional cooperation with Swo1p in S. pombe, with a view to characterizing the entire subset of proteins involved in folding the myosin head domain into its proper conformation.


arrow
ACKNOWLEDGMENTS
 
We are grateful to Juan Jimenez for providing the swo1-w1 strain, to Paul Russell for providing the swo1-26 and swo1-HA strains, to Keith Gull for providing the TAT-1 antibodies, and to Er Poh Nee (senior imaging facility engineer at Temasek Life Sciences Laboratory) for guidance with confocal microscopy. We thank all members of the yeast and fungal biology laboratories at the Temasek Life Sciences Laboratories for encouragement and advice.

This work was supported by research funds from the Temasek Life Sciences Laboratory.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Temasek Life Sciences Laboratory, 1 Research Link, The National University of Singapore, Singapore 117604. Phone: 65-6872-7478. Fax: 65-6872-7007. E-mail: mohan{at}tll.org.sg. Back


arrow
REFERENCES
 
    1
  1. Aligue, R., H. Akhavan-Niak, and P. Russell. 1994. A role for Hsp90 in cell cycle control: Wee1 tyrosine kinase activity requires interaction with Hsp90. EMBO J. 13:6099-6106.[Medline]
    2. 2
  2. Ao, W., and D. Pilgrim. 2000. Caenorhabditis elegans UNC-45 is a component of muscle thick filaments and colocalizes with myosin heavy chain B, but not myosin heavy chain A. J. Cell Biol. 148:375-384.[Abstract/Free Full Text]
    3. 3
  3. Atkinson, S. J., and M. Stewart. 1991. Expression in Escherichia coli of fragments of the coiled-coil rod domain of rabbit myosin: influence of different regions of the molecule on aggregation and paracrystal formation. J. Cell Sci. 99:823-836.[Abstract]
    4. 4
  4. Balasubramanian, M. K., D. McCollum, L. Chang, K. C. Wong, N. I. Naqvi, X. He, S. Sazer, and K. L. Gould. 1998. Isolation and characterization of new fission yeast cytokinesis mutants. Genetics 149:1265-1275.[Abstract/Free Full Text]
    5. 5
  5. Balasubramanian, M. K., D. McCollum, and K. L. Gould. 1997. Cytokinesis in fission yeast Schizosaccharomyces pombe. Methods Enzymol. 283:494-506.[Medline]
    6. 6
  6. Barral, J. M., C. C. Bauer, I. Ortiz, and H. F. Epstein. 1998. Unc-45 mutations in Caenorhabditis elegans implicate a CRO1/She4p-like domain in myosin assembly. J. Cell Biol. 143:1215-1225.[Abstract/Free Full Text]
    7. 7
  7. Barral, J. M., A. H. Hutagalung, A. Brinker, F. U. Hartl, and H. F. Epstein. 2002. Role of the myosin assembly protein UNC-45 as a molecular chaperone for myosin. Science 295:669-671.[Abstract/Free Full Text]
    8. 8
  8. Berg, J. S., B. C. Powell, and R. E. Cheney. 2001. A millennial myosin census. Mol. Biol. Cell 12:780-794.[Abstract/Free Full Text]
    9. 9
  9. Chang, F., A. Woollard, and P. Nurse. 1996. Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring. J. Cell Sci. 109:131-142.[Abstract]
    10. 10
  10. Chow, D., R. Srikakulam, Y. Chen, and D. A. Winkelmann. 2002. Folding of the striated muscle myosin motor domain. J. Biol. Chem. 277:36799-36807.[Abstract/Free Full Text]
    11. 11
  11. Clarke, M., and J. A. Spudich. 1974. Biochemical and structural studies of actomyosin-like proteins from non-muscle cells. Isolation and characterization of myosin from amoebae of Dictyostelium discoideum. J. Mol. Biol. 86:209-222.[CrossRef][Medline]
    12. 12
  12. Feierbach, B., and F. Chang. 2001. Cytokinesis and the contractile ring in fission yeast. Curr. Opin. Microbiol. 4:713-719.[CrossRef][Medline]
    13. 13
  13. Fujiwara, K., and T. D. Pollard. 1976. Fluorescent antibody localization of myosin in the cytoplasm, cleavage furrow, and mitotic spindle of human cells. J. Cell Biol. 71:848-875.[Abstract/Free Full Text]
    14. 14
  14. Fukui, Y., and S. Inoue. 1991. Cell division in Dictyostelium with special emphasis on actomyosin organization in cytokinesis. Cell Motil. Cytoskeleton 18:41-54.[CrossRef][Medline]
    15. 15
  15. Gietz, R. D., and R. H. Schiestl. 1995 Transforming yeast with DNA. Methods Mol. Cell. Biol. 5:255-269.
    16. 16
  16. Guertin, D. A., S. Trautmann, and D. McCollum. 2002. Cytokinesis in eukaryotes. Microbiol. Mol. Biol. Rev. 66:155-178.[Abstract/Free Full Text]
    17. 17
  17. Hutagalung, A. H., M. L. Landsverk, M. G. Price, and H. F. Epstein. 2002. The UCS family of myosin chaperones. J. Cell Sci. 115:3983-3990.[Abstract/Free Full Text]
    18. 18
  18. Kitayama, C., A. Sugimoto, and M. Yamamoto. 1997. Type II myosin heavy chain encoded by the myo2 gene composes the contractile ring during cytokinesis in Schizosaccharomyces pombe. J. Cell Biol. 137:1309-1319.[Abstract/Free Full Text]
    19. 19
  19. Le Goff, X., F. Motegi, E. Salimova, I. Mabuchi, and V. Simanis. 2000. The S. pombe rlc1 gene encodes a putative myosin regulatory light chain that binds the type II myosins myo3p and myo2p. J. Cell Sci. 113:4157-4163.[Abstract]
    20. 20
  20. Liu, J., H. Wang, D. McCollum, and M. K. Balasubramanian. 1999. Drc1p/Cps1p, a 1,3-beta-glucan synthase subunit, is essential for division septum assembly in Schizosaccharomyces pombe. Genetics 153:1193-1203.[Abstract/Free Full Text]
    21. 21
  21. Lord, M., and T. D. Pollard. 2004. UCS protein Rng3p activates actin filament gliding by fission yeast myosin-II. J. Cell Biol. 167:315-325.[Abstract/Free Full Text]
    22. 22
  22. May, K. M., F. Z. Watts, N. Jones, and J. S. Hyams. 1997. Type II myosin involved in cytokinesis in the fission yeast, Schizosaccharomyces pombe. Cell Motil. Cytoskeleton 38:385-396.[CrossRef][Medline]
    23. 23
  23. McCollum, D., M. K. Balasubramanian, L. E. Pelcher, S. M. Hemmingsen, and K. L. Gould. 1995. Schizosaccharomyces pombe cdc4+ gene encodes a novel EF-hand protein essential for cytokinesis. J. Cell Biol. 130:651-660.[Abstract/Free Full Text]
    24. 24
  24. Minet, M., P. Nurse, P. Thuriaux, and J. M. Mitchison. 1979. Uncontrolled septation in a cell division cycle mutant of the fission yeast Schizosaccharomyces pombe. J. Bacteriol. 137:440-446.[Abstract/Free Full Text]
    25. 25
  25. Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of the fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194:795-823.[Medline]
    26. 26
  26. Munoz, M. J., and J. Jimenez. 1999. Genetic interactions between Hsp90 and the Cdc2 mitotic machinery in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 261:242-250.[CrossRef][Medline]
    27. 27
  27. Naqvi, N. I., K. C. Wong, X. Tang, and M. K. Balasubramanian. 2000. Type II myosin regulatory light chain relieves auto-inhibition of myosin-heavy-chain function. Nat. Cell Biol. 2:855-858.[CrossRef][Medline]
    28. 28
  28. Nurse, P., P. Thuriaux, and K. Nasmyth. 1976. Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146:167-178.[CrossRef][Medline]
    29. 29
  29. Okazaki, K., N. Okazaki, K. Kume, S. Jinno, K. Tanaka, and H. Okayama. 1990. High-frequency transformation method and library transducing vectors for cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe. Nucleic Acids Res. 18:6485-6489.[Abstract/Free Full Text]
    30. 30
  30. Picard, D. 2002. Heat-shock protein 90, a chaperone for folding and regulation. Cell Mol. Life Sci. 59:1640-1648.[CrossRef][Medline]
    31. 31
  31. Rayment, I., W. R. Rypniewski, K. Schmidt-Base, R. Smith, D. R. Tomchick, M. M. Benning, D. A. Winkelmann, G. Wesenberg, and H. M. Holden. 1993. Three-dimensional structure of myosin subfragment-1: a molecular motor. Science 261:50-58.[Abstract/Free Full Text]
    32. 32
  32. Saraswat, L. D., and S. Lowey. 1991. Engineered cysteine mutants of myosin light chain 2. Fluorescent analogues for structural studies. J. Biol. Chem. 266:19777-19785.[Abstract/Free Full Text]
    33. 33
  33. Schmidt, S., M. Sohrmann, K. Hofmann, A. Woollard, and V. Simanis. 1997. The Spg1p GTPase is an essential, dosage-dependent inducer of septum formation in Schizosaccharomyces pombe. Genes Dev. 11:1519-1534.[Abstract/Free Full Text]
    34. 34
  34. Srikakulam, R., and D. A. Winkelmann. 2004. Chaperone-mediated folding and assembly of myosin in striated muscle. J. Cell Sci. 117:641-652.[Abstract/Free Full Text]
    35. 35
  35. Venolia, L., W. Ao, S. Kim, C. Kim, and D. Pilgrim. 1999. unc-45 gene of Caenorhabditis elegans encodes a muscle-specific tetratricopeptide repeat-containing protein. Cell Motil. Cytoskeleton 42:163-177.[CrossRef][Medline]
    36. 36
  36. Whitesell, L., E. G. Mimnaugh, B. De Costa, C. E. Myers, and L. M. Neckers. 1994. Inhibition of heat shock protein HSP90-pp60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation. Proc. Natl. Acad. Sci. USA 91:8324-8328.[Abstract/Free Full Text]
    37. 37
  37. Wang H., X. Tang, J. Liu, S. Trautmann, D. Balasundaram, D. McCollum, and M. K. Balasubramanian. 2002. The multiprotein exocyst complex is essential for cell separation in Schizosaccharomyces pombe. Mol. Biol. Cell 13:515-529.[Abstract/Free Full Text]
    38. 38
  38. Wong, K. C., V. M. D'Souza, N. I. Naqvi, F. Motegi, I. Mabuchi, and M. K. Balasubramanian. 2002. Importance of a myosin II-containing progenitor for actomyosin ring assembly in fission yeast. Curr. Biol. 12:724-729.[CrossRef][Medline]
    39. 39
  39. Wong, K. C., N. I. Naqvi, Y. Iino, M. Yamamoto, and M. K. Balasubramanian. 2000. Fission yeast Rng3p: an UCS-domain protein that mediates myosin II assembly during cytokinesis: J. Cell Sci. 113:2421-2432.[Abstract]
    40. 40
  40. Yu, Q., and S. I. Bernstein. 2003. UCS proteins: managing the myosin motor. Curr. Biol. 13:R525-R527.[CrossRef][Medline]

Eukaryotic Cell, March 2005, p. 567-576, Vol. 4, No. 3
1535-9778/05/$08.00+0     doi:10.1128/EC.4.3.567-576.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Pai, C. C., Garcia, I., Wang, S. W., Cotterill, S., MacNeill, S. A., Kearsey, S. E. (2009). GINS Inactivation Phenotypes Reveal Two Pathways for Chromatin Association of Replicative {alpha} and {varepsilon} DNA Polymerases in Fission Yeast. Mol. Biol. Cell 20: 1213-1222 [Abstract] [Full Text]  
  • Antonov, A., Snead, C., Gorshkov, B., Antonova, G. N., Verin, A. D., Catravas, J. D. (2008). Heat Shock Protein 90 Inhibitors Protect and Restore Pulmonary Endothelial Barrier Function. Am. J. Respir. Cell Mol. Bio. 39: 551-559 [Abstract] [Full Text]  
  • Lord, M., Sladewski, T. E., Pollard, T. D. (2008). Yeast UCS proteins promote actomyosin interactions and limit myosin turnover in cells. Proc. Natl. Acad. Sci. USA 105: 8014-8019 [Abstract] [Full Text]  
  • Liu, L., Srikakulam, R., Winkelmann, D. A. (2008). Unc45 Activates Hsp90-dependent Folding of the Myosin Motor Domain. J. Biol. Chem. 283: 13185-13193 [Abstract] [Full Text]  
  • Alaamery, M. A., Hoffman, C. S. (2008). Schizosaccharomyces pombe Hsp90/Git10 Is Required for Glucose/cAMP Signaling. Genetics 178: 1927-1936 [Abstract] [Full Text]  
  • Etard, C., Roostalu, U., Strahle, U. (2008). Shuttling of the chaperones Unc45b and Hsp90a between the A band and the Z line of the myofibril. JCB 180: 1163-1175 [Abstract] [Full Text]  
  • Du, S. J., Li, H., Bian, Y., Zhong, Y. (2008). Heat-shock protein 90{alpha}1 is required for organized myofibril assembly in skeletal muscles of zebrafish embryos. Proc. Natl. Acad. Sci. USA 105: 554-559 [Abstract] [Full Text]  
  • Bazzaro, M., Santillan, A., Lin, Z., Tang, T., Lee, M. K., Bristow, R. E., Shih, I.-M., Roden, R. B.S. (2007). Myosin II Co-Chaperone General Cell UNC-45 Overexpression Is Associated with Ovarian Cancer, Rapid Proliferation, and Motility. Am. J. Pathol. 171: 1640-1649 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mishra, M.
Right arrow Articles by Balasubramanian, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mishra, M.
Right arrow Articles by Balasubramanian, M. K.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»